ID: 1006258883

View in Genome Browser
Species Human (GRCh38)
Location 6:32852588-32852610
Sequence GCCCTCCAGGATAATGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 192}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006258883_1006258887 -10 Left 1006258883 6:32852588-32852610 CCCTCACCATTATCCTGGAGGGC 0: 1
1: 0
2: 2
3: 15
4: 192
Right 1006258887 6:32852601-32852623 CCTGGAGGGCATCAGCAGAAAGG 0: 1
1: 0
2: 0
3: 18
4: 235
1006258883_1006258888 24 Left 1006258883 6:32852588-32852610 CCCTCACCATTATCCTGGAGGGC 0: 1
1: 0
2: 2
3: 15
4: 192
Right 1006258888 6:32852635-32852657 TCTCAATCCCGAACCTAAATAGG 0: 1
1: 0
2: 0
3: 4
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006258883 Original CRISPR GCCCTCCAGGATAATGGTGA GGG (reversed) Intronic
902680572 1:18041235-18041257 GCCCCTCAGGATAATGGTGAGGG + Intergenic
903609282 1:24598348-24598370 GACCTCTAGGATACTGGTGGTGG - Intronic
906167561 1:43698268-43698290 GCCCTCAAGGATAATTTAGACGG - Intronic
910002919 1:82359494-82359516 GCCCCCCAGGAAAGTGGAGAAGG + Intergenic
911121584 1:94302237-94302259 TCCCTCCTGGAAGATGGTGATGG - Intergenic
911148229 1:94571806-94571828 GCCCCCCAGGAAAGTGGAGAAGG + Intergenic
912733263 1:112128367-112128389 TCCCTTAAGGATAGTGGTGAAGG - Intergenic
913666849 1:121056739-121056761 GCCCTCCTGGACCATGGTAAGGG - Intergenic
914018593 1:143844175-143844197 GCCCTCCTGGACCATGGTAAGGG - Intergenic
914657148 1:149752378-149752400 GCCCTCCTGGACCATGGTAAGGG - Intergenic
915034126 1:152908475-152908497 TCCCTCCAGGTTGAAGGTGATGG - Intergenic
915043220 1:152985653-152985675 GCCCTCCAGAATGAGGGTAAGGG - Intergenic
916328700 1:163592190-163592212 GCCCCCCAGGAAAGTGGAGAAGG - Intergenic
916563974 1:165957248-165957270 TCACTCCAGGATCATGCTGATGG + Intergenic
920007301 1:202842808-202842830 GCCCTGCAGGATAAGGGCTAAGG + Intergenic
920186746 1:204164159-204164181 GCACTCCAGGATAAAGGTAGAGG - Intronic
920297590 1:204968392-204968414 ACCCTCCAGGAGGATGGGGATGG + Intronic
921082431 1:211753145-211753167 ACTCACCAGGACAATGGTGAAGG - Intronic
921703438 1:218292364-218292386 GCCCACAAGCATAATGCTGACGG - Intronic
923523366 1:234753316-234753338 GCCTTACAAGATAATGGAGATGG + Intergenic
923998268 1:239521395-239521417 GCCTTCCAGGAGAATGAAGAAGG - Intronic
1065027522 10:21553022-21553044 AAACTCCAAGATAATGGTGAAGG - Intronic
1065546404 10:26825969-26825991 GCCCTCATGGATGATGCTGAGGG - Intronic
1067360162 10:45572075-45572097 GCCCCCCAGGAAAGTGGAGAAGG - Intronic
1067360181 10:45572133-45572155 GCCCCCCAGGAAAGTGGAGAAGG - Intronic
1067360200 10:45572191-45572213 GCCCCCCAGGAAAGTGGAGAAGG - Intronic
1068327089 10:55506172-55506194 TCCCTCCAGGAGAAAGATGAAGG + Intronic
1071821535 10:89285717-89285739 GCCCCCCAGGAAAGTGGAGAAGG - Intronic
1072360525 10:94654609-94654631 TCCCTGAAGGACAATGGTGAAGG + Intergenic
1072833410 10:98684183-98684205 AATCCCCAGGATAATGGTGAAGG + Intronic
1073567285 10:104546004-104546026 GCCCTCATGGATGCTGGTGAGGG - Intergenic
1075266250 10:121001608-121001630 GCCTTTCAGGATGGTGGTGAGGG - Intergenic
1076264292 10:129097636-129097658 GCCCTGCAGAATACTGGAGATGG + Intergenic
1077848048 11:6046580-6046602 GGCCTCCAGGTGGATGGTGATGG + Intergenic
1081214023 11:40372224-40372246 GCCATGGAGGATAATGGTGAAGG + Intronic
1086550036 11:88044317-88044339 GCCCCCCAGGAAAGTGGAGAAGG - Intergenic
1090588931 11:128244452-128244474 CCCCTCCAAGAGAAGGGTGATGG + Intergenic
1091138966 11:133219078-133219100 CCCATCCATGATAATGGTCAAGG - Intronic
1091212474 11:133873958-133873980 TCCCTGAAGGACAATGGTGAAGG + Intergenic
1091694831 12:2621459-2621481 GCCCTTCAGGATCACGGTGAGGG + Intronic
1093621045 12:21289471-21289493 GACCTCCAGGAGAATGGAGTGGG + Intronic
1093752746 12:22819518-22819540 GTCCTGAAGGATAGTGGTGAAGG + Intergenic
1095461427 12:42448312-42448334 GCCTACCAGAATAATGCTGATGG - Intronic
1097391088 12:59014167-59014189 GCCCTCCAGGAGTCTGCTGATGG - Intergenic
1097693964 12:62759717-62759739 GCCCCCCAGGAAAGTGGAGAAGG - Intronic
1102660643 12:114524618-114524640 TTCCTCCAGGCTAAGGGTGATGG - Intergenic
1104635292 12:130434694-130434716 GCCCACCAGGAGGATGGTGTGGG + Intronic
1105742928 13:23347637-23347659 GCCCTACAGTCTAATGGAGAAGG + Intronic
1106595018 13:31128343-31128365 GCCTTCCACCATAATTGTGAGGG + Intergenic
1117641717 14:57807275-57807297 CCCCTCCAGGAGGAGGGTGAAGG - Intronic
1118749619 14:68796140-68796162 GCGCTCCAGGCGAATGGGGAGGG - Intronic
1119978561 14:79053780-79053802 GGCCAGCAGGATAATGGTTATGG + Intronic
1120143863 14:80957927-80957949 GCCCTTGAGAATAATGGAGAGGG + Intronic
1120145030 14:80970030-80970052 GCCCTAAAGGATAGTGGTGAAGG - Intronic
1121087534 14:91157951-91157973 GCCCTCTAGGGTAATAATGAGGG + Intronic
1121345045 14:93129392-93129414 ACCCTCCAGGGTCATGGGGAAGG + Intergenic
1123882647 15:24690090-24690112 GCCCCCCAGGAAACTGGAGAAGG + Intergenic
1124047548 15:26164097-26164119 GTCATCCATGAGAATGGTGAGGG + Intergenic
1125848930 15:42885688-42885710 GCCCCCCAGGAAAGTGGAGAAGG - Intronic
1129331370 15:74829308-74829330 GCCCCCCAGAAGAATAGTGAAGG + Intronic
1129411783 15:75354411-75354433 GCCCTGCAGGACACTGGTGTTGG - Exonic
1132359264 15:101198937-101198959 GGGCTCCAGCATAAAGGTGAAGG - Intronic
1143172655 17:4939086-4939108 TGCCTTCAGGATACTGGTGAGGG + Exonic
1143549175 17:7618784-7618806 GATCCCCAGGATAAAGGTGAAGG + Intronic
1145797486 17:27664276-27664298 GCCCTCCAGGCTGTTGGTGCTGG - Intergenic
1146315776 17:31805760-31805782 GCCTTCCAGGAGAATGGCCAGGG + Intergenic
1146487922 17:33259086-33259108 GCCATTCCGGGTAATGGTGAGGG + Intronic
1147419551 17:40315581-40315603 GCCCTCCAAGACCATGGTGCGGG - Intronic
1149992597 17:61391248-61391270 GCCCTTCAGGTTGATGCTGAGGG + Intronic
1150907893 17:69358092-69358114 GTTCTCCAGGATGCTGGTGATGG + Intergenic
1151081998 17:71340237-71340259 GCCCTAAAGGACTATGGTGAAGG + Intergenic
1151319647 17:73344816-73344838 GCCGTTCAGTAGAATGGTGACGG + Intronic
1154194413 18:12254948-12254970 GCCCTCCAGGTTGGTGGTGCTGG + Intronic
1156118508 18:33816159-33816181 TCCCTGCAGGACAGTGGTGAAGG + Intergenic
1156237195 18:35216923-35216945 GCCCCCCAGGAAAGTGGTGAAGG - Intergenic
1156998636 18:43498161-43498183 TCCCTGAAGGACAATGGTGAAGG + Intergenic
1161711035 19:5848184-5848206 GCCCCCCAGGAAAATGGAAACGG - Intronic
1163635668 19:18436191-18436213 GCCCTCCAGGATGCTGGCCACGG + Exonic
1165797292 19:38526511-38526533 GCCCTCAAGGACCAAGGTGAGGG - Intronic
1166077419 19:40421641-40421663 GCTCTCCAGGAAAATGGGGGAGG - Exonic
1166430776 19:42725105-42725127 GACCTCTAGGCTAATGATGATGG + Intronic
1166451237 19:42903135-42903157 GACCTCAAGGCTAATGATGATGG + Intronic
1166480768 19:43171215-43171237 GACCTCAAGGCTAATGATGATGG + Intronic
1166490348 19:43254333-43254355 GACCTCAAGGCTAATGATGATGG + Intronic
925153113 2:1630163-1630185 GCCCTCATGGATAACGCTGAGGG + Intergenic
928778134 2:34790863-34790885 GCCCTCCAGAAAAGTGGAGAAGG - Intergenic
930295159 2:49544949-49544971 TCCCTGAAGGACAATGGTGAAGG - Intergenic
931714513 2:65018604-65018626 GGCCTCCAGGATAATGGCAATGG - Exonic
932159671 2:69448386-69448408 GCCCTCCAGGAAAGTGGAAAAGG + Intergenic
932697572 2:73969503-73969525 GGCCTCCAGGATCATGGGGGAGG - Intergenic
934305807 2:91821028-91821050 TCCCTGCAGGACAGTGGTGAAGG + Intergenic
934327449 2:92031714-92031736 TCCCTGCAGGACAGTGGTGAAGG - Intergenic
937015612 2:118602676-118602698 ACACTCCAGGAGAAAGGTGAGGG + Intergenic
944463527 2:199977369-199977391 GCTCTCCAGGATATTGGTCTGGG - Intronic
946871951 2:224092477-224092499 GCCCCCCAGGAAAGTGGAGAAGG + Intergenic
1169798135 20:9487254-9487276 ACCTTCCAGGATGATGGTGATGG + Intergenic
1172792463 20:37515338-37515360 GCCCTCCAGGCTAATGGGAAAGG - Intronic
1173154601 20:40596899-40596921 GCCATACAGCATAGTGGTGAAGG + Intergenic
1176782551 21:13215411-13215433 GCCCTCCAGGACATTGGTCTGGG - Intergenic
1177031345 21:15984368-15984390 GCCCCCCAGGAAAGTGGAGAAGG + Intergenic
1181347814 22:22233126-22233148 CCCCTGTAGGATCATGGTGATGG - Intergenic
1184235858 22:43182664-43182686 ACCCTCCAGGTTAAGGGTGCAGG - Intronic
951233668 3:20209814-20209836 GCCCTTCAGGACTATGTTGATGG + Intergenic
951762967 3:26164940-26164962 GCCCCCCAGGAAAGTGGAGAAGG + Intergenic
952554316 3:34514604-34514626 TGCCTCCAGGATCATGTTGAGGG - Intergenic
955098810 3:55826894-55826916 GCCCTCCAGGAGAATTGGGCAGG - Intronic
955253196 3:57304838-57304860 GCCCCCCAGGAAAGTGGAGAAGG - Intronic
956910864 3:73815524-73815546 GCCCTCCACCATGATCGTGAGGG + Intergenic
961262907 3:125616835-125616857 TCCCTGAAGGACAATGGTGAGGG + Intergenic
962334365 3:134513162-134513184 AACCTCCAGAATAATGATGAAGG - Intronic
964941134 3:162158754-162158776 GCCCTCCAGGAAAGTGGAAATGG + Intergenic
964941259 3:162159144-162159166 GCCCCCCAGGAAAGTGGAGAAGG + Intergenic
965862170 3:173160590-173160612 GCCCTCCAGGAAAGTGGAGAAGG + Intergenic
966397494 3:179517995-179518017 GCCCCCCAGGAAAGTGGAGAAGG - Intergenic
967570804 3:191026286-191026308 TCCCTGAAGGACAATGGTGAAGG - Intergenic
969346946 4:6575758-6575780 GCCCCCCAGGACAGGGGTGAAGG + Intronic
970941664 4:21641380-21641402 TACCTGAAGGATAATGGTGAAGG + Intronic
971308701 4:25505793-25505815 GCCCTCCAGGATGCTGGCCACGG - Intergenic
971329124 4:25667898-25667920 GGCCCCCATGATAATGGGGATGG - Exonic
972492248 4:39598920-39598942 ACCTTCCAGGATAATGGTGAAGG - Intronic
972962178 4:44466946-44466968 ACTCTCCAGGATATTGGTGTGGG + Intergenic
973975494 4:56258648-56258670 GCCCTGAAGGACAGTGGTGAAGG + Intronic
974225233 4:59033597-59033619 GTTCTCCAGGATAATGGAGTGGG - Intergenic
974701257 4:65450475-65450497 GCCCCTCAGCATAATGGTCATGG - Intronic
977225502 4:94388013-94388035 GCCCCCCAGAAAAGTGGTGAAGG + Intergenic
977782610 4:100996357-100996379 GCCCCCCAGGAAAGTGGAGAAGG + Intergenic
977782634 4:100996431-100996453 GCCCCCCAGGAAAGTGGAGAAGG + Intergenic
979640871 4:123011981-123012003 GCCCCCCAGGAAAGTGGAGAAGG + Intronic
979640890 4:123012043-123012065 GCCCCCCAGGAAAGTGGAGAAGG + Intronic
979640918 4:123012142-123012164 GCCCCCCAGGAAAGTGGAGAAGG + Intronic
979640997 4:123012398-123012420 GCCCCCCAGGAAAGTGGAGAAGG + Intronic
979648728 4:123105653-123105675 GCCCTCAGGGATAATTTTGAGGG + Intronic
983883933 4:172960956-172960978 GCCCTCCAGGAAAGTGGAGAAGG + Intronic
983883965 4:172961073-172961095 GCCCTCCAGGAAAGTGGAGAAGG + Intronic
983883999 4:172961190-172961212 GCCCTCCAGGAAAGTGGAGAAGG + Intronic
984165517 4:176299404-176299426 GCCCCCCAGGAAAGTGGAGAAGG + Intergenic
985885792 5:2676662-2676684 GCCCACCAGGATAATGCAGAAGG - Intergenic
986036982 5:3950017-3950039 TCCCTGAAGGATAGTGGTGAAGG - Intergenic
986644877 5:9907156-9907178 GGCCTCCAGGAGAATGGACAGGG + Intergenic
986697738 5:10373639-10373661 GCCCTCCAGGAACATCGTGACGG - Intronic
986886676 5:12246308-12246330 GCTCTCCAGCATAATGGCAAGGG + Intergenic
987163066 5:15165221-15165243 GACCTCAAGGATAATGTTAATGG + Intergenic
988704939 5:33716282-33716304 GAAGTCCAAGATAATGGTGAAGG - Intronic
989097892 5:37797751-37797773 TCCCTGAAGGATAGTGGTGAAGG + Intergenic
992452217 5:76885297-76885319 GCCCCCCAGGAAAGTGGAGAAGG + Intronic
992452367 5:76885740-76885762 GCCCCCCAGGAAAGTGGAGAAGG + Intronic
992452435 5:76886056-76886078 GCCCCCCAGGAAAGTGGAGAAGG + Intronic
994311275 5:98274171-98274193 ACTCTCCAGGATATTGGTGCGGG + Intergenic
994375991 5:99015998-99016020 GCCCCCCAGGAAAGTGGAGAAGG + Intergenic
995125375 5:108573368-108573390 GCCCTCCAGAAAAGTGGAGAAGG + Intergenic
995125394 5:108573431-108573453 GCCCTCCAGAAAAGTGGAGAAGG + Intergenic
996392146 5:122973358-122973380 GCCCTGAAGGACAGTGGTGAAGG - Intronic
999254515 5:150202608-150202630 GCCAGCCAGGATGCTGGTGATGG - Exonic
1000885494 5:166743658-166743680 GCCCCCCAGGAAAGTGGAGAAGG + Intergenic
1002998027 6:2305192-2305214 TCCCTGAAGGACAATGGTGAAGG + Intergenic
1003138718 6:3454677-3454699 GCCCTGCAAGGTAATGGGGAAGG - Intronic
1005740751 6:28788305-28788327 TCCCTCCTGGATACTGGTTATGG + Intergenic
1006010325 6:31037680-31037702 GCCCTGCAGGACAGTGGGGAAGG - Intergenic
1006258883 6:32852588-32852610 GCCCTCCAGGATAATGGTGAGGG - Intronic
1006636695 6:35466377-35466399 GCCCTTCAGGAAGCTGGTGATGG - Exonic
1006688484 6:35858797-35858819 AATCTCCAGGATGATGGTGAAGG + Intronic
1008389548 6:50933853-50933875 ACCATCCACGATCATGGTGAGGG - Intergenic
1008959958 6:57256306-57256328 GCCCTGTAGGGTGATGGTGAGGG - Intergenic
1010841482 6:80652390-80652412 GCCCCCCAGGAAAGTGGAGAAGG + Intergenic
1012730523 6:102874752-102874774 TCCCTGAAGGACAATGGTGAAGG + Intergenic
1013406729 6:109850237-109850259 TCCCTGAAGGATAGTGGTGAAGG + Intergenic
1014611907 6:123557776-123557798 GCCCCCCAGGAAAGTGGAGAAGG - Intronic
1018077418 6:160229583-160229605 GCCCCCCAGGAAAGTGGAGAAGG - Intronic
1019387146 7:763675-763697 GCCTGCCAGGATAATCGGGAGGG - Intronic
1020548839 7:9572194-9572216 GCCCTCCAGAATAACTTTGAAGG - Intergenic
1020714099 7:11648212-11648234 GCTCTAAAGGATAATGGTGGAGG - Intronic
1022500331 7:30878592-30878614 CCCCTCCAGGCTGATGGTCATGG + Intronic
1023904498 7:44512784-44512806 CCCCTCCTGGAAAATGGTGTTGG - Exonic
1024058845 7:45683417-45683439 GCCCTGAGGGACAATGGTGAAGG - Intronic
1024522356 7:50316568-50316590 TCCCTCCAGGAGACTGGTGCGGG + Intronic
1024526486 7:50354012-50354034 GCCCTCCAGGATGATGCTATGGG - Intronic
1024681713 7:51696868-51696890 GCCCTAGAGGGTAAAGGTGAAGG + Intergenic
1024776041 7:52787388-52787410 GCTGCCCAGGACAATGGTGAAGG - Intergenic
1026550500 7:71364403-71364425 GCCCAGCAGGATATTGGTGGAGG - Intronic
1027157595 7:75779860-75779882 GCCCTCCAGGAAAGTGGAAAAGG - Intronic
1027289811 7:76694225-76694247 GCCCTCATGGATAATTTTGAGGG + Intergenic
1027640577 7:80728742-80728764 GCTTTCCAGGAGAAGGGTGAGGG - Intergenic
1030675727 7:112383813-112383835 GCCCTCCAGGGTCATGGAGGTGG + Intergenic
1030957843 7:115877397-115877419 GCCCTATAGGATAATTGTGTAGG + Intergenic
1034406254 7:150904423-150904445 TCCCTCCAGGACAGTGGTGGAGG + Intergenic
1035493977 7:159305812-159305834 GTCCTCCAGGTTAATAGAGATGG + Intergenic
1035881036 8:3244376-3244398 GCTCTCCAGGGTAATGGGGGAGG - Intronic
1041964712 8:63662709-63662731 GGCCTCCAGTATAATGGTTAAGG + Intergenic
1043992501 8:86773394-86773416 GCCCTGAAGGACAATGGTGAAGG + Intergenic
1048479708 8:134777528-134777550 GCCTTTTAGGGTAATGGTGAAGG + Intergenic
1049161233 8:141099289-141099311 GCCCTCCAGGTGGATGGTGTTGG - Intergenic
1050205448 9:3191567-3191589 AACCTCCAGGATAATGGCCAGGG + Intergenic
1050473976 9:6021038-6021060 GCCCCCCAGGAAAGTGGAGAAGG - Intergenic
1055347887 9:75356341-75356363 GCCCTCCAGAAAAGTGGAGAAGG + Intergenic
1057970134 9:99547151-99547173 GACCTCCAGGAAAATGGTCTGGG - Intergenic
1061308437 9:129746310-129746332 GCCCTCCTGGACAGTGGAGAAGG - Intronic
1061582891 9:131548218-131548240 GCCCCCCAGGAAAGTGGAGAAGG - Intergenic
1185885983 X:3783268-3783290 GCCCTCCAGCACAATGCTTAGGG - Intergenic
1192142540 X:68658230-68658252 GCCTTGCAGGATTATTGTGATGG - Intronic
1192375021 X:70550312-70550334 GCTCTCCAGGATATTGGAGTAGG + Intronic
1192705929 X:73528675-73528697 GCCCCCCAGGAAAGTGGAGAAGG - Intergenic
1195291345 X:103434177-103434199 GCCCCCCAGGAAAGTGGAGAAGG + Intergenic
1195327033 X:103766351-103766373 GCCCCCCAGGAAAGTGGAGAAGG + Intergenic
1196114898 X:111988385-111988407 GCACTCCAGTTTAATGGAGATGG + Intronic
1196426695 X:115576986-115577008 GTGCTCCAGGACAATGGTGGAGG + Intronic
1196940259 X:120768730-120768752 GCACTCTAGACTAATGGTGATGG + Intergenic
1198965717 X:142227580-142227602 GCCCCCCAGGAAAGTGGAGAAGG - Intergenic
1198965730 X:142227617-142227639 GCCCCCCAGGAAAGTGGAGAAGG - Intergenic
1199377830 X:147133771-147133793 GCCCCCCAGGAAAGTGGAGAAGG + Intergenic
1201473655 Y:14359001-14359023 GCCCCCCAGGAAAGTGGAGAAGG + Intergenic