ID: 1006258897

View in Genome Browser
Species Human (GRCh38)
Location 6:32852677-32852699
Sequence AGTTCTGGTAGAGCAACCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 77}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006258897_1006258901 -2 Left 1006258897 6:32852677-32852699 CCTGTGGTTGCTCTACCAGAACT 0: 1
1: 0
2: 0
3: 5
4: 77
Right 1006258901 6:32852698-32852720 CTTTCAGGATTTTATTAGGAAGG 0: 1
1: 0
2: 1
3: 18
4: 241
1006258897_1006258900 -6 Left 1006258897 6:32852677-32852699 CCTGTGGTTGCTCTACCAGAACT 0: 1
1: 0
2: 0
3: 5
4: 77
Right 1006258900 6:32852694-32852716 AGAACTTTCAGGATTTTATTAGG 0: 1
1: 0
2: 3
3: 40
4: 340
1006258897_1006258902 2 Left 1006258897 6:32852677-32852699 CCTGTGGTTGCTCTACCAGAACT 0: 1
1: 0
2: 0
3: 5
4: 77
Right 1006258902 6:32852702-32852724 CAGGATTTTATTAGGAAGGCTGG 0: 1
1: 1
2: 0
3: 10
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006258897 Original CRISPR AGTTCTGGTAGAGCAACCAC AGG (reversed) Intronic
900083688 1:876566-876588 GGTTCAGCTACAGCAACCACTGG + Intergenic
900387011 1:2415284-2415306 ATTTTAGGGAGAGCAACCACAGG + Intergenic
903134933 1:21303086-21303108 AGTTCTGGGAAAGCAGCCAGTGG - Intronic
906866715 1:49428980-49429002 AGTTCTTGATGAGCTACCACAGG + Intronic
907438624 1:54464953-54464975 AGCTCTGGCAGAGCAGTCACAGG + Intergenic
910113007 1:83701921-83701943 AGTGCTGGTTAAGCAAACACCGG - Intergenic
911536419 1:99105963-99105985 AGTGCGGGTAGAGCACCAACTGG + Intergenic
921329553 1:214021880-214021902 TGTTCTTGTAGATCAAGCACTGG + Intronic
924113677 1:240725195-240725217 AGTTCTTGTAGAGAAAAAACAGG + Intergenic
1066580537 10:36875629-36875651 AGTGCTGGTAGAACCAGCACTGG + Intergenic
1075807956 10:125203607-125203629 AGTTCTGGGAGGGCTCCCACAGG - Intergenic
1078157958 11:8814976-8814998 AGTTCTGGGAAACAAACCACAGG - Intronic
1079437720 11:20474517-20474539 AGTCCTGGCAGAGCAGCCGCTGG - Intronic
1081276364 11:41154141-41154163 AATTTTGCTAAAGCAACCACTGG + Intronic
1084431670 11:69114701-69114723 ACTTCTGGAAGAGCAGCCATAGG - Intergenic
1088421447 11:109652487-109652509 AGTTCTGACAAAGCATCCACAGG + Intergenic
1089606076 11:119642162-119642184 AGTTCTGGGAGAGGGTCCACCGG + Intronic
1093084051 12:14847137-14847159 AGTTCTGGCAGGGAAATCACAGG + Intronic
1093363294 12:18259211-18259233 AGTTCTGATAGAGTATCTACTGG - Intronic
1097717923 12:62986165-62986187 AGTTCTTCTAGAGCACTCACTGG - Intergenic
1098413599 12:70207796-70207818 ATTTCTAGTAGAGCTAACACAGG + Intergenic
1103539059 12:121653315-121653337 AGCTCTGGAAGAGCGACCCCTGG - Intronic
1105441700 13:20420641-20420663 ACTTAGGGTAGAGCAAACACAGG + Intronic
1116617381 14:47155632-47155654 AGGGCTGTTTGAGCAACCACAGG - Intronic
1117280949 14:54240345-54240367 AGTTCTGCTTGAGCATCCATTGG - Intergenic
1117338623 14:54775524-54775546 AGCTCTGGTGGAGCATCCACAGG + Intronic
1117495708 14:56300709-56300731 ATTTCTGATAGACAAACCACAGG + Exonic
1120327704 14:83051357-83051379 AGTTCTGAGAGAGGACCCACAGG + Intergenic
1120509681 14:85398316-85398338 TGTTCAGGTTGAGCAAGCACTGG - Intergenic
1129198995 15:73987568-73987590 AGTTGTGTTAGATCAAGCACTGG + Intronic
1130061858 15:80576185-80576207 AGTTCTGGGTGAGGAAGCACAGG - Intronic
1131938846 15:97538518-97538540 GGTTCTGGTAGAGAAACAAGAGG - Intergenic
1134782229 16:16908675-16908697 AGTTTTGCTATGGCAACCACTGG + Intergenic
1143037082 17:4005454-4005476 AGTTCTGGTAGAACCATCCCGGG - Exonic
1144221525 17:13104351-13104373 AGGTCTGGTAGAGAAACAAGGGG - Intergenic
1150316363 17:64172437-64172459 AGTTCACGCAGACCAACCACTGG - Intronic
1154315254 18:13298924-13298946 AATTCTGGGGGAGCATCCACAGG + Intronic
1159883187 18:73879038-73879060 TGTTCTGGTGGAGCTACCTCTGG + Intergenic
1160165599 18:76508278-76508300 AGTTTTGTTTGAGCAACCTCAGG + Intergenic
934900006 2:98152144-98152166 AGTTGTGGTAGAGGAAGGACAGG - Intronic
941933181 2:170962913-170962935 AGTTCTGGTAAGCCAACCCCTGG - Exonic
943147032 2:184058684-184058706 AGTTGTGATAGAGTATCCACTGG - Intergenic
944535118 2:200701549-200701571 AGTTCTGGTAAAGCAAGCTCAGG + Intergenic
1168995307 20:2128693-2128715 AGTGCTGTCAGGGCAACCACAGG + Intronic
1171348297 20:24483518-24483540 AGTACAGGAAGAGCAAACACTGG - Intronic
949400207 3:3657683-3657705 TGTTCTAGTAGAGCAGGCACGGG + Intergenic
950890867 3:16402484-16402506 GGTTCTGGTGCAGCAAGCACAGG + Intronic
952669971 3:35954506-35954528 AGTTCTGGAAAAGCAGACACTGG - Intergenic
953388341 3:42519918-42519940 AGCTCTGGGAGAGCAGCCCCGGG - Intronic
962378737 3:134879733-134879755 AGTTCTGGTAGAGATAAGACAGG + Intronic
963075805 3:141345323-141345345 AGATATGGAGGAGCAACCACAGG + Intronic
980131298 4:128818666-128818688 AGTTGTGCCAGAGCAACCATGGG + Intronic
982403031 4:154989543-154989565 AATCCTATTAGAGCAACCACAGG - Intergenic
991289643 5:65020612-65020634 AGGAATGGTAGAGAAACCACAGG - Intergenic
995911219 5:117189396-117189418 ATTAATGGTAGAGGAACCACAGG - Intergenic
996876519 5:128246378-128246400 TGTTTTGTTAGAGCAGCCACAGG + Intergenic
997234872 5:132266998-132267020 AGTTCTGCTAGAAGCACCACAGG - Intronic
1002917194 6:1538839-1538861 TGCTCTGGAAGAGGAACCACAGG - Intergenic
1003568014 6:7236838-7236860 TGTTCTGGGAGAGTAAACACTGG + Intronic
1006258897 6:32852677-32852699 AGTTCTGGTAGAGCAACCACAGG - Intronic
1013184934 6:107749300-107749322 AAATCTGGAAGAGCAAACACAGG + Intronic
1015070404 6:129087184-129087206 AGTTATGGTAGAGTAAACAGTGG - Intronic
1017591480 6:155982580-155982602 AGATCTGGTAGACCTACCTCTGG - Intergenic
1017989115 6:159470927-159470949 AGTCCTTGGAGAGCATCCACAGG - Intergenic
1018637404 6:165875368-165875390 AGTTCTGCTAGACCAACCCTTGG + Intronic
1019812879 7:3177320-3177342 ATTCCTGGTAGAGGAACCACAGG - Intergenic
1020507689 7:9014261-9014283 AGTTCTGGGAGAGAAAACACTGG - Intergenic
1025249763 7:57343996-57344018 AGCTCTGCTGGAGCACCCACTGG - Intergenic
1033066777 7:138163481-138163503 AGTTCTGGAACAGCAGACACAGG + Intergenic
1034111936 7:148545636-148545658 AGATCTGGTTGAGAAACCAAAGG - Intergenic
1038729402 8:30113678-30113700 AAGTCTGGAAGAGCAGCCACCGG + Intronic
1039859831 8:41447554-41447576 AGTTCAGGTAGAGCTGCCAGGGG + Intergenic
1046737600 8:117793894-117793916 AGTTGGGGGAGAGCTACCACTGG + Intergenic
1046746945 8:117886367-117886389 ATTTCTAGTAGAGCTCCCACTGG - Intronic
1052326086 9:27218053-27218075 AGGTCTGGGAGAGGAGCCACAGG - Intronic
1058604902 9:106710448-106710470 AGTCCTGGTAGAGGAAGCAAAGG + Intergenic
1186682499 X:11890755-11890777 AATTATGGTAGAGTATCCACTGG + Intergenic
1187094803 X:16136514-16136536 AGTACTGGAAGACCAACGACAGG + Intronic
1187424370 X:19163888-19163910 AGTCCGGGTAGAGCAAAAACAGG - Intergenic
1189376237 X:40468309-40468331 AGTGTTGGTGGAGCCACCACTGG + Intergenic
1192131470 X:68555562-68555584 AGTTCGAGTAGGACAACCACTGG - Intergenic
1195615162 X:106906247-106906269 AGGTCTGGAAAAGCAATCACTGG - Intronic
1200214986 X:154364243-154364265 AGTCCAGGTAGAGCACCCACGGG - Exonic