ID: 1006259816

View in Genome Browser
Species Human (GRCh38)
Location 6:32858400-32858422
Sequence CCGGAGCCACCAATGGCAAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 115}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006259816_1006259823 22 Left 1006259816 6:32858400-32858422 CCTTTTGCCATTGGTGGCTCCGG 0: 1
1: 0
2: 0
3: 14
4: 115
Right 1006259823 6:32858445-32858467 GTGGATGCAGCATATAAGCCAGG 0: 1
1: 0
2: 0
3: 6
4: 186
1006259816_1006259819 -5 Left 1006259816 6:32858400-32858422 CCTTTTGCCATTGGTGGCTCCGG 0: 1
1: 0
2: 0
3: 14
4: 115
Right 1006259819 6:32858418-32858440 TCCGGCAGCACCTTTATCTATGG 0: 1
1: 0
2: 0
3: 3
4: 69
1006259816_1006259821 3 Left 1006259816 6:32858400-32858422 CCTTTTGCCATTGGTGGCTCCGG 0: 1
1: 0
2: 0
3: 14
4: 115
Right 1006259821 6:32858426-32858448 CACCTTTATCTATGGTTATGTGG 0: 1
1: 0
2: 0
3: 15
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006259816 Original CRISPR CCGGAGCCACCAATGGCAAA AGG (reversed) Exonic
900004334 1:34835-34857 TCGGAGCCAGCATTGGCCAATGG - Intergenic
900024059 1:205351-205373 TCGGAGCCAGCATTGGCCAATGG - Intergenic
900697943 1:4023951-4023973 CCGGAGCCTCCAAGGGAACATGG - Intergenic
911059466 1:93735158-93735180 CCGGATCCACCAAACCCAAAGGG - Intronic
915902468 1:159856399-159856421 TGGGAGCCCCCACTGGCAAATGG + Intronic
917447210 1:175116605-175116627 CCGGAGCCACAACTGGCAGATGG + Intronic
918186096 1:182129145-182129167 CCCAAGCCACCAGTGCCAAATGG - Intergenic
919134453 1:193490188-193490210 CAGAGGCCAACAATGGCAAAGGG - Intergenic
923377491 1:233379190-233379212 CCAGAGCCACCGATGCCAGAAGG - Exonic
1062907073 10:1186443-1186465 CAGGAGGCACCAATGGGACAAGG - Intronic
1068675013 10:59761731-59761753 CCTGAGCCAGCATTGGCATATGG + Intergenic
1070973519 10:80586701-80586723 CCCGAGCCAGCAGTGGCAACGGG + Intronic
1070999270 10:80814981-80815003 CCTGAGCCAGCAGTGGCAACTGG + Intergenic
1071796956 10:89018162-89018184 CCAGAGCCAGCAGTGGCAACTGG - Intergenic
1073532902 10:104249064-104249086 CCGGAGCCAGCAGGGGCAACAGG + Intronic
1074714703 10:116207463-116207485 GAGTAGCCACCCATGGCAAATGG + Intronic
1078743533 11:14090776-14090798 CGGGAGCCAGCAGTGGCAACCGG - Intronic
1078829597 11:14966821-14966843 GCAGAGCCACCAATGTCAATAGG + Intronic
1080147666 11:29006879-29006901 CCTGAGCCACCAATGGCTGGGGG - Intergenic
1081187225 11:40058720-40058742 CCTAAACCATCAATGGCAAAGGG + Intergenic
1081315338 11:41623800-41623822 CCCGAGCCAGCAGTGGCAACCGG + Intergenic
1083868478 11:65471792-65471814 CTCGATGCACCAATGGCAAATGG - Intergenic
1084259258 11:67964054-67964076 CCCGAGCCAGCAGTGGCAACCGG + Intergenic
1088481588 11:110300551-110300573 CCTGAGCCAACAGTGGCAATTGG - Intergenic
1091377755 12:36883-36905 TCGGAGCCAGCATTGGCCAATGG - Intergenic
1093448455 12:19287535-19287557 CCAGAGCCTCCAAGGGAAAACGG + Exonic
1097213061 12:57387163-57387185 CCCGAGCCACCAGTGGCAACCGG + Intronic
1100295026 12:93253127-93253149 CCCGAGCCACCATTGTCAAAAGG + Intergenic
1103136714 12:118513783-118513805 CTTGAGCCACAGATGGCAAATGG - Intergenic
1103913204 12:124363206-124363228 CCGGAGCCCCCAGTTGCAACTGG + Intronic
1104539830 12:129653597-129653619 ACGACGCCACCAATGGCAACTGG + Intronic
1104620394 12:130307638-130307660 CAGGAGCCACCAGAGCCAAAAGG - Intergenic
1107217121 13:37934697-37934719 CCTGTGCCAGCAAGGGCAAAGGG + Intergenic
1107521991 13:41192850-41192872 CAGGAGCCACCAATGCCCACTGG + Exonic
1107665195 13:42681196-42681218 CAGAAGCCGCTAATGGCAAAGGG - Intergenic
1108598885 13:51973574-51973596 CCGGAGTCCCCACTGGCAGAAGG + Intronic
1111509777 13:89245911-89245933 CAGCAGCCACCAATTGCAGATGG + Intergenic
1118451408 14:65905945-65905967 CCCCAGCCACCAATGGAAAAAGG + Intergenic
1132449170 15:101956109-101956131 TCGGAGCCAGCATTGGCCAATGG + Intergenic
1138693493 16:58790481-58790503 CTGGAGCCAGCAGTGGCAACCGG - Intergenic
1140715911 16:77725521-77725543 CTTTAGCCACCAATGGCAAAAGG - Exonic
1142109236 16:88322464-88322486 CCGCAGCCACCCATGGCAGTGGG + Intergenic
1142142517 16:88478912-88478934 CCGGAGCCACCACTGCCATGTGG - Intronic
1144829460 17:18123232-18123254 CCGGGCCCAACAATGGCAACCGG + Intronic
1146602536 17:34230632-34230654 CAGAAGCTAGCAATGGCAAAAGG + Intergenic
1146799193 17:35805143-35805165 CCGGGGTCACCAATGGAAACTGG + Intronic
1147373842 17:40012327-40012349 CCCGAGCCAGCAGTGGCAACGGG + Intergenic
1152894888 17:82905360-82905382 CCTGAGACACCAAGGGCAACAGG - Intronic
1154057103 18:11023181-11023203 CCCGAGCCAGCAGTGGCAACTGG - Intronic
1155205117 18:23551930-23551952 CCAGTGCCATCAATGGCACATGG + Intronic
1155602908 18:27569674-27569696 CCGGAGCCAGCAGCGGCAACTGG - Intergenic
1156969814 18:43140482-43140504 CTGGAGCCAGCAGTGGCAACTGG + Intergenic
1158773806 18:60553133-60553155 CCGGGGCCATGAATGGCAACAGG + Intergenic
1160636086 19:76444-76466 TCGGAGCCAGCATTGGCCAATGG - Intergenic
1162718540 19:12648341-12648363 TCGGAGCCACTAATGGAGAACGG - Exonic
1164901060 19:31924206-31924228 CAAGACCCACCACTGGCAAAAGG - Intergenic
929929877 2:46245554-46245576 TCGTAGCCACTAAGGGCAAAGGG - Intergenic
930267639 2:49218538-49218560 CCTGAGCCATCTATGCCAAATGG - Intergenic
932735811 2:74253495-74253517 CCTGAGCCTCCAAGGGCGAAGGG - Intronic
936347040 2:111682828-111682850 CCGAAGCCAGCAGTGGCAACCGG + Intergenic
936565395 2:113578606-113578628 TCGGAGCCAGCATTGGCCAATGG + Intergenic
939899747 2:147837754-147837776 CTGGAGTCACCAATCTCAAATGG + Intergenic
944933131 2:204540897-204540919 CCGGAGCCAGCCATGGCTCAAGG - Intergenic
945451359 2:210000048-210000070 CCTGAGCCAGCAGTGGCAACCGG - Intergenic
1170246596 20:14227274-14227296 CCGGAGCCAGCAGTGGCAACAGG + Intronic
1173778904 20:45736813-45736835 CTGGAGCCAGCAGTGGCAACCGG + Intergenic
1174536058 20:51252342-51252364 CCACAGCAACCAATGTCAAAAGG - Intergenic
1175592017 20:60200710-60200732 CAGGAGCCACCCAAGGCAAGGGG - Intergenic
1176156230 20:63622696-63622718 CCTGGGCCACCAATCGCAAATGG + Intronic
1177637759 21:23807883-23807905 CCCGAGCCAGCAGTGGCAACCGG + Intergenic
1177669514 21:24208159-24208181 CCTGAGCCAGCAAAGGCAACTGG - Intergenic
1178585537 21:33868070-33868092 CCCGAGCCAGCAGTGGCAACCGG - Intronic
1182229545 22:28827062-28827084 CCGTAACCTCAAATGGCAAAGGG - Intergenic
1182831826 22:33310411-33310433 CAGAAGACACCAATGGCAAAGGG - Intronic
952289379 3:32000653-32000675 CAGGAGTCAACAATGGTAAAGGG - Intronic
953124348 3:40077282-40077304 CCCGAGCCAGCAGTGGCAACTGG - Intronic
956347319 3:68294932-68294954 CAGTAGCCACAAATGGCCAATGG + Intronic
959765038 3:110016255-110016277 CTGCAGCCACCAATAGAAAATGG - Intergenic
960156029 3:114297862-114297884 CTGGAGTCTGCAATGGCAAAAGG - Intronic
960199269 3:114812163-114812185 CCGGAGCCAGCAGTGGCAACCGG - Intronic
960227417 3:115184590-115184612 CCCGAGCCAGCAGTGGCAACCGG - Intergenic
960248932 3:115430967-115430989 CAGTAGCCACAAATGGCTAATGG + Intergenic
962758397 3:138485665-138485687 CCTGAGCCAGCAGTGGCAACCGG + Intergenic
965256893 3:166424588-166424610 CCGGAGCCAGCAGTGGCAACCGG + Intergenic
965837500 3:172867559-172867581 CCGGAGCCAGCAGTGGCAACCGG + Intergenic
969362476 4:6673433-6673455 CCGGAGCCAGCAGTGGCAACCGG + Intergenic
971020616 4:22531353-22531375 GCTGCGCCACCAATGGTAAAAGG - Intergenic
971201233 4:24511148-24511170 GAGGAGCCACCAAGGGCAAATGG + Intergenic
971265830 4:25095616-25095638 CCGGATTTACCAAGGGCAAAAGG - Intergenic
971622526 4:28873895-28873917 CGGCAGCCACCAAAGGCAATTGG - Intergenic
973764951 4:54154545-54154567 CCCGAGCCAGCAATGGCAACTGG - Intronic
975709511 4:77145959-77145981 CCGGAAGCACCAGTGTCAAAAGG + Intergenic
976733252 4:88284773-88284795 CGCGAGCCACCACTGGCACAGGG - Intergenic
980470074 4:133239829-133239851 CCCGAGCCAGCATTGGCAACTGG - Intergenic
980512404 4:133811999-133812021 CAGGAGCTACACATGGCAAAGGG + Intergenic
993041806 5:82823192-82823214 CCAGAGCCAGCAGTGGCAACCGG - Intergenic
994254659 5:97579536-97579558 CCAGAGCCAGCAGTGGCAACGGG - Intergenic
996747601 5:126858518-126858540 CCGGAGCCACCTATTGCTATTGG - Intergenic
999799804 5:155022981-155023003 CAAGAGCCAACAAAGGCAAATGG + Intergenic
1002634110 5:180598684-180598706 CCCGAGCCACGAGTGGCCAAGGG - Intergenic
1002833445 6:845189-845211 TAGGACCCACCAATGACAAATGG + Intergenic
1005675324 6:28148628-28148650 CCTCAGCCACTGATGGCAAAGGG - Exonic
1005790526 6:29295653-29295675 TCTGAGCCTGCAATGGCAAAGGG - Intergenic
1006259816 6:32858400-32858422 CCGGAGCCACCAATGGCAAAAGG - Exonic
1012148945 6:95721245-95721267 CAGAAGCCACAATTGGCAAATGG + Intergenic
1018117953 6:160606382-160606404 CAGCAGCCTCCAATGGTAAACGG - Intronic
1018777876 6:167035081-167035103 CCAAGGCCCCCAATGGCAAAGGG - Intronic
1019307497 7:342840-342862 ACAGAGCCACCAAAGGCCAAGGG - Intergenic
1019516429 7:1442215-1442237 CCAGAGGCCCCGATGGCAAAGGG - Exonic
1024743344 7:52378903-52378925 CCGGGACAACGAATGGCAAAAGG + Intergenic
1030366879 7:108656681-108656703 CCCGAGCCAGCAGTGGCAACCGG - Intergenic
1033065214 7:138147009-138147031 CCGGAGCCAGGAGTGGCAACCGG + Intergenic
1033843612 7:145404495-145404517 CCGGTGCCACCTCTGGCAATGGG - Intergenic
1038870827 8:31490726-31490748 CCCGAGCCAGCAGTGGCAACCGG + Intergenic
1046797039 8:118384579-118384601 CCTGAGCCACCAATGGCTGGAGG + Intronic
1046841861 8:118868003-118868025 ATGGAGCCACCATTGGCACATGG - Intergenic
1049887029 9:34618-34640 TCGGAGCCAGCATTGGCCAATGG - Intergenic
1051560856 9:18438673-18438695 CCGCAGCCAACAACAGCAAATGG - Intergenic
1057098942 9:92339432-92339454 CCAGAGCCAGTAATAGCAAATGG - Intronic
1057977709 9:99623931-99623953 CCGTAGCCACCTGTGGCTAAAGG + Intergenic
1058174719 9:101723533-101723555 CCCGAGCCAGCAGTGGCAACTGG - Intronic
1058317492 9:103586726-103586748 CCCCTGCCAGCAATGGCAAAGGG - Intergenic
1060730700 9:126035017-126035039 TCAGAGCCACCAATGCCAAGGGG + Intergenic
1186152456 X:6689972-6689994 CTGGAGCCAGCAGTGGCAACCGG - Intergenic
1187618175 X:21020910-21020932 CTGGACCCACCCAGGGCAAAAGG + Intergenic
1194996008 X:100592104-100592126 CCGCAGCCCCCAATGGCTAGTGG + Intronic
1197078893 X:122388586-122388608 CCCGAGCCAGCAGTGGCAACTGG - Intergenic
1199028638 X:142971364-142971386 CCCGAGCCAGCATTGGCAACCGG - Intergenic
1200898342 Y:8400626-8400648 CCTGAGCCACCATTGTAAAATGG - Intergenic
1201726086 Y:17153612-17153634 CTGTACCCTCCAATGGCAAAGGG + Intergenic