ID: 1006261343

View in Genome Browser
Species Human (GRCh38)
Location 6:32874151-32874173
Sequence GAAAATGTACATATGCACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006261343_1006261348 8 Left 1006261343 6:32874151-32874173 CCATGGTGCATATGTACATTTTC No data
Right 1006261348 6:32874182-32874204 GTCTGTCATTGATGGGCAGTTGG No data
1006261343_1006261349 9 Left 1006261343 6:32874151-32874173 CCATGGTGCATATGTACATTTTC No data
Right 1006261349 6:32874183-32874205 TCTGTCATTGATGGGCAGTTGGG No data
1006261343_1006261346 1 Left 1006261343 6:32874151-32874173 CCATGGTGCATATGTACATTTTC No data
Right 1006261346 6:32874175-32874197 TTATCCAGTCTGTCATTGATGGG 0: 356
1: 4447
2: 6040
3: 4560
4: 4397
1006261343_1006261345 0 Left 1006261343 6:32874151-32874173 CCATGGTGCATATGTACATTTTC No data
Right 1006261345 6:32874174-32874196 CTTATCCAGTCTGTCATTGATGG 0: 7
1: 520
2: 5457
3: 11098
4: 20564

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006261343 Original CRISPR GAAAATGTACATATGCACCA TGG (reversed) Intergenic
No off target data available for this crispr