ID: 1006268942

View in Genome Browser
Species Human (GRCh38)
Location 6:32949325-32949347
Sequence GGCCTTTGGCCTGGGTGTGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 432
Summary {0: 1, 1: 1, 2: 3, 3: 39, 4: 388}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006268942_1006268949 12 Left 1006268942 6:32949325-32949347 CCAGCACACCCAGGCCAAAGGCC 0: 1
1: 1
2: 3
3: 39
4: 388
Right 1006268949 6:32949360-32949382 ACATTCTCCAGCAGATCTGAGGG 0: 1
1: 0
2: 4
3: 20
4: 188
1006268942_1006268951 25 Left 1006268942 6:32949325-32949347 CCAGCACACCCAGGCCAAAGGCC 0: 1
1: 1
2: 3
3: 39
4: 388
Right 1006268951 6:32949373-32949395 GATCTGAGGGCAGTGCGTTCCGG 0: 1
1: 0
2: 0
3: 11
4: 103
1006268942_1006268953 27 Left 1006268942 6:32949325-32949347 CCAGCACACCCAGGCCAAAGGCC 0: 1
1: 1
2: 3
3: 39
4: 388
Right 1006268953 6:32949375-32949397 TCTGAGGGCAGTGCGTTCCGGGG 0: 1
1: 0
2: 1
3: 4
4: 87
1006268942_1006268948 11 Left 1006268942 6:32949325-32949347 CCAGCACACCCAGGCCAAAGGCC 0: 1
1: 1
2: 3
3: 39
4: 388
Right 1006268948 6:32949359-32949381 CACATTCTCCAGCAGATCTGAGG 0: 1
1: 0
2: 3
3: 14
4: 200
1006268942_1006268952 26 Left 1006268942 6:32949325-32949347 CCAGCACACCCAGGCCAAAGGCC 0: 1
1: 1
2: 3
3: 39
4: 388
Right 1006268952 6:32949374-32949396 ATCTGAGGGCAGTGCGTTCCGGG 0: 1
1: 0
2: 1
3: 45
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006268942 Original CRISPR GGCCTTTGGCCTGGGTGTGC TGG (reversed) Exonic
900160804 1:1222538-1222560 GCCCTGAGGCCTGGGTCTGCTGG - Intronic
901873340 1:12151516-12151538 GGTCCTGGGCCTGGGTGTCCTGG - Intergenic
902277876 1:15352441-15352463 AGCCATTGGCATGGGTCTGCAGG + Intronic
902520074 1:17011180-17011202 GCCCTTGGCCCTGGGTGTGACGG + Intronic
903861660 1:26368183-26368205 GGCCTTGGGCCTTAGTGAGCAGG - Intronic
904243000 1:29162638-29162660 GACATTTGGCCTGGGCGTGATGG + Intronic
904434397 1:30484900-30484922 GGCCTATGGTCTGGGTCTCCAGG + Intergenic
904604239 1:31690269-31690291 GGCCCTAGGCCTAGGGGTGCTGG - Intronic
905876187 1:41433325-41433347 TGCCTTGGGCCTGAGTGGGCAGG + Intergenic
906006832 1:42480572-42480594 GTCATTTTGCCTGGGTGTGGTGG - Intronic
906674518 1:47683543-47683565 GCTCTTTGACCTGGGTGTGCAGG - Intergenic
906942855 1:50271466-50271488 GGCCTTAGGCCTGGCTGGGCGGG - Intergenic
910994248 1:93087282-93087304 GGCCTTAAGGCTGGGTGTGGTGG + Intronic
913163688 1:116167175-116167197 AGCCTTTTACCTGGGTCTGCTGG + Intergenic
915162629 1:153930916-153930938 GGTATTTGGCCTGGGTGGGGAGG - Intronic
915164101 1:153939132-153939154 GGCTTTGGGCCTGAGTGGGCAGG - Intronic
915285909 1:154851883-154851905 GGCCTTTACCCTGGGTGAGATGG - Intronic
915467521 1:156106179-156106201 GGCAATTGCCCTGGGTTTGCCGG - Intronic
915571758 1:156748776-156748798 GGCCTCAGCCCTGGGTGTGGTGG - Intronic
916706691 1:167357664-167357686 GGCATAAGGACTGGGTGTGCTGG - Intronic
917404479 1:174689732-174689754 GGACTTTGGCCTGGTTGGGTAGG + Intronic
917533383 1:175856534-175856556 GGCCGTGGGGCTGTGTGTGCTGG - Intergenic
917568001 1:176231834-176231856 TGCCTATGGCCTGCCTGTGCAGG + Intergenic
917982719 1:180281637-180281659 GCCCCTTTGCCTGGCTGTGCAGG + Intronic
919778471 1:201208605-201208627 GGCCTTGGGCCTAGGAGTACAGG + Exonic
919847840 1:201652558-201652580 GGCCCTTGGCCTGGGTCTGGGGG + Intronic
920062855 1:203239892-203239914 GGCCTTGGGCCAGGGCCTGCTGG + Intronic
920179934 1:204126314-204126336 AGCTGTTGGCCTGGGTGGGCAGG + Exonic
920189383 1:204182979-204183001 GCCTTCGGGCCTGGGTGTGCAGG + Intergenic
920370935 1:205478943-205478965 GGCCCTTGGCATGGGAGGGCAGG + Intergenic
921760987 1:218914839-218914861 GAACTCTGGCCTGGGTGCGCTGG + Intergenic
922239065 1:223743653-223743675 GGAGTTTGGGCTGGGTGTGGTGG - Intronic
924039727 1:239972603-239972625 GGCCCATGGCCTGGGCTTGCAGG + Intergenic
1062858178 10:789974-789996 GGCATTTGGCCTGGGAGGCCTGG - Intergenic
1062961879 10:1578542-1578564 GGCCCTTGGCGTGGGTCTGGAGG + Intronic
1063031740 10:2242562-2242584 GGCCTTTCCTCTGCGTGTGCAGG - Intergenic
1064882020 10:20065919-20065941 GGCCTGTGGCCTGGGAGTTGAGG + Intronic
1065902074 10:30217220-30217242 GGCCATTGGCCTGGCTCTCCTGG + Intergenic
1066185965 10:33010713-33010735 GCCCTGAGGCTTGGGTGTGCTGG + Intergenic
1066432108 10:35362307-35362329 GACTTTTGGCCTGGGTGATCTGG + Intronic
1066692786 10:38047340-38047362 AGCCCTTGGGCTGGGTGTGGTGG + Intronic
1067033915 10:42899001-42899023 GGCCTCTGGCTTAGGTGGGCTGG + Intergenic
1069554025 10:69384960-69384982 CCCCTGTGGCCTGGGTGGGCTGG + Intronic
1069623448 10:69852054-69852076 GGCCTTTGCACTTGCTGTGCTGG + Intronic
1069956931 10:72057651-72057673 GGCCTTGGGCCAGGATCTGCTGG - Intergenic
1070418358 10:76211060-76211082 GTCCTTTGTCCTGGGTATGTGGG + Intronic
1070808832 10:79287044-79287066 GGCCCATGTCCTAGGTGTGCTGG - Intronic
1072710253 10:97711855-97711877 GGCCTTTGGCCTGGCTGAGCAGG - Intergenic
1074406477 10:113184023-113184045 GGCCTTTGGCCAAAGTGTGTGGG + Intergenic
1074592065 10:114822300-114822322 GGCCTCGGGCCTGGCTCTGCGGG + Intronic
1074776390 10:116770994-116771016 GGGCTGTGGGCTGTGTGTGCTGG + Intergenic
1075045493 10:119143170-119143192 GCTCCTTGGCCTGGCTGTGCAGG + Intronic
1076010742 10:126986129-126986151 ACCCTTTGGGCTGGGTGTGGTGG - Intronic
1076594833 10:131619024-131619046 GGCCGATGGCCTGGGGCTGCTGG - Intergenic
1077124527 11:926365-926387 GGCCCTGGGTCTGGGGGTGCGGG + Intronic
1077239286 11:1502288-1502310 GGCCCCTGGCCTGGGTGGGCTGG - Intergenic
1077467393 11:2739926-2739948 GGGCTGAGGCCTGGGTGTGCAGG + Intronic
1077524832 11:3057725-3057747 GGCCTCGGGACAGGGTGTGCTGG + Intergenic
1078179219 11:8996566-8996588 GGCTTTTTGGCTGGGTGTGATGG - Intronic
1078319686 11:10322986-10323008 GGTCTCTGGCCTGGGGGTGGCGG + Intronic
1081493656 11:43584926-43584948 GGACTTGGGCCTGTGTGTTCAGG + Intronic
1081664418 11:44908249-44908271 GGGCTTTGGCTTGGCTGAGCAGG - Intronic
1081678826 11:44987712-44987734 GGCCTTTGGTCTGGTTGGACTGG - Intergenic
1081710551 11:45212938-45212960 GGGCTTGGGCCTGGGTGGCCTGG - Intronic
1082128809 11:48462512-48462534 GGCTTTTAGACTGGGTGTGGTGG + Intergenic
1083898972 11:65634576-65634598 GTGTTTTGGCCTGTGTGTGCTGG + Exonic
1084191524 11:67501428-67501450 AGCCTTTGGCCCTGGTGTTCAGG - Intronic
1084594092 11:70106913-70106935 GACCTTTGGCCTGTGGGCGCTGG + Intronic
1084758629 11:71254142-71254164 GGTCTTTGAGCTGGGTTTGCAGG - Intergenic
1085103552 11:73822284-73822306 TGCCTTTGGGGTGGGGGTGCAGG - Intronic
1085399297 11:76225994-76226016 GGCCTTTGGGCTGGGTGTGCAGG - Intergenic
1089068000 11:115676639-115676661 GGCCTTTTGCCTGTAAGTGCTGG + Intergenic
1089710695 11:120312408-120312430 TGCCTTTGGGCTGGGTGCGGTGG - Intronic
1089970122 11:122686576-122686598 GGCTTTTGGCCGTGGTGTGCAGG + Intronic
1090077492 11:123588351-123588373 AGCCCTTGGCATGGGTGTGGGGG + Intronic
1090805451 11:130199392-130199414 TGCCTTGGGCTTGGGTGAGCTGG - Intronic
1091252875 11:134158397-134158419 AGCACTTGCCCTGGGTGTGCAGG + Exonic
1091313939 11:134597563-134597585 GGACTGCAGCCTGGGTGTGCGGG - Intergenic
1092439372 12:8484339-8484361 ACCCTTTGGGCTGGGTGTGGTGG - Intergenic
1092913310 12:13167246-13167268 AGCCTCTGACCTGCGTGTGCAGG - Intergenic
1093746665 12:22749952-22749974 GGTCTGTGGCCTGGGGGTGTGGG + Intergenic
1093977406 12:25438321-25438343 GGCCAATGGCCTAGTTGTGCAGG - Intronic
1095246539 12:39929841-39929863 GGCACTTGGGCTGGGTGTGGTGG + Intronic
1096194799 12:49642938-49642960 GGCCTTTGGTGTGGAGGTGCTGG - Exonic
1096477328 12:51916184-51916206 GGCCTTTGGCCTGGTGCTGTGGG + Exonic
1096866801 12:54569274-54569296 GGCCTTTGGCCCGGGCCTGCTGG - Exonic
1097359432 12:58642227-58642249 GGGCTTTTGCTTGGGTGTGATGG + Intronic
1098250840 12:68568166-68568188 GGCCTCTCGGCTGGGTGTGGTGG - Intergenic
1100385562 12:94102043-94102065 GGCTCTCGGCCTGGGTGTCCAGG - Intergenic
1100961568 12:99968268-99968290 GGGCTGTGGGCTGGGTGTGGTGG + Intronic
1106245336 13:27944855-27944877 GGCCATGAGCCAGGGTGTGCAGG + Intergenic
1107198737 13:37687248-37687270 GAACTTTGGGCTGGGTGTGGTGG - Intronic
1108279537 13:48847812-48847834 TGCCTTTGGCCTGGAACTGCAGG - Intergenic
1108393520 13:49971398-49971420 GGCCTATCGGCTGGGTGTGGTGG + Intergenic
1109074748 13:57821048-57821070 GGCCCTGGGCCTGGGTGGGGAGG - Intergenic
1112119781 13:96396913-96396935 TGCCTTTTGGCTGGGTGTGGTGG + Intronic
1112594383 13:100794669-100794691 GGTCTGTGGCCTGGGGGTGGGGG - Intergenic
1112656448 13:101456625-101456647 GGGCTCTGGGCTGGGTGTGGTGG + Intronic
1113696152 13:112347060-112347082 AGCCTTTAGCCTGAGAGTGCAGG - Intergenic
1113957005 13:114104411-114104433 AGCCTCTGGCCAGGGTGTGGTGG - Intronic
1114930957 14:27466591-27466613 GGCCTGTTGCCTGGGTATACTGG - Intergenic
1115755895 14:36525545-36525567 GGCCATTGGGGTGGGTGTGAGGG + Intergenic
1116432909 14:44866961-44866983 GGCCTTGGGTCTGGGGCTGCAGG + Intergenic
1117561926 14:56949303-56949325 GGGCTTTGAGCTGGGTGTGGTGG - Intergenic
1118383893 14:65239479-65239501 GGCCTTTGCCCTTGGCTTGCAGG - Intergenic
1119184557 14:72630710-72630732 TGGCTTTGCCCTGGGTGTTCTGG - Intronic
1119509220 14:75198042-75198064 GTGCTCTGGCCTGGGTTTGCAGG + Intergenic
1119979163 14:79059949-79059971 TGCCTCTGGCCTTGGTTTGCAGG + Intronic
1121024625 14:90606263-90606285 GGCCTATGGTTGGGGTGTGCTGG + Intronic
1121050157 14:90815196-90815218 GCCCTCTGGCCACGGTGTGCTGG + Intronic
1121250640 14:92497257-92497279 GGCCTTTGGTCAGGGTCTGTAGG - Exonic
1121636514 14:95457375-95457397 GGCCTTTGGGCTGTCTGGGCTGG - Intronic
1122120968 14:99553218-99553240 GGGCTCTGGCCTGGGTGTTCTGG - Intronic
1122307275 14:100773796-100773818 CTCCTTTGGCCTGAGGGTGCTGG + Intergenic
1122904752 14:104796478-104796500 GGACTTCGGACTGGGTGTCCGGG - Intergenic
1122998785 14:105280772-105280794 GACCCTGAGCCTGGGTGTGCAGG + Intronic
1123039748 14:105485656-105485678 TGGCCTTGGGCTGGGTGTGCTGG + Intergenic
1123060446 14:105592001-105592023 GGCCTGTGGTCTGGCTGTGGTGG + Intergenic
1123084924 14:105712972-105712994 GGCCTGTGGTCTGGCTGTGGTGG + Intergenic
1123474974 15:20582820-20582842 GCCCTCTGCCCTGTGTGTGCAGG - Intergenic
1123643037 15:22417537-22417559 GCCCTCTGCCCTGTGTGTGCAGG + Intergenic
1124185085 15:27518061-27518083 GGACTTTGGGCTGGGCGTGGTGG + Intronic
1124270871 15:28279275-28279297 TGCTTTTGGGCTGGGTGTGGTGG - Intronic
1124714014 15:32041572-32041594 GGCCTGTGGCCTGGGGGTTGGGG + Intronic
1124859978 15:33429983-33430005 GGCCTTCTGGCTGGGTGTGCTGG + Intronic
1125693445 15:41615636-41615658 GGCCTGTGGGCTGGGTGTGGTGG + Intergenic
1126098815 15:45107514-45107536 GTCCTTGGGCCTGGGGTTGCTGG - Intronic
1126104922 15:45141219-45141241 GTCCTTGGGCCTGGGGTTGCTGG + Intronic
1127148559 15:56050420-56050442 GGCCTTTGTCATCGGTGTGCAGG + Intergenic
1128133887 15:65248800-65248822 GGACTCTGGCCTGGGTCTGTGGG - Intronic
1128359641 15:66953045-66953067 GGCCTTTGGGATGGATGTCCTGG - Intergenic
1128460074 15:67860204-67860226 GGCCTTAGCAGTGGGTGTGCAGG + Intergenic
1129571441 15:76689133-76689155 GGCATTTGGGCTGGGTGCGGTGG - Intronic
1130343875 15:83023675-83023697 TGCCTTTTGACTGGGTGTGGTGG - Intronic
1131802128 15:96081829-96081851 GGCCTTTGCCCCGAGTGTGTGGG - Intergenic
1132284929 15:100655820-100655842 TGCCACTGGCCTGTGTGTGCAGG - Intergenic
1132306884 15:100821697-100821719 TGCCCATGGCCTGGGTGGGCAGG - Intergenic
1133285882 16:4690495-4690517 GGTGGCTGGCCTGGGTGTGCAGG - Exonic
1134096250 16:11420849-11420871 TGCCTGTGTACTGGGTGTGCGGG + Intronic
1134144163 16:11746702-11746724 GGCCCTTGGCCTGGGTACTCTGG + Intergenic
1134502837 16:14782599-14782621 GGAATTTGGGCTGGGTGTGGTGG + Intronic
1134577726 16:15346296-15346318 GGAATTTGGGCTGGGTGTGGTGG - Intergenic
1134724862 16:16411251-16411273 GGAATTTGGGCTGGGTGTGGTGG + Intergenic
1134942570 16:18300608-18300630 GGAATTTGGGCTGGGTGTGGTGG - Intergenic
1135232338 16:20720581-20720603 GGTCTGTGGCCTGGGTGTTGGGG + Intronic
1135403725 16:22183575-22183597 GTCCTTTAGCCTGGGTTTTCTGG - Intronic
1135971207 16:27073399-27073421 GACCTATTCCCTGGGTGTGCTGG - Intergenic
1136077169 16:27825095-27825117 GGGCTTTGGCATGGAAGTGCTGG + Intronic
1136361708 16:29784807-29784829 GGCCTCTAGCCTGGGCGTGGTGG - Intergenic
1137494876 16:48961961-48961983 GTCATTTGGCCAGGGTCTGCGGG + Intergenic
1138245290 16:55462808-55462830 GGACCTGGGCCTGGGTGGGCAGG + Intronic
1139923943 16:70475480-70475502 CGGCTCTGGCCTGGGTGAGCGGG + Exonic
1139958262 16:70703593-70703615 GGCCTCTGGGCTGTGTGTGAAGG - Intronic
1140332391 16:74070551-74070573 GGCCTTTGGCCTGGCTGTGATGG - Intergenic
1141378518 16:83553842-83553864 TGACTTTGGGCTGGGTGTGGTGG - Intronic
1142068517 16:88076352-88076374 GGGCCGGGGCCTGGGTGTGCCGG + Intronic
1142153740 16:88523855-88523877 GGCGCCTGGCCTGGCTGTGCGGG - Intronic
1142384652 16:89755832-89755854 GCCGTGTGGCCTAGGTGTGCGGG - Intronic
1142384665 16:89755887-89755909 GCCGTGTGGCCTAGGTGTGCGGG - Intronic
1142384678 16:89755941-89755963 GCCATGTGGCCTAGGTGTGCGGG - Intronic
1142896146 17:2980417-2980439 GGCCTCTGGAATGGGGGTGCAGG + Intronic
1143369030 17:6426871-6426893 GGCCTCTGACCTTGGTCTGCAGG + Exonic
1143890141 17:10096601-10096623 GGCCTTAGGCCTGGGTCTGTTGG - Intronic
1144061646 17:11588248-11588270 GGCCTTTGGCCTGTGGAAGCTGG - Intergenic
1144381674 17:14705114-14705136 GGCCAGTGGTCTTGGTGTGCTGG + Intergenic
1144782577 17:17815391-17815413 GGGCTTTTTCCTGGGTGGGCTGG + Intronic
1144949114 17:18984585-18984607 GGCCTTTGCCCAGGGGCTGCTGG + Intronic
1145234991 17:21202070-21202092 GGCTGTGGCCCTGGGTGTGCGGG + Intronic
1146464718 17:33077158-33077180 GGCCTTGGGCCAAGGTCTGCAGG - Intronic
1146684939 17:34835250-34835272 GGCCTTTGGCACAGGTGGGCAGG - Intergenic
1147301103 17:39528205-39528227 GGACTTTTGGCTGGGTGTGGTGG - Intronic
1147689294 17:42305727-42305749 GTCCTAGGGCCTGGGGGTGCTGG - Intronic
1150334713 17:64322109-64322131 GGCCTTTGGGTTGGGATTGCAGG - Exonic
1150445359 17:65224109-65224131 GCCCATGGGCCTGGGTTTGCTGG - Intronic
1150540186 17:66088827-66088849 GGCCAGGGGCCTGAGTGTGCAGG - Intronic
1150703758 17:67469549-67469571 GGCCGCTGGTCTGAGTGTGCTGG - Intronic
1151584969 17:75003390-75003412 GGCCTGTCGCCTGCGTGTGCAGG + Exonic
1151633352 17:75326359-75326381 GGCCTTTGGGCTTGGTGTACGGG + Intronic
1151633829 17:75330094-75330116 GGGCTTTGGGCCGGGTGTGGTGG + Intronic
1151767429 17:76139606-76139628 GGTCTTTGGCCTGGGCCTGCTGG + Intronic
1151869312 17:76825859-76825881 GGTCTTTTGGCTGGGTGTGGTGG - Intergenic
1151996891 17:77615339-77615361 GGCCTTTGGGCTGGGCGCGGTGG - Intergenic
1152120493 17:78415341-78415363 GGCATTGGGGCTGGGTGTGGTGG + Intronic
1152558369 17:81065844-81065866 GCCCTTTGGCCTGGCTGTGCAGG + Intronic
1152690055 17:81713856-81713878 GCCCTCTGGCCTGGGAGGGCGGG + Intronic
1153998153 18:10460255-10460277 GGCCCTTGGCCTGGGATTACAGG - Intronic
1155164358 18:23220581-23220603 GCCTTTGGGGCTGGGTGTGCTGG + Intronic
1156256575 18:35403504-35403526 GGACTTTTGGCTGGGTGTGGAGG + Intergenic
1157027385 18:43861683-43861705 GGTCTTTGGGCTGAGTGTGCAGG + Intergenic
1158982998 18:62783513-62783535 GGCTTGTGGGCTGGGTGTGGTGG - Intronic
1159071414 18:63627158-63627180 GGCCTGAAGCCTGGGTCTGCAGG - Intergenic
1160420918 18:78743312-78743334 GGCCTCAGGCCTGGCTGTGTGGG - Intergenic
1160509170 18:79443769-79443791 GGCCTTGTGCCTGGAGGTGCCGG - Intronic
1160598212 18:79992448-79992470 GGCCCTGGGCCTGGGGGTGATGG - Intronic
1160717245 19:581980-582002 GCCCCTTGGGCTGCGTGTGCCGG + Intronic
1160942559 19:1627208-1627230 GGGCTTGGGCCAGGGTGGGCTGG - Intronic
1161089399 19:2352584-2352606 GACCTTTGGGGTGGGGGTGCTGG - Intronic
1161170866 19:2811931-2811953 TGGCCTGGGCCTGGGTGTGCCGG + Intronic
1161626349 19:5329151-5329173 GGCCTTTGTCCTTGCTCTGCCGG - Intronic
1162295574 19:9811132-9811154 TGCCCCTGGCCTGGCTGTGCTGG - Exonic
1163025073 19:14506084-14506106 GTCCCTTGGCCTGTGTGTCCAGG + Intergenic
1163565544 19:18049034-18049056 GGCCAATGGTCTCGGTGTGCTGG - Intergenic
1163571184 19:18083330-18083352 GGTCTTTGGCCTGGTGGTGGAGG + Intronic
1165251360 19:34538903-34538925 GGCCTTCTGGCTGGGTGTGGTGG + Intergenic
1165285974 19:34841926-34841948 GGTCTGTGGCCTGGGTGTTGGGG - Intergenic
1165527658 19:36369696-36369718 GGCTTTTAGGCTGGGTGTGGTGG - Intronic
1167159032 19:47755689-47755711 GGGCTTTGGACTGGGTGTCCTGG + Intronic
1167596364 19:50430342-50430364 GTCCTTGAGCCTGGGTGGGCAGG + Exonic
1168097557 19:54124279-54124301 GGCAGCTGGCCTGGGGGTGCAGG - Intronic
1168304403 19:55427526-55427548 GGAGTTTGGGCTGGGTGTGGTGG + Intergenic
925348690 2:3187406-3187428 GGCCTTGGGGAGGGGTGTGCTGG - Intergenic
925638485 2:5965210-5965232 GGCCCTTGGCCTGGATGGGAGGG + Intergenic
926745624 2:16154661-16154683 AGTCCTTGGCTTGGGTGTGCAGG - Intergenic
927748195 2:25642105-25642127 AGACTTTGGGCTGGGTGTGGTGG - Intronic
927849573 2:26490468-26490490 TTCCCCTGGCCTGGGTGTGCAGG + Intronic
927931646 2:27049635-27049657 GTCCTGTGGGGTGGGTGTGCCGG - Intronic
927958663 2:27225752-27225774 AGCCTTTGCCCTGGGTGGCCTGG + Exonic
928022753 2:27716407-27716429 GGCCTTTGGCCGGGTTGCCCAGG - Intergenic
928420620 2:31135779-31135801 GTCCTTTGGCATGGGGGTGGGGG - Intronic
928490500 2:31778240-31778262 GGCCGTGGGCCAGTGTGTGCAGG - Intergenic
929814374 2:45219601-45219623 GGCCTTTGGCTTGTGGGGGCCGG + Intergenic
930090801 2:47530128-47530150 GGCCGCTGGCCTGGCTGGGCAGG - Intronic
930219056 2:48727138-48727160 GTCTTTTGGGCTGGGTGTGGTGG + Intronic
930285876 2:49427201-49427223 AGGCTTTTGCCTGGGTATGCTGG - Intergenic
930659126 2:54036379-54036401 GGACTTTGGGCTGGGTGCGGTGG - Intronic
931353903 2:61517186-61517208 GGCATTTAGGCTGGGTGTGGTGG - Intronic
932551345 2:72772613-72772635 GTCCTGTTGCCTGGGTGTGTGGG - Intronic
932571185 2:72939195-72939217 CGCCTCTTGCCTTGGTGTGCTGG + Intergenic
933307660 2:80621876-80621898 TCCCTGTGGCCTGGGTGGGCTGG + Intronic
933777429 2:85779502-85779524 GGCCCTGGCCCTGGGGGTGCTGG + Intronic
936241473 2:110791907-110791929 GGCTTCAGGTCTGGGTGTGCAGG + Intronic
937100124 2:119262100-119262122 GGCCTGTGGTCTGGGTGACCTGG - Intronic
938004154 2:127774026-127774048 GGCTTTTGGGCTGGGCGTGGTGG - Intronic
938781339 2:134587532-134587554 GGCCTTTGACCTGGACGTGCAGG - Intronic
940112414 2:150169418-150169440 GGCCTTTGGCCTCAGAGTGAGGG - Intergenic
940909279 2:159196059-159196081 GGCCGGTGGCCTGGGCATGCTGG - Intronic
942084383 2:172429911-172429933 GTGCTATGGCCTGTGTGTGCTGG - Intronic
942318640 2:174716955-174716977 GGCCTTTTGCCTGGGAGAGCAGG + Intergenic
943126758 2:183803888-183803910 GGCCTTTTGCCTGGGGCTGCAGG + Intergenic
943480004 2:188405404-188405426 GGCCTAGAGCTTGGGTGTGCTGG - Intronic
943502125 2:188705348-188705370 GTCCTTAGGCCTGGGTGTCCTGG - Intergenic
946372209 2:219287724-219287746 GGCCTGGGCCCTGGGTGGGCTGG - Intergenic
947248945 2:228079642-228079664 GGCCTTGAGCCTGAGTCTGCAGG - Intronic
947668810 2:231924147-231924169 GGCCATGGGCCAGGGTGTGCTGG + Intronic
947764984 2:232632332-232632354 AGCCTTTGGCATGCGAGTGCAGG - Intronic
948571808 2:238922471-238922493 GGCCTCTCTCCTGGGAGTGCAGG - Intergenic
1170335511 20:15266687-15266709 GGACTTTGTCCTGGGAGTGATGG - Intronic
1170546394 20:17438746-17438768 GGGCTGTGCCCTGGGTGTGGGGG - Intronic
1171936168 20:31277433-31277455 GGCCTTGAGCCTGGGTCTGCAGG + Intergenic
1172634802 20:36402880-36402902 GGCTTTTAGCCTGGGTGTGTTGG + Intronic
1172754028 20:37270902-37270924 GCTCTGTGGCCTGGGTGTTCAGG - Intergenic
1173029957 20:39347724-39347746 GGCCTGGTGCCTGGGTCTGCAGG - Intergenic
1175424738 20:58856052-58856074 GGCCCTTGGCCTGGGGGAGCGGG + Intronic
1175660549 20:60808753-60808775 AGCCCTTTGCCTGGGTGTCCAGG + Intergenic
1175675772 20:60945601-60945623 GGGCAGTGGCCTGGGTCTGCAGG - Intergenic
1175742146 20:61427216-61427238 GACCTGTGCCCTGTGTGTGCAGG + Intronic
1176106150 20:63388785-63388807 ATCCATTGGCCTGGGAGTGCGGG + Intergenic
1176385840 21:6138221-6138243 GGCCTTGGGCCTGGGGGCCCCGG + Intergenic
1177016624 21:15797569-15797591 TTCCTTTGGTGTGGGTGTGCTGG - Intronic
1178924962 21:36767215-36767237 GACCTTTGCCCTCGGTCTGCCGG + Exonic
1179737633 21:43400031-43400053 GGCCTTGGGCCTGGGGGCCCCGG - Intergenic
1180280281 22:10687426-10687448 TGCCTTTGTCCAGGGTGTGTCGG + Intergenic
1180835738 22:18928639-18928661 GGGCATTGGTCTGGCTGTGCAGG - Intronic
1181488335 22:23245511-23245533 GGCCTTTAGCCAGGGTGCGGTGG + Intronic
1181540374 22:23569840-23569862 GGTCTGGGGCCTGGGTGGGCAGG - Intergenic
1181749975 22:24982605-24982627 GGCATTTGCCCTGTGGGTGCTGG + Intronic
1182108703 22:27707413-27707435 GGGGCCTGGCCTGGGTGTGCTGG + Intergenic
1182612408 22:31559879-31559901 GGCCAGTGGTCTTGGTGTGCTGG - Intronic
1183323915 22:37181109-37181131 GGCCTGTGTTCTGGGTGTTCAGG - Exonic
1183584197 22:38742720-38742742 GACCTCTGAGCTGGGTGTGCTGG + Intronic
1184057199 22:42060502-42060524 GGACTTTGGCCTGTCTGTGCTGG + Intronic
1184560576 22:45260725-45260747 GGCCTTGGGGCTGGGTGCGGTGG + Intergenic
1184651279 22:45920482-45920504 GGCCCTTTGCCTGGGTGAGACGG - Exonic
1184658800 22:45955844-45955866 GGCCTCTGGCCTGAGACTGCAGG - Intronic
1184662995 22:45974138-45974160 GGCCTTTGCCCTGTGGGTGCTGG - Intronic
1184798287 22:46744671-46744693 GGCCTCTGCCCTGGCTGTGCTGG - Intergenic
1185250726 22:49800254-49800276 GGCCTTGGGGGTGGGGGTGCGGG - Intronic
1203285827 22_KI270734v1_random:153938-153960 GGGCATTGGTCTGGCTGTGCAGG - Intergenic
949920607 3:8997263-8997285 GGGCATTGGCCTGGGTGAGCAGG - Intronic
952854899 3:37762145-37762167 GGGGTTTGGCCTGGGAGGGCCGG - Intronic
953401766 3:42628712-42628734 GCCCTTTTGGCTGGGTGTGGTGG + Intronic
954340209 3:49947275-49947297 GGGTTTTGAGCTGGGTGTGCAGG + Intronic
954533270 3:51338846-51338868 GGCCATAGCCGTGGGTGTGCTGG - Intronic
954580151 3:51698901-51698923 GGCCTAAGGACTGGGGGTGCTGG + Intronic
954638993 3:52086982-52087004 GCCCTTTGGCCTGGGGGACCTGG - Intronic
954670838 3:52290594-52290616 GGGCTTTGGCAAGGCTGTGCTGG + Exonic
956254528 3:67269970-67269992 GTCCTTTGCCCTGGATTTGCTGG + Intergenic
958046453 3:88289535-88289557 GCCCTTTGGCCCGAGTGTGGTGG - Intergenic
959056951 3:101576527-101576549 GGCCAGTGGTCTTGGTGTGCTGG + Intronic
959712017 3:109395024-109395046 GGCCTTTAGGCTGGGCGTGGTGG - Intergenic
961447699 3:126988561-126988583 GGCCTTGGGCCTCGGTGCTCTGG - Intergenic
961646541 3:128395694-128395716 GCTGATTGGCCTGGGTGTGCTGG - Intronic
961714250 3:128847818-128847840 TGCCACTGGGCTGGGTGTGCTGG + Intergenic
961723088 3:128908856-128908878 CCCCTCTGGCCTGGGTATGCTGG - Intronic
962010002 3:131383041-131383063 AGCCTTGGGCCTGGTTCTGCTGG + Exonic
962534346 3:136314387-136314409 ACCCTTTGGGCTGGGTGTGGTGG + Intronic
962684749 3:137836602-137836624 GGCCTTTCTCCTGGGCTTGCAGG - Intergenic
963881819 3:150537003-150537025 GGAATTTGGCCTGGATGTGGTGG - Intergenic
964343371 3:155731277-155731299 GGCCTTGAGCCTGAGTCTGCAGG - Intronic
965141154 3:164836431-164836453 GGCCTTTGGCCTCTCAGTGCTGG + Intergenic
966681447 3:182645741-182645763 GGCCTTTGGGCCGGGTGCGGTGG - Intergenic
967094220 3:186163410-186163432 GGCCTCTGGTCTGGGTGAGCAGG + Intronic
967631947 3:191754979-191755001 TGACTTTGGGCTGGGTGTGGTGG + Intergenic
967963280 3:194941918-194941940 TGCGTGTGGCCAGGGTGTGCGGG + Intergenic
968232029 3:197009942-197009964 GGCCTGAGGCCAGGGTGTTCTGG + Intronic
968517053 4:1019755-1019777 GGCCCATGGCCTGGGTGGGAGGG + Intronic
968520955 4:1034513-1034535 GGCCTTGGGCCAGGAGGTGCCGG - Intergenic
968576086 4:1366804-1366826 GGCCGGTGTGCTGGGTGTGCAGG - Intronic
968759108 4:2432975-2432997 GGCCTGGGGCCTGGGGGTGGGGG - Intronic
969310461 4:6350245-6350267 GGCATTCGGCCTGGGAGGGCTGG - Intronic
969396483 4:6924883-6924905 GGCTTGTGGCCTGGGGGTGGTGG + Intronic
973346270 4:49059860-49059882 GGCCTTCAGCCTGAGTCTGCAGG + Intronic
973712185 4:53641135-53641157 GTTTTTTGGCCTGGGTATGCTGG + Intronic
979099860 4:116599993-116600015 GGGCTTTGGCCTGGATGGGGAGG - Intergenic
980901312 4:138907898-138907920 CGCCTTTTGGCTGGGTGTGGTGG + Intergenic
985917319 5:2932466-2932488 GCCATTTGGGCTGGGTGTGGTGG + Intergenic
987103790 5:14617111-14617133 GTCCTGGGGCCTGGGTGTGGTGG + Intergenic
987739340 5:21885172-21885194 GGCCTTTTGCCTGGGCGCGGTGG - Intronic
989625289 5:43424044-43424066 GATCTCTGGCCTGGGTGTGGTGG + Intergenic
991399153 5:66235644-66235666 GGGCTTTTGGCTGGGTGTGGTGG - Intergenic
991444656 5:66686083-66686105 GGTCTGTGGCCTGGGTGTCGCGG + Intronic
992473768 5:77082846-77082868 ACCCTTGGGCCTGGGTGTGGTGG + Intronic
993246636 5:85459953-85459975 GGCCTGTATCCTGGGAGTGCAGG + Intergenic
994790440 5:104219043-104219065 GACCTTTGGAATGGGTGTACTGG - Intergenic
995136178 5:108682540-108682562 CTCCTTCTGCCTGGGTGTGCTGG - Intergenic
995149854 5:108830164-108830186 GGAGTTTGGGCTGGGTGTGGTGG + Intronic
996040919 5:118810090-118810112 GGCCTGGAGCCTGGGTGTGTAGG - Intergenic
997081171 5:130740135-130740157 GTCGTTTGGCCAGGGTCTGCGGG - Intergenic
997582874 5:135028314-135028336 GGCCTGCGGACTGGATGTGCGGG - Exonic
997693516 5:135843899-135843921 GACCCAGGGCCTGGGTGTGCAGG - Intronic
999733085 5:154491191-154491213 TGCCTTTGGCCATGGTGTGAAGG - Intergenic
1000093763 5:157952892-157952914 GGGTTTTGGGCTGGGTGTGGTGG + Intergenic
1001403438 5:171460022-171460044 GGCCTCTGTCCTGGGTCTGCAGG + Intergenic
1001407200 5:171484550-171484572 AGCCTTTAGCCTGGGTGGGGAGG - Intergenic
1001859407 5:175040376-175040398 GGCCTTTCTTCTGTGTGTGCAGG + Intergenic
1002135916 5:177107451-177107473 GGACTTTGGCCAGGGTGATCAGG - Intergenic
1002680937 5:180963457-180963479 GGCCTTGAGCCTGAGTCTGCAGG + Intergenic
1003065553 6:2901726-2901748 GGCCTTGGGGATGGGTGTGGGGG - Intronic
1006268942 6:32949325-32949347 GGCCTTTGGCCTGGGTGTGCTGG - Exonic
1006296776 6:33173355-33173377 CCTCTTTGGCCTGGGTGTCCCGG + Exonic
1006313276 6:33276406-33276428 GGCCAGTGGTCTTGGTGTGCTGG - Exonic
1006417021 6:33910691-33910713 GGCATTGGGCCTGGGGGGGCAGG + Intergenic
1006445965 6:34079963-34079985 GGCTTTTGTTCTGGGTGAGCTGG - Intronic
1006673527 6:35745460-35745482 GGGCTTTGGGCTGGGGGAGCAGG + Intronic
1006728267 6:36215686-36215708 GGCCTCAGGCCTGGGTGTGTGGG + Intronic
1007423326 6:41732894-41732916 GGCCTTTGTCCTGGGGATGGAGG - Intronic
1008209276 6:48701645-48701667 GGCTGTTGGCCAGGCTGTGCTGG + Intergenic
1009985674 6:70778863-70778885 GGTCTCTGGGCTGGGTGTGTGGG + Intronic
1015981904 6:138847662-138847684 GGCCTTTAGGCTGGGTGCGGTGG - Intronic
1016865151 6:148758992-148759014 GGCACTAGGCCTGGGTGTGCAGG + Intronic
1016952577 6:149594483-149594505 AGCCTGTGGTCTTGGTGTGCTGG - Intergenic
1017098000 6:150822126-150822148 GTCCTTTGGGCTGGGCGTGGTGG - Intronic
1018268520 6:162051591-162051613 GGCCCTTGGCATGGGTGCTCTGG - Intronic
1018724794 6:166603557-166603579 GGGCTTTGGCATGGAAGTGCAGG + Intronic
1018916257 6:168134353-168134375 GGCCTCTGTCCAGAGTGTGCAGG - Intergenic
1019144845 6:169969980-169970002 GGGCTGTGGCCTGGCTGTGCTGG + Intergenic
1019442022 7:1052346-1052368 GGCCTTGGGGCTGCTTGTGCTGG + Intronic
1019507890 7:1402346-1402368 GGCCTGTGGCCTGGGGGTCATGG - Intergenic
1019508932 7:1407581-1407603 GGCCTGTGGCTTGGGTGGCCTGG - Intergenic
1019603923 7:1899071-1899093 GGCAGTGGGCCTGGGGGTGCCGG - Intronic
1019665806 7:2251898-2251920 GGCCTTTGCCCTTGCTTTGCGGG - Exonic
1019765229 7:2844643-2844665 GGGCTTTGGATTGGGTGTTCGGG + Intergenic
1019904253 7:4048643-4048665 TGCCTCTGGCCTGGGAGGGCTGG - Intronic
1020481566 7:8668806-8668828 GGCCTGGAGCCTGGGTCTGCAGG + Intronic
1023389008 7:39689278-39689300 GGCATGTGGGCTGGGTGTGGTGG - Intronic
1023860719 7:44216395-44216417 GGACTTCGTCCTGGGTGTGAAGG - Intergenic
1025849702 7:65235947-65235969 GGCATATGGCCTGGACGTGCTGG - Intergenic
1027053783 7:75036407-75036429 GGACTTTGGGCAGGGTGTGGTGG - Intronic
1027223247 7:76227411-76227433 GGTCTCTGGCCTGGGTGACCAGG - Intronic
1028306825 7:89276160-89276182 GGCCTGTGGCAAGGGTGTGAGGG + Intronic
1028317183 7:89418055-89418077 CGACTTTGGGCTGGGTGTGGTGG - Intergenic
1028884661 7:95917899-95917921 GCCCCTTGGCCTGGGGCTGCAGG + Intronic
1029414763 7:100435947-100435969 GGCCTTGGGCCTGGAGCTGCGGG - Exonic
1029437491 7:100571306-100571328 GGGCTCTGGCCTGGCGGTGCCGG - Intergenic
1029445873 7:100612611-100612633 GGCCCTGGGCCTGGGTCTGCGGG + Exonic
1029479468 7:100803813-100803835 GGCCTTTGGCTTGGGTGCCAGGG + Intronic
1029655127 7:101919132-101919154 GGGCTGTGGCCGGAGTGTGCTGG + Intronic
1031442135 7:121807802-121807824 TGCCTTTGTCCTGGATATGCAGG + Intergenic
1031833890 7:126658803-126658825 GTCATTTGGCCAGGGTCTGCTGG - Intronic
1032165442 7:129541357-129541379 GGGCTGTGGCCTGGCTGTGATGG + Intergenic
1034070132 7:148176504-148176526 GGGCTCTGGGCTGGGTGTGGTGG - Intronic
1034101040 7:148450831-148450853 GTCCTTTGGGCTGGGTGCGGTGG + Intergenic
1035050738 7:155997870-155997892 GGCCTCTGTTCTGGGGGTGCTGG + Intergenic
1036160385 8:6382198-6382220 GGATTTTGGGCTGGGTGTGGTGG + Intergenic
1036502951 8:9330120-9330142 GGACTTTTGCCTGGGCGTGGTGG + Intergenic
1036775936 8:11613257-11613279 AGCCTTGGGCCTGTGGGTGCCGG + Intergenic
1038692916 8:29779585-29779607 GCCATTTTGCATGGGTGTGCAGG + Intergenic
1039067035 8:33617771-33617793 GGCCTGGTGCCTGGGTTTGCAGG + Intergenic
1039487806 8:37925355-37925377 GGGATTTGGCCTGGGTATGAAGG - Intergenic
1043602914 8:81962685-81962707 AGCCTTTTGGCTGGGTGTGGTGG + Intergenic
1044701963 8:94973419-94973441 GACCTTTGGGCTGGGTGCGGTGG + Intronic
1046066411 8:109202264-109202286 GGCCTCTGGCCTGGGTATCTGGG - Intergenic
1046785259 8:118258922-118258944 GAGTTTGGGCCTGGGTGTGCAGG - Intronic
1046893000 8:119443213-119443235 GGCCTATTGGCTGGGTGTGGTGG - Intergenic
1047532751 8:125692241-125692263 GACATTTGGGCTGGGTGTGGTGG + Intergenic
1049235093 8:141508301-141508323 CGCCTTAGGCCTGGGGCTGCGGG + Intergenic
1049686720 8:143942098-143942120 GGGCTTTGGCCTGGGTTTCCAGG - Intronic
1049986793 9:959338-959360 GGCCTTTGGCCTGGGCTGACAGG + Intronic
1050048717 9:1575910-1575932 GGCCTTGAGCCTGAGTCTGCAGG + Intergenic
1051092081 9:13421770-13421792 GGCTTTTGGCATGGATGTGTTGG - Intergenic
1051160622 9:14203639-14203661 GGCCTTTGCCCTTGGTGAGGCGG - Intronic
1051421856 9:16896813-16896835 GGCCTATGGGCTGGATGTGGTGG - Intergenic
1053345405 9:37374531-37374553 TGCCATTGGTCTGGGGGTGCAGG - Intergenic
1055295235 9:74827023-74827045 GACCTTGGGGCTGGGTGTGGTGG - Intronic
1056433445 9:86551538-86551560 GCCTTTTGGGCTGGGTGTGGTGG - Intergenic
1057702068 9:97370523-97370545 GTCCTCTGACCTGGGTGTGTGGG - Intronic
1057798329 9:98173827-98173849 AGCCTTTGGTCTGGGTGTGGTGG + Intronic
1058013409 9:100003719-100003741 GGCCTTGAGCCTGAGTCTGCAGG + Intronic
1060537877 9:124405971-124405993 GGACTGTGGGCTGGGTGTGGTGG - Intronic
1060610216 9:124957278-124957300 GGCCTTGTGGCTGGGTATGCTGG - Intronic
1060724701 9:125999274-125999296 TGCGTCAGGCCTGGGTGTGCTGG + Intergenic
1061700395 9:132410849-132410871 GGCCTTTACCCTGGGAGGGCTGG - Intronic
1062023539 9:134330162-134330184 GGCCTCTGCCCTGTGTCTGCTGG - Intronic
1062254398 9:135614272-135614294 GGCCCTTGGCCTGGGCCTGGCGG + Intergenic
1062299697 9:135858760-135858782 GGCCTTTGGCCTTGGCCTGGGGG - Intronic
1062612906 9:137382998-137383020 GGCCTCAGGCCTGGCAGTGCTGG + Intronic
1062614003 9:137387867-137387889 GAACTTGGGCCTGGGTGTGGAGG - Intronic
1062617248 9:137403438-137403460 GACCCTGGGCCAGGGTGTGCTGG - Intronic
1062636141 9:137492735-137492757 GGGCTATGGGCTGGGTGGGCCGG + Intronic
1188247697 X:27854811-27854833 GGCCTTTGGCATTGATGTGAAGG + Intergenic
1189504267 X:41595310-41595332 GACCTTAGGGCTGGGTGTGGTGG + Intronic
1190310614 X:49114637-49114659 GGCCTTTCAGCTGGGTGTGGTGG + Intronic
1191112941 X:56821915-56821937 GGCCTAGAGCCTGGGTCTGCAGG - Intergenic
1191956958 X:66652210-66652232 GGCCTCTATCCTGGGTCTGCAGG - Intergenic
1192034233 X:67545881-67545903 GTCCATGGGCCTGGGTGTGGAGG + Exonic
1192211910 X:69133130-69133152 GGTCTCTGCCCTGGGCGTGCTGG - Intergenic
1192618730 X:72655118-72655140 TGCATATGGCCTGGGTGTGGTGG + Intronic
1192960388 X:76124315-76124337 GGCCTTTGGACTAGGTGTCCAGG - Intergenic
1195564377 X:106323908-106323930 GGCCTGGGCCCTGGGTCTGCTGG - Intergenic
1197214659 X:123856861-123856883 GTCCTTTGGCTTGGGGGTTCTGG + Intergenic
1197487675 X:127074352-127074374 GGACTTTGGGCTGGGTGTGGTGG - Intergenic
1198597261 X:138250078-138250100 GGCCCTTGGGCTGGGGGTGGTGG + Intergenic