ID: 1006269386

View in Genome Browser
Species Human (GRCh38)
Location 6:32952145-32952167
Sequence GCCACTGTATTGACTAGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006269380_1006269386 14 Left 1006269380 6:32952108-32952130 CCTCCCAAAGGGGATTCCTTTGT 0: 1
1: 0
2: 1
3: 12
4: 138
Right 1006269386 6:32952145-32952167 GCCACTGTATTGACTAGAGAAGG No data
1006269382_1006269386 10 Left 1006269382 6:32952112-32952134 CCAAAGGGGATTCCTTTGTCTAA 0: 1
1: 0
2: 0
3: 17
4: 126
Right 1006269386 6:32952145-32952167 GCCACTGTATTGACTAGAGAAGG No data
1006269381_1006269386 11 Left 1006269381 6:32952111-32952133 CCCAAAGGGGATTCCTTTGTCTA 0: 1
1: 0
2: 0
3: 12
4: 131
Right 1006269386 6:32952145-32952167 GCCACTGTATTGACTAGAGAAGG No data
1006269384_1006269386 -2 Left 1006269384 6:32952124-32952146 CCTTTGTCTAATTCATACCAGGC 0: 1
1: 0
2: 0
3: 8
4: 93
Right 1006269386 6:32952145-32952167 GCCACTGTATTGACTAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006269386 Original CRISPR GCCACTGTATTGACTAGAGA AGG Intronic
No off target data available for this crispr