ID: 1006269620

View in Genome Browser
Species Human (GRCh38)
Location 6:32953749-32953771
Sequence TAGGAGGAACATAATCAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006269614_1006269620 20 Left 1006269614 6:32953706-32953728 CCAAGTGTTTTGGAAGTCGCAGT 0: 1
1: 0
2: 0
3: 12
4: 170
Right 1006269620 6:32953749-32953771 TAGGAGGAACATAATCAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006269620 Original CRISPR TAGGAGGAACATAATCAGGC AGG Intronic
No off target data available for this crispr