ID: 1006269818

View in Genome Browser
Species Human (GRCh38)
Location 6:32955583-32955605
Sequence CTTCTCAGCCCACCACAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 1, 2: 6, 3: 26, 4: 217}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006269818_1006269822 -7 Left 1006269818 6:32955583-32955605 CCAGATTGTGGTGGGCTGAGAAG 0: 1
1: 1
2: 6
3: 26
4: 217
Right 1006269822 6:32955599-32955621 TGAGAAGTAAGTGGGAGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006269818 Original CRISPR CTTCTCAGCCCACCACAATC TGG (reversed) Intronic
900092957 1:928486-928508 CTTCCCAGCACAGCACACTCCGG + Intronic
900322867 1:2093695-2093717 CATCTCAGCCCACCACGTTTGGG - Intronic
900857096 1:5195033-5195055 CTTCCCATACCACCACAAGCTGG + Intergenic
901137346 1:7006595-7006617 CATCTCAGCCCACCTCAACTGGG - Intronic
902755023 1:18543272-18543294 ATTCTCAGCCTACCACAGCCAGG - Intergenic
903071119 1:20727389-20727411 CTGACCAGCCCACCACAAACAGG + Intronic
903580749 1:24368768-24368790 AATCTCGGCTCACCACAATCTGG + Intronic
904084416 1:27894878-27894900 CTCCTCAGCCCACCATATTTGGG + Intronic
904368796 1:30035405-30035427 CCTCTCAGCCCACCTCTTTCAGG - Intergenic
905006650 1:34715299-34715321 CTTATCATCCCACCAGCATCTGG + Intronic
906749393 1:48245491-48245513 CTTCACAGACCACCACCATGAGG + Intronic
907999649 1:59668052-59668074 CTTCTCAGCTCATCAGAATCAGG + Intronic
908118859 1:60966819-60966841 CATCTGAGACCACCTCAATCTGG + Intronic
908267158 1:62390712-62390734 ATACTCAGCCCAGCACAATGGGG + Intergenic
908641872 1:66232825-66232847 CTTCTCAACACACTAGAATCAGG - Intronic
909137255 1:71817065-71817087 CTCCTCAGCCCACTCCAATCAGG + Intronic
909469849 1:76014555-76014577 CTATTCAGCCCTCCACCATCTGG + Intergenic
912581721 1:110726848-110726870 CTCTTCAACCCACTACAATCTGG - Intergenic
915063931 1:153209303-153209325 CTTCTAAGCCCTCCCAAATCAGG + Intergenic
915956758 1:160226771-160226793 CTTCTCAGTCCATCCTAATCTGG + Intronic
916859922 1:168792511-168792533 CTTCTTAGCCCACAACACACTGG - Intergenic
917270732 1:173270638-173270660 CTTCACAGCCCAACATAATTGGG - Intergenic
920876439 1:209840556-209840578 CTTCTCACTCCACTGCAATCCGG - Intronic
921729051 1:218556087-218556109 CTTTTAAGCCCACCACAGTTAGG + Intergenic
922058870 1:222068467-222068489 CTCCTCAGCCAACAACAGTCAGG + Intergenic
924561498 1:245159810-245159832 CTTCTCAGGCCACCAGAGCCAGG - Intronic
1062759894 10:10453-10475 CTTTGCAGCCCTCAACAATCAGG - Intergenic
1063139578 10:3244348-3244370 CTCCTCAGCACACCACACTTAGG - Intergenic
1063604026 10:7507381-7507403 CTTCTTAGTCTGCCACAATCTGG - Intergenic
1064166283 10:12989102-12989124 CTTCATAGCCCCCTACAATCTGG + Intronic
1066290716 10:34012268-34012290 CTTATCAACCAACCGCAATCAGG + Intergenic
1072801614 10:98396137-98396159 CCTCTCAACCCACCACAACTTGG + Intronic
1073177312 10:101564518-101564540 CTTCTCACCCCAGCACATTCAGG + Intergenic
1074856264 10:117476221-117476243 CTTCTAATCCCACCACTCTCAGG - Intergenic
1075960588 10:126564296-126564318 CTTCTGTGCTCACCACAACCTGG - Intronic
1076491014 10:130861682-130861704 CTTCTCAGGCCATCACCACCAGG - Intergenic
1078082306 11:8212945-8212967 CTCCTCAGCCCCCCACCACCAGG - Intergenic
1078100264 11:8326212-8326234 CTGCTCAGACCACCTCAACCAGG + Intergenic
1079140210 11:17803696-17803718 CTTCTCAGCCTTCCTCGATCTGG + Intronic
1085236232 11:75017600-75017622 CTCCTCAGCCCAGCATACTCAGG - Intronic
1086334160 11:85782850-85782872 CATCTGAGACCACCTCAATCTGG + Intronic
1086942713 11:92815052-92815074 CTTCACAAACAACCACAATCAGG - Intronic
1087113549 11:94498063-94498085 CTTCTCAGCTTACCACAGTGCGG + Exonic
1087385434 11:97463431-97463453 CTTCTGAGACCACCTCAACCTGG - Intergenic
1087722941 11:101687481-101687503 CTTCTGAGCCCACCCCAATCAGG + Intronic
1089084456 11:115805302-115805324 TCTCTAAGCCCACCACAATGGGG + Intergenic
1089939116 11:122397008-122397030 ATTATCAGCCTACCACAATCTGG + Intergenic
1090510734 11:127372041-127372063 CTACTCAGCCCAGCGCCATCTGG + Intergenic
1090620288 11:128554362-128554384 CTTCTCAACCTACCAAAAGCTGG + Intronic
1090733892 11:129594582-129594604 TTTCTCAGATCACCACAGTCAGG + Intergenic
1091227442 11:133966103-133966125 CTTCTGAGCCCTCCCCAGTCAGG - Intergenic
1091595909 12:1878997-1879019 CATCTGAGCCCACCACACCCAGG + Exonic
1094714987 12:33004638-33004660 CTTCCCAGACCACATCAATCAGG + Intergenic
1097288432 12:57895075-57895097 CTTCCCAGCCCACCCCTAGCAGG - Intergenic
1097627981 12:62024131-62024153 CCTCTCATCCCAACAAAATCTGG + Intronic
1098836035 12:75425307-75425329 CTTCTCAGCCCACTCCAACATGG - Intronic
1100819397 12:98417247-98417269 CCTCTCAGTCCCCGACAATCTGG - Intergenic
1100921571 12:99494252-99494274 CTTCTCAGCCCACTTTAGTCAGG - Intronic
1101828280 12:108237728-108237750 CTCCTCAGGCAACCAGAATCTGG + Intronic
1104038227 12:125113293-125113315 CTTCTAGGCCCTCCACAACCAGG + Intronic
1108555582 13:51588553-51588575 CTTCTCTAACCACCACAAGCAGG - Intronic
1110205809 13:72911800-72911822 TTTTTCAGCCCACCACATTTGGG - Intronic
1110623088 13:77621272-77621294 TCTCTAAGCCCACCACGATCTGG + Intronic
1110730985 13:78877908-78877930 ACTCTCATCCCACCACCATCTGG - Intergenic
1112552015 13:100430198-100430220 GATCTCAGCTCACCACAACCCGG - Intronic
1113230167 13:108205047-108205069 CTTTTGAGACCACCACATTCAGG - Intergenic
1117684372 14:58238321-58238343 CTTCTCAACCCACCCTAGTCAGG - Intronic
1117954159 14:61109904-61109926 TTTCTCAGCCCACAACAACCAGG + Intergenic
1119972495 14:78987220-78987242 GTTCTCAGACGACCACAACCTGG - Intronic
1120189798 14:81430158-81430180 CTTCCCAGCCCAGCACAATCTGG + Intronic
1120343809 14:83257655-83257677 CTGCTCAGCCCACTTCTATCTGG - Intergenic
1120930872 14:89847086-89847108 CTTCTCAACCCAAAGCAATCTGG + Intronic
1121339961 14:93099322-93099344 CTTCTCAACCCTCCCCAAGCAGG + Intronic
1123507150 15:20954467-20954489 CTCCTCAGCCTACAGCAATCTGG + Intergenic
1123564377 15:21528214-21528236 CTCCTCAGCCTACAGCAATCTGG + Intergenic
1123600630 15:21965497-21965519 CTCCTCAGCCTACAGCAATCTGG + Intergenic
1126141739 15:45444927-45444949 CTTCTCAGCCCACCAGACCCTGG + Intronic
1128524269 15:68401908-68401930 CTGCTCACCCCACCACCATCTGG - Intronic
1128770585 15:70278759-70278781 CTTCCCAGCTCACCACGGTCAGG + Intergenic
1202972738 15_KI270727v1_random:255318-255340 CTCCTCAGCCTACAGCAATCTGG + Intergenic
1132553362 16:562255-562277 CTGCTCAGCCCAGCTCCATCTGG - Intronic
1133174175 16:4001429-4001451 CTTCTCAGCACACCACACTAGGG + Intronic
1133293234 16:4736470-4736492 CTTCTCAGTGCACCATAATCCGG - Exonic
1133750226 16:8719524-8719546 CCTCTCTGCCCACCTCAATCAGG - Intronic
1136654705 16:31702926-31702948 CTCCTTAGCCCACCACAGTCTGG - Intergenic
1138323224 16:56137454-56137476 CTTCTCAGCCCACTGCAATCTGG + Intergenic
1140058506 16:71546731-71546753 CTCCTCAACCCACTCCAATCTGG + Intronic
1142334147 16:89476288-89476310 CTTAATAACCCACCACAATCGGG + Intronic
1145917029 17:28580466-28580488 CTCCCCAGCCCACTACACTCAGG + Intronic
1145969515 17:28948998-28949020 CGGCTCAGCCCAGGACAATCCGG - Intronic
1146613245 17:34327208-34327230 CTTCTCAGTGCACCATTATCAGG - Intergenic
1148150437 17:45393807-45393829 CTTCTCCGGCCACCACATTTGGG + Intergenic
1149345826 17:55734372-55734394 CTTCTTAGCTGAACACAATCTGG - Intergenic
1150146418 17:62773401-62773423 CTCCTCAGCCCACTCCAATCTGG - Intronic
1151612332 17:75184200-75184222 CTCCTCAACCCACTGCAATCTGG + Intergenic
1152952765 18:10649-10671 CTTTGCAGCCCTCAACAATCAGG - Intergenic
1153266001 18:3270095-3270117 CTTTTCAACCCACCACAATCTGG - Intronic
1153914688 18:9734867-9734889 CTTCTCAGCTCATCAGAATTGGG + Intronic
1154268868 18:12902016-12902038 TTTCTCAGCCCATCGCCATCTGG + Intronic
1155311876 18:24532224-24532246 TTTCTCAACCCACTACAATTAGG + Intergenic
1156989340 18:43388424-43388446 CTACTCAGGCCACCAAAAACTGG - Intergenic
1157282826 18:46357476-46357498 CAGCACAGCCCACCAAAATCAGG - Intronic
1158777347 18:60600249-60600271 CTTATCAACCCACCACAGACTGG + Intergenic
1160436043 18:78853599-78853621 CTTCCCATCCCACCACCACCAGG + Intergenic
1161364037 19:3868363-3868385 CTTCTCCTCCCCCCGCAATCGGG + Intronic
1161722292 19:5909875-5909897 CTTCTTAGCCCAGGACATTCAGG + Exonic
1162727136 19:12696451-12696473 GTTCTCAGTCCGCCAAAATCCGG - Exonic
1163018186 19:14469597-14469619 CTTCTCACCCCTCCACCCTCAGG + Intronic
1165920735 19:39296492-39296514 CTTCCAAGCCCACCACAACTGGG + Exonic
926188072 2:10707198-10707220 CTCCTCAGCCCTCCACAGCCTGG - Intergenic
927293543 2:21427617-21427639 CTTCTCACCCCTCTCCAATCTGG + Intergenic
927974644 2:27329036-27329058 CTCCTCTCCCCACAACAATCTGG + Intronic
928126419 2:28619794-28619816 CTTCTGAGGTCACCATAATCTGG - Intronic
928417115 2:31104779-31104801 CTTCTCAGCCCATCACATCCAGG + Intronic
928738796 2:34324718-34324740 CTTCCCAGCCTACTACACTCTGG + Intergenic
929420629 2:41786007-41786029 CTTCTAAGCACATCACAATTTGG + Intergenic
929705891 2:44211456-44211478 CTTCTCAGTGCATCACAATCAGG + Intronic
931376301 2:61711533-61711555 CTTCTCAACCCACCACAAACTGG + Intergenic
931659017 2:64539806-64539828 CTCCTCAACTCAACACAATCTGG - Intronic
932090656 2:68803409-68803431 CCTCTCAACCCATCACAATCTGG - Intronic
932239612 2:70146410-70146432 TATCACAGCCCATCACAATCTGG - Intergenic
934094403 2:88585765-88585787 CTTCTCAACCCATCACAGTCTGG - Intronic
935626066 2:105173206-105173228 CATCTCAGACCACCTCAACCTGG + Intergenic
936795073 2:116194916-116194938 CATCTCAGACCACCTCAACCTGG + Intergenic
937519249 2:122691530-122691552 CTCCTCAGCCTACTCCAATCTGG + Intergenic
937954575 2:127414891-127414913 CTGCTCAGCCCACCCCAGGCAGG - Intergenic
938930648 2:136083843-136083865 CTCCTCAGCCCACTCCATTCAGG + Intergenic
940259990 2:151769585-151769607 ATTCTAGGCCTACCACAATCTGG + Intergenic
941630939 2:167883498-167883520 CTTCCCTGCCATCCACAATCTGG + Intergenic
941665546 2:168241019-168241041 CCTCTCAGCCCACTGCAGTCTGG - Intronic
942319759 2:174726084-174726106 CCTCTGAGCCCAACACAATAAGG - Intergenic
942434129 2:175952727-175952749 CTTCTTAACCCAACTCAATCTGG + Intronic
942534882 2:176952396-176952418 CTTGTCTTCCCAGCACAATCAGG - Intergenic
1169336951 20:4764495-4764517 TTTTTCAGCCTACCACACTCTGG - Intergenic
1170454080 20:16516478-16516500 CCTCTCAGCCCAGCACACTAAGG + Intronic
1170579535 20:17687374-17687396 TTTCTTAGCCCTCCACGATCTGG - Intergenic
1172862220 20:38063489-38063511 CTCCTGAGCCCACCCCAATCGGG - Intronic
1173212217 20:41043837-41043859 CTTCTCAGGCCAGCTCAATTAGG - Intronic
1173265781 20:41478678-41478700 CATTTCAGACTACCACAATCAGG - Intronic
1173310497 20:41892511-41892533 CTTCCCAGCCCACCACCACTGGG + Intergenic
1173859270 20:46271554-46271576 CTTCTCAGCCCACTGCCATCTGG + Intronic
1173860126 20:46277803-46277825 CTGCTCAGCCCACTCCAATCTGG - Intronic
1173864796 20:46307212-46307234 CTTCTCTGCCCGCCACAAGGGGG + Intronic
1173952775 20:47006378-47006400 CTTTACAGCCCACCCAAATCCGG + Intronic
1174376447 20:50129514-50129536 CCTCCCAGCCCACCACTAGCTGG + Intronic
1175282551 20:57813826-57813848 CTCCTCAACCCACCACCATCTGG - Intergenic
1175397236 20:58674679-58674701 CTTCTCTTCCCACCACAGGCTGG - Intronic
1175889810 20:62311128-62311150 CCTCTCAGCCCACCCCAGCCGGG + Intronic
1177204356 21:17994562-17994584 CCTCTCAGTCCACTACCATCAGG - Intronic
1178178675 21:30133672-30133694 CATCTGAGACCACCTCAATCTGG + Intergenic
1178942102 21:36914880-36914902 TGTCTCAGCCCAACACAAACAGG + Intronic
1180678578 22:17606715-17606737 CTTCTCATGCCATAACAATCTGG + Intronic
1181918336 22:26298886-26298908 CTTCTCTCCCCAGCACAAACTGG + Intronic
1182261955 22:29079505-29079527 CTCCTCAGCCCACTAGAAGCAGG - Intronic
1183002948 22:34876838-34876860 CTGCCCAGCCCACCACCACCAGG + Intergenic
1183593706 22:38796920-38796942 CTCTTCAGCCCACTGCAATCTGG + Intergenic
1183673625 22:39287800-39287822 CTTTTCAACCCACAACAATGTGG + Intergenic
1184341420 22:43888070-43888092 TTCCTCAGCCCACCTCAGTCTGG - Intronic
1185381361 22:50508957-50508979 CTCCTCAGCCCAGCTCAGTCTGG + Intronic
949212732 3:1525069-1525091 CTTCTTAACCCCCCAAAATCAGG - Intergenic
949242448 3:1888921-1888943 CTCCTGAGGCCACCACAATATGG - Intergenic
949696199 3:6699152-6699174 TTTCTCAATCCACCAAAATCAGG + Intergenic
949796517 3:7857184-7857206 CTTCTCAGTCCTCCACAGTTAGG + Intergenic
950681867 3:14590989-14591011 TATCTCTGCCCTCCACAATCTGG + Intergenic
952401134 3:32965331-32965353 CATCTGAGACCACCTCAATCTGG - Intergenic
952516822 3:34112861-34112883 CTTCTCAACCCACTCCAGTCTGG + Intergenic
952970207 3:38645912-38645934 CTTCTCAACCCACTCCAAACTGG + Intronic
954800892 3:53186392-53186414 CTCCTCAGCCCCCCTCAGTCAGG + Intronic
959527345 3:107391982-107392004 CTTCTCAGCCCACTCCAAACTGG + Intergenic
961699659 3:128732711-128732733 CGTCTCAGCCTCCCACCATCTGG - Intronic
961815534 3:129548284-129548306 ATTCTCAGCCTACCCCAAGCCGG + Intronic
962720219 3:138166857-138166879 GTTCCCATCCCACCACAGTCTGG + Intronic
963059589 3:141214436-141214458 CTTCTCAGCACATCACTACCAGG - Intergenic
963923699 3:150929411-150929433 TATCTCAGGCCACCACAATAGGG + Intronic
963951517 3:151207404-151207426 CTATTCACCCCACCACAGTCTGG - Intronic
964555834 3:157936954-157936976 CTTCTCAGGCATTCACAATCTGG - Intergenic
966602394 3:181788476-181788498 CATCTCAGCCCTCCAGTATCAGG + Intergenic
967467807 3:189827753-189827775 ATTCACAGCCCATCTCAATCTGG - Intronic
968438416 4:608350-608372 CTTCTAAACCCTCCACAGTCTGG + Intergenic
968722734 4:2219698-2219720 TTTCCCAGCCCTCCACAATATGG + Intronic
972035314 4:34512675-34512697 CTTCTCTTCCCACTATAATCTGG - Intergenic
975678095 4:76847687-76847709 CTTTTCAACCCACCACAAAATGG + Intergenic
976376610 4:84352793-84352815 GTTCTCAGCCCGCCATACTCTGG - Intergenic
977518887 4:98056239-98056261 CTTCTCTGTCCCCCACAAGCAGG - Intronic
979860221 4:125683794-125683816 CTTCTCACCCCAGCACAATCTGG + Intergenic
980308665 4:131099467-131099489 CTTCTCTTCTCACCACAATGTGG + Intergenic
981715154 4:147745226-147745248 CTTCTCAGCCCTCTGCAAGCAGG - Intronic
982966277 4:161912863-161912885 CTTCTGAGACCACCTCAGTCTGG - Intronic
984991576 4:185386487-185386509 CCTCTCTGCCCACCACTTTCTGG - Intronic
985425511 4:189826483-189826505 CTTCTGAGCCCACATCAGTCTGG - Intergenic
996641543 5:125761131-125761153 CATCTGAGACCACCTCAATCTGG - Intergenic
998953434 5:147414479-147414501 CTTCTCAGCCCACAGTATTCTGG + Intronic
1000030583 5:157397863-157397885 CTTCTCAGACCACCTCAGCCTGG + Intronic
1001014169 5:168125796-168125818 CTTCTCAGCCCACTTGACTCTGG + Intronic
1003657616 6:8028122-8028144 CTTCCTACCCCACCCCAATCCGG + Intronic
1004494425 6:16150387-16150409 GTACTCAGCTCACTACAATCTGG - Intergenic
1005124618 6:22432415-22432437 CTTTTCATCCCATAACAATCAGG + Intergenic
1005655351 6:27929773-27929795 CATCTGAGACCACCACAACCTGG + Intergenic
1006269818 6:32955583-32955605 CTTCTCAGCCCACCACAATCTGG - Intronic
1011238015 6:85239059-85239081 ATTCTCAGCCCAGCGCCATCTGG + Intergenic
1011592346 6:88982333-88982355 CTTCTCAACCAACCACACTGTGG + Intergenic
1011738933 6:90340076-90340098 GTTCTCAGGCCTCCACAATTGGG + Intergenic
1013945732 6:115720017-115720039 CTTCTTAGCCCCATACAATCTGG - Intergenic
1014295279 6:119610054-119610076 CTTCTCAGCCCACTACAATCTGG - Intergenic
1016126229 6:140407774-140407796 TATCTCAGACCACCACAACCTGG - Intergenic
1018014517 6:159699888-159699910 GTTCTCAGTGGACCACAATCTGG - Intronic
1019259847 7:75631-75653 CTTCTCATCCCACCACATCAGGG - Intergenic
1020119946 7:5497497-5497519 CTTCTCAACCCAACACTAACAGG + Intronic
1023291220 7:38670878-38670900 CTTTGCAGCCCACCACAACAGGG + Intergenic
1024156209 7:46628396-46628418 TGTCTCAGCCCCCCACAGTCTGG - Intergenic
1024259000 7:47560050-47560072 CTTTGCAGCCCACCTCAAACTGG + Intronic
1027782990 7:82542809-82542831 CTTCTCAACCCATTGCAATCTGG + Intergenic
1028625216 7:92870100-92870122 CTTCTCAGCCTCCCAAAATCTGG - Intergenic
1034032440 7:147782807-147782829 CTTCTCAGCTATCTACAATCAGG + Intronic
1037903384 8:22701398-22701420 CTACTCAGCCTAAAACAATCAGG + Intergenic
1038554112 8:28494536-28494558 CTCCGCAGCCCGCCACAGTCCGG - Intronic
1041131735 8:54709106-54709128 ATTCTCAGTCCTCCACAATGGGG - Intergenic
1042832062 8:73041503-73041525 CTTCTCAGCCCACCACCCCTTGG + Intronic
1045182187 8:99796287-99796309 CTTCTTAGCCCACTGTAATCTGG - Intronic
1047380385 8:124356543-124356565 CTTCTCAGCCAACTAAAATCTGG + Intronic
1048009980 8:130447781-130447803 GTCCTCAACCCACCGCAATCTGG - Intergenic
1049420352 8:142513685-142513707 CTTCTCCCCACACCACACTCAGG - Intronic
1051340649 9:16106822-16106844 CTTATCTGCCCAGCACACTCAGG + Intergenic
1052917136 9:33931995-33932017 CTCCGCAACCCACCACAATCTGG + Intronic
1053785608 9:41650561-41650583 CTCCTCAGTCCACCAGATTCTGG + Intergenic
1054159425 9:61663616-61663638 CTCCTCAGTCCACCAGATTCTGG - Intergenic
1054174327 9:61864527-61864549 CTCCTCAGTCCACCAGATTCTGG + Intergenic
1054449184 9:65393572-65393594 CTCCTCAGTCCACCAGATTCTGG + Intergenic
1054479197 9:65594621-65594643 CTCCTCAGTCCACCAGATTCTGG - Intergenic
1054663211 9:67716264-67716286 CTCCTCAGTCCACCAGATTCTGG - Intergenic
1055697546 9:78903013-78903035 CTTCACAGCCCTCCATCATCTGG - Intergenic
1055858632 9:80722874-80722896 CTTCTGAGACCACCACAGCCTGG + Intergenic
1056233358 9:84569099-84569121 ATTCTCTGCCCACCAGACTCTGG + Intergenic
1058672962 9:107376201-107376223 ATCCTCAGCCCACAGCAATCTGG - Intergenic
1059934964 9:119300718-119300740 CTTCTCAACTCACTACACTCTGG + Intronic
1060554814 9:124502860-124502882 CTTCTCAGCCCAACCCAGGCTGG + Intronic
1061670661 9:132186458-132186480 CCTCCCCGCCCACCACACTCTGG + Intronic
1062008388 9:134253097-134253119 CTCCCCAGCCCACCCCAACCCGG - Intergenic
1062393551 9:136343454-136343476 CTTCTCAGCCCTCCACCGTCTGG + Intronic
1185926234 X:4150152-4150174 CATCTCAGCTCAGCACAAGCTGG + Intergenic
1187250988 X:17597802-17597824 CTCCAGAGTCCACCACAATCAGG - Intronic
1190058916 X:47198541-47198563 CTTCCCAGCCCAGCATAATGAGG - Intronic
1191642396 X:63441633-63441655 CGTCTCAGTGCTCCACAATCAGG - Intergenic
1192612025 X:72576228-72576250 CTTCTTAAACCCCCACAATCTGG - Intergenic
1195617749 X:106926547-106926569 TTTTTCAACCCACCACAATCTGG - Intronic
1195690121 X:107617398-107617420 ATTCAAAGCCCTCCACAATCTGG + Intergenic
1196193151 X:112814633-112814655 CTTCTCTGCCCACCCCCATTGGG - Intronic
1197404208 X:126029771-126029793 CTTCTCTGTGCACCACAAGCAGG + Intergenic
1198429957 X:136555311-136555333 CTCTTCAGCCCACTTCAATCTGG - Intronic
1202380010 Y:24268520-24268542 CCTCTCAGCACACCACAAGGAGG - Intergenic
1202490772 Y:25401602-25401624 CCTCTCAGCACACCACAAGGAGG + Intergenic