ID: 1006271076

View in Genome Browser
Species Human (GRCh38)
Location 6:32968315-32968337
Sequence AGGTGCGGCTTCGCTGGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 75}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006271076_1006271084 6 Left 1006271076 6:32968315-32968337 CCAGGACCAGCGAAGCCGCACCT 0: 1
1: 0
2: 0
3: 6
4: 75
Right 1006271084 6:32968344-32968366 CACCGAGGAGGAAACAAGCCTGG 0: 1
1: 0
2: 0
3: 22
4: 189
1006271076_1006271078 -9 Left 1006271076 6:32968315-32968337 CCAGGACCAGCGAAGCCGCACCT 0: 1
1: 0
2: 0
3: 6
4: 75
Right 1006271078 6:32968329-32968351 GCCGCACCTTACACCCACCGAGG 0: 1
1: 0
2: 0
3: 3
4: 67
1006271076_1006271080 -6 Left 1006271076 6:32968315-32968337 CCAGGACCAGCGAAGCCGCACCT 0: 1
1: 0
2: 0
3: 6
4: 75
Right 1006271080 6:32968332-32968354 GCACCTTACACCCACCGAGGAGG 0: 1
1: 0
2: 0
3: 6
4: 96
1006271076_1006271089 29 Left 1006271076 6:32968315-32968337 CCAGGACCAGCGAAGCCGCACCT 0: 1
1: 0
2: 0
3: 6
4: 75
Right 1006271089 6:32968367-32968389 CCACCCGAGGCTACCCCGCTAGG 0: 1
1: 0
2: 0
3: 9
4: 60
1006271076_1006271086 16 Left 1006271076 6:32968315-32968337 CCAGGACCAGCGAAGCCGCACCT 0: 1
1: 0
2: 0
3: 6
4: 75
Right 1006271086 6:32968354-32968376 GAAACAAGCCTGGCCACCCGAGG 0: 1
1: 0
2: 1
3: 16
4: 346

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006271076 Original CRISPR AGGTGCGGCTTCGCTGGTCC TGG (reversed) Intronic
900995701 1:6122160-6122182 AGGTGCAGCTTCTCAGGGCCTGG + Intronic
905091189 1:35432698-35432720 AGATGCTGATGCGCTGGTCCTGG - Intergenic
911151492 1:94600694-94600716 AGGTGAGGCTGCCCTGCTCCTGG - Intergenic
916211962 1:162366931-162366953 AGGTGCTGCTAAGCTGGTCTGGG + Intronic
920182535 1:204141294-204141316 AGGTATGGCTTCTCTGGCCCTGG - Exonic
923036192 1:230286828-230286850 GGGTGCGGCTTCTCAGGCCCTGG + Intergenic
1064169862 10:13021530-13021552 AGGTGCGGCTTCCTTTGTTCAGG + Intronic
1067094895 10:43293946-43293968 AGATGGGGCTGCTCTGGTCCAGG - Intergenic
1069580653 10:69563861-69563883 AGGTGTGGCTTAGCTGGTTCAGG - Intergenic
1070644317 10:78190958-78190980 AGGTGGAACTTCGCTGGTGCTGG - Intergenic
1076096342 10:127737234-127737256 CGGTGCGGCACCGCTGGCCCAGG + Exonic
1083302716 11:61747302-61747324 AGGTGCGGGTTTAGTGGTCCGGG + Intergenic
1090424429 11:126597209-126597231 AAGAGCAGCCTCGCTGGTCCTGG + Intronic
1091792300 12:3278881-3278903 AGGTGGGGCTTCCCAGGTCTGGG - Intronic
1099608564 12:84836165-84836187 AGATGCTGCTTGGCTGGTGCTGG + Intergenic
1104594260 12:130109794-130109816 AGGTGCGGAGTGGCTGGACCTGG - Intergenic
1108689248 13:52847230-52847252 TGGTGCCACTTCGCTGGTGCCGG - Exonic
1114490966 14:23101719-23101741 AGGAGCAGCTTCCCTTGTCCAGG + Intergenic
1116413339 14:44650500-44650522 AGGTACTGCTTTGGTGGTCCTGG - Intergenic
1117676408 14:58159164-58159186 AGGTGGGGTTTCGCTTGGCCAGG + Intronic
1118752527 14:68817168-68817190 AGCTGCTGGTCCGCTGGTCCTGG + Intergenic
1123087163 14:105722048-105722070 AGGTGAGGGTGCGCTTGTCCCGG + Intergenic
1125387499 15:39153938-39153960 ATGTGTGCCTTTGCTGGTCCAGG - Intergenic
1125514400 15:40309613-40309635 ACCTGCGGCTGCCCTGGTCCCGG + Intergenic
1130305404 15:82709654-82709676 AAGGGCGGCTCCGCTGGCCCCGG - Exonic
1134402189 16:13920371-13920393 AGGTGCGGCCGCGCTGGCGCGGG + Exonic
1136067066 16:27766505-27766527 AGGTGCTGCTTCCCTGATGCTGG - Intronic
1140334935 16:74096158-74096180 AGGTGAGGCTTGGCTGGGCATGG - Intergenic
1151344689 17:73494409-73494431 GGGTGTGGCCTCGCTGGACCTGG - Intronic
1151758036 17:76085857-76085879 AGGAGCGCGTTCGCGGGTCCTGG - Intronic
1152573544 17:81130694-81130716 GGGTGCGGGCTCTCTGGTCCTGG - Intronic
1161186727 19:2926464-2926486 GGGTGCGTCTGCGCTGGTCGTGG - Intergenic
1162800765 19:13109415-13109437 TGGTGCTGCTCAGCTGGTCCAGG + Exonic
1163679372 19:18671975-18671997 AGATTGGGCTACGCTGGTCCAGG - Intergenic
1168591044 19:57634315-57634337 AGGTGAGGCTGAGCTGGTTCAGG + Intronic
926165286 2:10519079-10519101 AGGTGAGGCTTCGGAGGTCTTGG + Intergenic
926362734 2:12105566-12105588 AGGTGCTGGTTCTCTGGTGCTGG + Intergenic
928945856 2:36771237-36771259 ATGTTCGGCTTTGCCGGTCCCGG + Intronic
943661062 2:190559819-190559841 AGGTGAGGTTTGGCTGCTCCAGG + Intergenic
944621405 2:201519187-201519209 TGGTGCGGCTTTGCTGGTGGTGG - Intronic
945419414 2:209616223-209616245 AGGTGGGGCATCACTGGCCCGGG + Intronic
948045596 2:234941164-234941186 AGGTTCCGATTGGCTGGTCCTGG + Intergenic
949041702 2:241852600-241852622 AGGTGCGGCCTCGGAGGCCCCGG - Exonic
1171169084 20:22999519-22999541 AGGGGCTGCCTCGCTGGCCCAGG + Intergenic
1176024888 20:62980939-62980961 AGGTCCGGCATCGCTGGTGGAGG + Intergenic
1178872069 21:36385450-36385472 AGGTACGGCTTCCCTGGCCCGGG + Exonic
1180668140 22:17531320-17531342 AAGTGCGGCTTCGCAGATGCAGG + Intronic
1181776016 22:25160722-25160744 AGGTGTGGCCTGGCTGGGCCAGG - Intronic
1184483828 22:44764439-44764461 AGGGTCGGCTGCGGTGGTCCGGG + Intronic
951729199 3:25791854-25791876 AGGTGCAGCTGTGCTGGTGCTGG + Exonic
954000986 3:47556891-47556913 AGGGGCAGCTTCACTGGTCCAGG - Intergenic
954361515 3:50125097-50125119 GGCTGCGGCTCCGCTGGGCCAGG - Intergenic
963706785 3:148698073-148698095 AGGGCCGGCTGCGCTGGTGCGGG - Exonic
965841562 3:172911327-172911349 AGGTGCTGCTCAGCTGGTACTGG - Intronic
968817672 4:2830113-2830135 AGCTGCGGCTTCTCTGGCCTGGG - Exonic
982198115 4:152936230-152936252 AGCTGCGGCCTCGCTGCTCCTGG - Intergenic
985381179 4:189396579-189396601 ACGTGCTGCTGCGCTGGTGCAGG + Intergenic
987111742 5:14694020-14694042 AGGTAGGGCTTAGCTGGACCTGG + Exonic
998334076 5:141355428-141355450 AGGTGCCGCTGCGCGGGTTCAGG - Exonic
998335082 5:141364558-141364580 AGCTGCCGCTTCGCGGGTTCAGG - Exonic
998337117 5:141383127-141383149 AGCTGCCGCTGCGCTGGTTCAGG - Exonic
1001445062 5:171776496-171776518 ATGTGTGACTTCGCTGTTCCTGG - Intergenic
1006152090 6:31995100-31995122 AGGTCCGGCCTCGGTGGTCTGGG - Exonic
1006158392 6:32027838-32027860 AGGTCCGGCCTCGGTGGTCTGGG - Exonic
1006271076 6:32968315-32968337 AGGTGCGGCTTCGCTGGTCCTGG - Intronic
1016885416 6:148955245-148955267 AGGAGCTGCTGCTCTGGTCCAGG + Intronic
1018316719 6:162563404-162563426 AGGTGCTGCTTTGATGGTCTTGG - Intronic
1019314733 7:379218-379240 AGGTGCGGCTCCTCAGGTGCAGG + Intergenic
1021162967 7:17298814-17298836 AGGTGCCGCCGCGCTGCTCCCGG - Exonic
1032033232 7:128501903-128501925 AGGTGCCTCTTAGCTGGTGCTGG - Exonic
1039475320 8:37836553-37836575 AGGTGTGGGGTCGCTGGTCCCGG - Intronic
1048364837 8:133729719-133729741 AGTTGAGGCCTGGCTGGTCCTGG + Intergenic
1050388733 9:5114533-5114555 AGGTGAGGGTGCGCTTGTCCTGG - Intronic
1052475818 9:28957540-28957562 AGGTGAGGCTTCACAGTTCCAGG + Intergenic
1056796441 9:89662087-89662109 AAGTGCGGCTGGGCTGGGCCTGG + Intergenic
1059235548 9:112757929-112757951 AGCTGGGGCTTCAGTGGTCCTGG + Intronic
1062499071 9:136844653-136844675 TGGCTCGGCTTCGCGGGTCCGGG - Exonic
1187132904 X:16519184-16519206 AGGTACTGCTTTGCTGGTCTTGG - Intergenic
1198073235 X:133170111-133170133 AGGAGCGGTTTGGCAGGTCCAGG - Intergenic
1198714648 X:139544171-139544193 AGGTGCAGCTTGGTTTGTCCAGG - Intronic
1199248256 X:145631477-145631499 TGGTGCTGCTCAGCTGGTCCAGG - Intergenic
1200233502 X:154457881-154457903 GGGCGCGGCCTCGCTGGTCCCGG - Intergenic