ID: 1006271602

View in Genome Browser
Species Human (GRCh38)
Location 6:32970304-32970326
Sequence CCTTCCCCCAGCCAGGGATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 322}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006271602_1006271611 21 Left 1006271602 6:32970304-32970326 CCTGATCCCTGGCTGGGGGAAGG 0: 1
1: 0
2: 0
3: 33
4: 322
Right 1006271611 6:32970348-32970370 CATTTTCCCCCGCCCTCCCGGGG 0: 1
1: 0
2: 0
3: 10
4: 114
1006271602_1006271609 19 Left 1006271602 6:32970304-32970326 CCTGATCCCTGGCTGGGGGAAGG 0: 1
1: 0
2: 0
3: 33
4: 322
Right 1006271609 6:32970346-32970368 CTCATTTTCCCCCGCCCTCCCGG 0: 1
1: 0
2: 1
3: 16
4: 185
1006271602_1006271610 20 Left 1006271602 6:32970304-32970326 CCTGATCCCTGGCTGGGGGAAGG 0: 1
1: 0
2: 0
3: 33
4: 322
Right 1006271610 6:32970347-32970369 TCATTTTCCCCCGCCCTCCCGGG 0: 1
1: 0
2: 1
3: 12
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006271602 Original CRISPR CCTTCCCCCAGCCAGGGATC AGG (reversed) Intronic
900072100 1:779111-779133 GCCTCCCCCAGCCAGGGCCCGGG + Intergenic
900548792 1:3243311-3243333 ACATCCCCCTCCCAGGGATCTGG + Intronic
901132938 1:6973882-6973904 CCTTCCCACAGCCGGGGAAGGGG + Intronic
901449046 1:9325146-9325168 GCTTCCCCCAGCCGGGGCGCTGG + Intronic
902229416 1:15018388-15018410 CCAACCCCCAGCCAGGGCCCTGG - Intronic
902277982 1:15353076-15353098 AAGTCCCCCAGCCAGGGATGGGG - Intronic
902378061 1:16039531-16039553 CCTTCCCACAGCCAGGGTCTAGG + Intergenic
902383150 1:16062027-16062049 CCTTCCCACAGCCAGGGTCTAGG + Intronic
902932360 1:19740618-19740640 ACTTCCCCCAGACAGGAATGCGG + Intronic
904705197 1:32384703-32384725 CCTTCCAGCAGACAGGGATAGGG + Intronic
905315253 1:37078833-37078855 CCTTCCCCCATCCTGAGATCAGG + Intergenic
905661480 1:39729377-39729399 CCTCCAACCAGCCAGGGATGTGG + Intronic
906186088 1:43863130-43863152 ACTTCCCCCAGACAGTGAGCTGG - Intronic
906519517 1:46458871-46458893 CCCACCCCCAGCCAGGGACCAGG - Intergenic
906798707 1:48717998-48718020 CCTTTCCCCAGCCTAGAATCAGG - Intronic
907023060 1:51087282-51087304 ACTTCCTCCAGCCATGGTTCTGG + Intergenic
907118064 1:51987059-51987081 CTTTCCCCCAGCCTGGGACAGGG - Intronic
909078404 1:71080795-71080817 CCTTCTTCCCGCCAGGGAACTGG + Intronic
912272040 1:108221292-108221314 CCTGCCCCCAACCAGGGCTAGGG + Intergenic
912520911 1:110244037-110244059 CCTTCCACCTGCCAAGGATGGGG - Intronic
914241308 1:145854853-145854875 CCTTCCCCCAACCAAGAATGGGG - Exonic
914348117 1:146817188-146817210 CCCTACACCAGCCAGGGGTCTGG - Intergenic
915835370 1:159171731-159171753 CCAGCGCCCAGCCAGGGAGCCGG + Exonic
916418949 1:164618338-164618360 CCTTACCCCAGCCTGGGAGAAGG - Intronic
916792373 1:168136226-168136248 CCTTCTCCCAGCCGGGACTCAGG - Intronic
918343787 1:183589036-183589058 CCTTCCTCCAGCCAGAGGTGGGG + Intronic
920253581 1:204638901-204638923 CCCTTCCCCAGCCTGGGAGCAGG - Intronic
920297471 1:204967841-204967863 CTTCTCCCCAGGCAGGGATCTGG - Intronic
920363805 1:205437483-205437505 TCTTCCCCTAGCCAGGGCCCAGG - Intronic
920435596 1:205944808-205944830 CCTTCCCTCAGCCAGGTGTCAGG - Intergenic
922216815 1:223526593-223526615 TCTTCCCCCAGCCAGGGCTGTGG - Intergenic
922222811 1:223621404-223621426 CCTCCCGCCTGCCAGGGAGCGGG + Intronic
922267036 1:223993066-223993088 GCCTCCCCCAGCCAGGGCCCGGG + Intergenic
922570883 1:226634187-226634209 CCTGCTCCCAGCCAGGGACCAGG + Exonic
923019324 1:230150771-230150793 CCTTTTCCCACCCAGGGATTTGG + Intronic
923520425 1:234731106-234731128 CCTTCCTCCAGACAGGGGCCTGG - Intergenic
1064221282 10:13442246-13442268 CCTTCCCCTAGCCCTGGATTTGG - Intronic
1064259590 10:13774515-13774537 TCCTCCCACATCCAGGGATCGGG - Intronic
1065188730 10:23192421-23192443 GCTGCCCCCAGCCAGGGCCCCGG + Exonic
1066783737 10:38979649-38979671 CCCAGCCCCAGCCGGGGATCAGG - Intergenic
1068989263 10:63133774-63133796 ACTTCCCCCAGCCAGAGAGGAGG - Intronic
1069801330 10:71083747-71083769 GCTTCCCCAAGACAGGGCTCTGG - Intergenic
1070003092 10:72395709-72395731 CCCTCCCCCAGCCAGGCTGCTGG - Intronic
1073927367 10:108532867-108532889 CCCTCCCCCAGCCAGGCTTGCGG - Intergenic
1074699839 10:116083263-116083285 CCTTCCCGGAGCCAGGAGTCTGG + Intronic
1075114294 10:119613040-119613062 CTTTTCCCCAGCCAGGAATACGG - Intergenic
1075699821 10:124462036-124462058 CCTGCCGGCAGCCAGGGAGCGGG - Intronic
1076308073 10:129478783-129478805 CATTCCCCAAGCCAGGACTCTGG - Intronic
1076360642 10:129886517-129886539 CCTTCCCCGAGCCACAGAACGGG - Intronic
1076750598 10:132540616-132540638 CCTTCCACCGGCCAGGCTTCTGG - Intronic
1077020991 11:417119-417141 CCTTCCCCCAGCCCTGGAAAGGG + Intronic
1077284026 11:1757999-1758021 CCCTCCCCCAGCCCTGGATGAGG + Intronic
1077718218 11:4601978-4602000 TCATCCACCAGCCAGGGATAGGG + Intronic
1079289678 11:19175921-19175943 CTTTCACCCAGCCAGGGAGAAGG + Exonic
1080901075 11:36491863-36491885 ACTTCACCCAGCTAGGGAACAGG - Intronic
1082283640 11:50298139-50298161 ACCTCCCCCAGCCAGGGCCCGGG - Intergenic
1082820796 11:57543484-57543506 CCCTCCCCCACCCTGGGCTCTGG - Intronic
1083563734 11:63695546-63695568 CACTACCTCAGCCAGGGATCAGG + Intronic
1083696673 11:64448119-64448141 CGTTCCCACAGCGCGGGATCTGG + Intergenic
1083883716 11:65560539-65560561 TCTTCGCCCATCCAGAGATCAGG - Intergenic
1084555538 11:69873770-69873792 CCCTCCCTCAGCCAGGGCACAGG - Intergenic
1084769678 11:71334509-71334531 CCATCCCCCAGCCAAGGACAGGG - Intergenic
1084775304 11:71370848-71370870 CCCTCCTCCAGCCAGGGCTGGGG - Intergenic
1084814529 11:71638541-71638563 CAGGCCCCCAGCCAGGGCTCAGG - Intergenic
1084972152 11:72777845-72777867 CCCACCCCCACCCTGGGATCAGG + Intronic
1085049983 11:73375477-73375499 CCTGACCCCAGCCAGGCCTCTGG + Intergenic
1085264764 11:75230704-75230726 CCTTCCCCAGGGCAGGGATGGGG + Intergenic
1088850314 11:113698684-113698706 CCTTGCCCCAGCTAGAGATCAGG + Intronic
1089197332 11:116701838-116701860 ACTTCCCCCAGCCTGGGCTAGGG - Intergenic
1089380880 11:118030634-118030656 TCCTCCCCCAGCTTGGGATCAGG - Intergenic
1090417716 11:126552008-126552030 GCTTCCCCCTTCCAGGCATCTGG + Intronic
1091394274 12:143975-143997 CCTTGCCCAAGCCAGGGTTCCGG - Intronic
1092091331 12:5805897-5805919 CTTTCCCCCACCCAGGTATTTGG - Intronic
1094670032 12:32561166-32561188 CCTCCCCCCATCCTGGGTTCAGG + Intronic
1095102259 12:38197397-38197419 CCTTTCCCCAGTAAGAGATCAGG - Intergenic
1095947965 12:47764582-47764604 CCCTGCCCCAGCCAGTGCTCTGG - Intronic
1096575075 12:52547750-52547772 TCTTCTCCCAGGCAGCGATCTGG + Intronic
1096692265 12:53328532-53328554 CCTTGCCGCAGCCAGGGATGTGG + Exonic
1096750513 12:53756039-53756061 CCTCCACCAAGCCAGGGAGCTGG - Intergenic
1097269136 12:57763714-57763736 CCCTCCCCCAGCCAGCGAGCTGG + Exonic
1098036009 12:66302645-66302667 TCTGCTCCCACCCAGGGATCTGG + Exonic
1099046221 12:77723596-77723618 CCTTCTCCCTGCCAGAAATCTGG + Intergenic
1101828630 12:108240322-108240344 CCTTCCCGCAGCCAGAGGTGAGG - Exonic
1101971597 12:109317726-109317748 CCTGAACCCAGCCAGGGATTTGG + Intergenic
1102238646 12:111310220-111310242 CCCTTCCCCAGCCTGGCATCAGG + Exonic
1102559960 12:113754859-113754881 CCCTCACCCATCCAGGAATCTGG - Intergenic
1103128156 12:118442856-118442878 ACTACACCCAGCCAGGAATCAGG - Intergenic
1103213585 12:119184471-119184493 CCTCCCCACAGCCAGGGCGCCGG - Intronic
1103681340 12:122696485-122696507 CCCTCCACCAGCGATGGATCTGG - Intergenic
1103683070 12:122709910-122709932 CCCTCCACCAGCGATGGATCTGG - Intergenic
1104386785 12:128357745-128357767 CCTTCTCCCAGCCAAGGGTAAGG + Intronic
1104772294 12:131371026-131371048 GCTTCCTGCAGCCAGGGACCAGG + Intergenic
1104854798 12:131896529-131896551 CCTTCCCTCAGCCAGGGGCTGGG - Intronic
1104968593 12:132521013-132521035 CCTGCCCTGAGCCAGGGAGCTGG + Intronic
1104999567 12:132681102-132681124 CCTTCTCCCACCCAGGAATATGG - Intronic
1105503271 13:20990078-20990100 CCTTCACTCTGCCAGGTATCGGG - Intronic
1106157223 13:27170955-27170977 CTTTCCCCCAGCGCGGGGTCGGG + Intronic
1106840662 13:33682328-33682350 CCTCCCCCCAGGCAGGGATGGGG + Intergenic
1110267252 13:73552403-73552425 CTTTCTCCCAGCCTGGTATCTGG - Intergenic
1111654213 13:91132045-91132067 CCTTCCCCCAGCCAGGAGTGTGG - Intergenic
1113899583 13:113788802-113788824 CCTCACCCCAGCCAGAGTTCTGG + Intronic
1114569991 14:23660179-23660201 CCTTGGCACAGCCAGGAATCTGG + Intergenic
1114953330 14:27785090-27785112 CCTTCCCCCAACAAGATATCTGG + Intergenic
1115644211 14:35356116-35356138 CCTGCCCCCAGCCCTGGTTCTGG - Intergenic
1115753609 14:36513828-36513850 CCTGGCCCCAGCCTGGGAACTGG - Exonic
1118336616 14:64858698-64858720 CCTTCTCCCAGGCAGGGTCCAGG - Intronic
1120749797 14:88186831-88186853 ACTTCCCCCAGTCAGGGTGCAGG + Intronic
1123048745 14:105530688-105530710 CCTTGCCCCAGCACGGGAGCTGG + Intergenic
1123684433 15:22786943-22786965 CCTTCCCCCAACCTGGGCCCGGG - Intronic
1123958853 15:25372414-25372436 GCTTTCCACAGCCAGGAATCAGG + Intronic
1124249223 15:28096457-28096479 CCTGCCCCCTCCCTGGGATCCGG - Intronic
1125541080 15:40470678-40470700 CCTTCCTCCAGCAACGGGTCTGG - Intergenic
1125673893 15:41492634-41492656 TCTCCCCTCAGCCAGGGCTCAGG - Intergenic
1125950290 15:43746234-43746256 CCTGCCCCCAGCCCAGGACCGGG + Intergenic
1128133375 15:65245433-65245455 TCTTCCCTCAGCCAGAGAGCTGG - Intronic
1129251446 15:74311241-74311263 CCTTCCCCCAGGGAGAGATGTGG + Intronic
1129929235 15:79395557-79395579 TCTTCCCCCAACCATGGATAAGG + Intronic
1131067609 15:89444184-89444206 CGTGCCGCCAGCCAGGGCTCAGG + Intergenic
1132252650 15:100345829-100345851 CCATCCCCCACCCTGGGCTCTGG + Intergenic
1132468575 16:89294-89316 CCTTCCCCAAGCCTGGGGACCGG + Intronic
1132670101 16:1099013-1099035 CCATCCCGCATCCAGGGCTCTGG - Intergenic
1134458336 16:14410857-14410879 CCCTCCCTCAGCCAGGTCTCCGG - Intergenic
1135420165 16:22300452-22300474 CCTCTGCCCTGCCAGGGATCAGG - Intronic
1136228302 16:28873159-28873181 CCTCCCCCCAGGCCGGGAGCAGG + Intronic
1137330499 16:47490579-47490601 CCTTCCAAAAGCCAGGTATCAGG + Intronic
1137614698 16:49839303-49839325 CCTTCTCCAAGCCAGGGCTGTGG - Intronic
1138180426 16:54937255-54937277 CGTTCCCCCAGCCCGGGTGCGGG + Intergenic
1138458598 16:57134876-57134898 CCTCCCTCCACCCAGGGAGCTGG - Intronic
1138493777 16:57394440-57394462 ACTTGACCCACCCAGGGATCAGG - Intergenic
1138582588 16:57951245-57951267 CCTACCCCCAGGCAGGTGTCAGG + Intronic
1139985920 16:70898357-70898379 CCCTACACCAGCCAGGGGTCTGG + Intronic
1141217009 16:82034105-82034127 CCTCCCTCCAGCCAGGCATGTGG + Intergenic
1141901925 16:86996575-86996597 CCTTCCCCCTGGAAGGAATCTGG - Intergenic
1142286686 16:89174285-89174307 CCCTCCCCCAGGCTGGAATCTGG - Intronic
1142314694 16:89336255-89336277 CCTGCTCCCAGCCAGGCACCAGG - Intronic
1203075498 16_KI270728v1_random:1120203-1120225 CCCTGCCCCTGCCATGGATCTGG + Intergenic
1142675738 17:1512090-1512112 TCTTTCCCCAGCCAAGAATCAGG - Intronic
1142742243 17:1937922-1937944 CCTTGCTCCAGCCAGGGACAAGG - Intronic
1142849204 17:2696152-2696174 CCCTCACCAAGCCAGGGATCTGG + Exonic
1143118710 17:4594650-4594672 CCTCCCCCCAGCCAGCCAGCGGG + Intronic
1143766835 17:9143335-9143357 CCTTTCCCCACCCAGGGCTCAGG - Intronic
1144672056 17:17138379-17138401 CCTCCTCCCTGCCAGGGCTCCGG - Intronic
1144851491 17:18246289-18246311 TCCTCCCCCAGCCAGGCACCGGG + Exonic
1146804813 17:35856684-35856706 CCTTCCCACAGCCTAGGATTTGG + Intronic
1147425044 17:40342282-40342304 CCTCCTCCCAGCCGGGGATCCGG - Intronic
1147888593 17:43701284-43701306 CCCTCCCCCACCCAAGGACCAGG + Intergenic
1148462723 17:47847640-47847662 CTTTCCCGCAGCCCGGGATGTGG + Exonic
1148680286 17:49469920-49469942 CCTTAGCGCAGCCAGGGAGCAGG - Intronic
1150123613 17:62622527-62622549 CCTTCTCCAAGCCAGGGAAGAGG - Intergenic
1150930231 17:69576784-69576806 CCTTCCTCCAGCAAGGGTTCTGG - Intergenic
1151487424 17:74409968-74409990 CCTTCCTCCAGCCCGGGAAAGGG - Intergenic
1151825794 17:76523510-76523532 CCTTCCCCCAGCAAGGCCTCTGG + Intergenic
1151963614 17:77419979-77420001 CCTCCCCCCAACCACGGAGCTGG - Intronic
1152211680 17:79005691-79005713 CCTTCCCACACCCAGAGAGCAGG + Intronic
1152239312 17:79153196-79153218 CCCACCCCCAGCCAAGGATCTGG - Intronic
1152286356 17:79415386-79415408 CCCTCCCCCACCCAGGGAGAAGG + Intronic
1152399326 17:80055757-80055779 CCTTCCCCCACCCAGCCACCAGG + Intronic
1152419674 17:80185663-80185685 CTTTCCCCCAGCCCAGGGTCGGG + Intronic
1152433335 17:80261099-80261121 CCCTCCCGCAGCCGGGGAACAGG - Intronic
1152599257 17:81253229-81253251 CCTGCTCCCAGCCCAGGATCCGG - Exonic
1152608656 17:81305192-81305214 CCCTCCACCAGCCAGGGCCCAGG + Intergenic
1152750204 17:82059096-82059118 CCTACCCCCAGGCAGGGACAAGG + Intronic
1153550110 18:6253502-6253524 TCTGCCTCCAGCCAGGCATCAGG - Intronic
1153561441 18:6375508-6375530 CCCTCACCTAGCCTGGGATCGGG - Intronic
1154198457 18:12282782-12282804 CCACCCCCAAGCCGGGGATCAGG + Intergenic
1156460726 18:37319964-37319986 CCTTCCCCCCGCCAGGGCTGGGG - Intronic
1157489365 18:48111567-48111589 CCGACCCCCAGCCAGGGCTCTGG - Intronic
1157555307 18:48609686-48609708 CCTGACTCCAGCCAGGGATATGG + Intronic
1158514204 18:58117698-58117720 CCTGCCCCCAGCCTGGTTTCTGG + Intronic
1158646688 18:59254775-59254797 ACTGCACCCAGCCAGGGACCTGG + Intergenic
1160583381 18:79900131-79900153 CCTGCCTCCAGCCAGGGAGGAGG + Intronic
1160682385 19:417806-417828 CCAGCCCCCAGCCAGGCCTCGGG - Intronic
1160795956 19:945562-945584 CCTGCCCTCAGCCTGGGGTCTGG + Intronic
1160873738 19:1287952-1287974 CCTTCCCCTGGCCGGGGGTCCGG - Intronic
1161337375 19:3721809-3721831 CCCTCCCCCAGCCCGGGGTGGGG + Exonic
1161588143 19:5116718-5116740 CCTGCCCCCACCCTGGGGTCTGG - Intronic
1161975845 19:7607506-7607528 CCTTCCCCCACCCTGGGGCCTGG + Intronic
1162582854 19:11540919-11540941 CCATCCCCCAACTATGGATCTGG + Intronic
1163124941 19:15239624-15239646 CCTGCCCACAGCCAGGGCTCAGG - Intronic
1163142826 19:15362036-15362058 CCTTCCTCCTTCAAGGGATCCGG + Intronic
1164778656 19:30874183-30874205 CCTTCCCCCAGACACAGAGCAGG - Intergenic
1164830398 19:31315513-31315535 CCTGCCCTCTGCCAGGGAGCTGG + Intronic
1165744556 19:38222853-38222875 CCTTCCCCCAGCCTGGGTCCCGG - Intronic
1165895701 19:39139659-39139681 CCCTCCCCCATCCAGGTCTCAGG + Intronic
1166045997 19:40231646-40231668 ACCTCCCCCAGCAAGGGACCAGG - Exonic
1166230890 19:41425431-41425453 GCCTCCCCCAGCCAGGGGCCTGG - Exonic
1166297810 19:41897334-41897356 CCTTCCCCCACCCAGGGCCCAGG - Intronic
1167080220 19:47272897-47272919 CCTTCCCCCAGAGTGGGATTAGG + Intergenic
1168417341 19:56176874-56176896 CCTTCCCCCATCATCGGATCAGG - Intronic
924982964 2:239984-240006 CCTTCCCCCAGCCCCTGGTCAGG + Intronic
926345290 2:11939197-11939219 ACTGCACCCAGCCAGGAATCTGG + Intergenic
927920826 2:26970853-26970875 CCCTCCCCCAGCCCGGGCCCTGG - Intronic
930730421 2:54723618-54723640 TCTTCCTCCAGCCGGGGCTCCGG - Intronic
930753631 2:54954920-54954942 ACTTCTCCCATCCAGGGCTCTGG + Intronic
932598245 2:73107529-73107551 CCTGGTCCCAGCCAGGGCTCAGG + Intronic
932731901 2:74227318-74227340 CCTCCCCTCACCCAGGGCTCAGG - Intronic
934483993 2:94684360-94684382 CCTTCCCCCAACAAGATATCTGG - Intergenic
934774474 2:96928413-96928435 CCTCCCCACAGGCAGGGACCAGG + Intronic
936166930 2:110128982-110129004 CCTTCCCTGACCCAGGGAGCAGG - Intronic
936626874 2:114157923-114157945 CCTCAACCCAGCCAGTGATCTGG - Intergenic
937265523 2:120612585-120612607 TCTTCCCCCAGCCTGGGTTCGGG + Intergenic
937267606 2:120626351-120626373 CCTTCCCACACCCATGGATGGGG + Intergenic
937929476 2:127193203-127193225 CCTTTCCGCAGCCAGCGCTCAGG + Exonic
938161084 2:128985145-128985167 CCTTCACCCAGGCAGGGTGCTGG - Intergenic
938213265 2:129486230-129486252 TCCTGCCCCAGTCAGGGATCAGG + Intergenic
938765323 2:134457361-134457383 CATTCCCACAGCCATGGATGAGG + Intronic
940349373 2:152664829-152664851 CCAACCCCCAGCCACGGAACCGG + Intronic
940614918 2:156038198-156038220 CCTCTCCCCAGCCAGGGAAGTGG + Intergenic
944609770 2:201390668-201390690 CTTCCCCCCAGTCAGGGATGAGG + Intronic
948329853 2:237156347-237156369 CCTGCCCACAGACAGGGAACCGG + Intergenic
948503468 2:238411424-238411446 CCTTCCCAGATCCAGGGAACCGG - Intergenic
948599166 2:239098405-239098427 CCTCCTCCCAGCCAGGGAGCAGG - Intronic
948874457 2:240819553-240819575 CCCTCCCCCACCCCGGGAACCGG + Intronic
1170987872 20:21274799-21274821 CATGCAGCCAGCCAGGGATCTGG - Intergenic
1171010302 20:21505878-21505900 CCTTCCGCCCGCCCTGGATCCGG - Intergenic
1171424884 20:25043064-25043086 CCCTCCCCCTGCCAGGGACAGGG + Intronic
1171439388 20:25148373-25148395 GCTTCCCCCAGCCACCGACCAGG + Intergenic
1172428443 20:34872028-34872050 CCCTCCCTGAGCCATGGATCTGG - Intronic
1172941758 20:38659140-38659162 CCTGCCCACAGCCAGGTACCAGG - Intergenic
1175278757 20:57788670-57788692 CCTGCCCACAGCCTGTGATCCGG - Intergenic
1175314989 20:58040880-58040902 TCTTCCCACAGCCAGGGAGCAGG - Intergenic
1175711564 20:61225435-61225457 CCTTCCTCCAGCCTGGCAGCCGG - Intergenic
1175980279 20:62735296-62735318 TGTTCCCACAGCCAGGGATGTGG + Intronic
1176131055 20:63496996-63497018 CCATCCCCCACCCAGGACTCTGG - Intronic
1178198098 21:30371780-30371802 CCTTCCCTCGGCTATGGATCTGG - Exonic
1178617324 21:34145438-34145460 CTTTCCTCCAGCCAGGGGGCAGG - Intergenic
1179574525 21:42299574-42299596 CATTCCCCCAGCCTGACATCAGG + Intergenic
1180261193 21:46670318-46670340 CCTTCCCGAGGCCAGGGACCAGG + Intergenic
1180671580 22:17557775-17557797 CCCTTCCCTAGCCAGGGCTCAGG + Intronic
1181462383 22:23093450-23093472 CCTACCCCCAGCCAGAGTGCGGG - Intronic
1181967945 22:26669694-26669716 CCCGCCCCCACCCAGGGATGGGG + Intergenic
1182355175 22:29719715-29719737 CCTTCCCCCATCCACGCACCAGG - Intergenic
1183339853 22:37274116-37274138 CCTCCCAGCAGCCAGGGATATGG + Intergenic
1183596971 22:38818716-38818738 CCCTTCCCCACCCAGGGGTCGGG + Exonic
1184556755 22:45237326-45237348 CCTCCCACAAGGCAGGGATCAGG + Intronic
1184959999 22:47921908-47921930 TCTCCCTCCAGCCAGGGTTCTGG + Intergenic
1185370922 22:50460522-50460544 CCTTCCCTCAGGTATGGATCTGG - Exonic
1185416150 22:50711677-50711699 CACTCCCCCAGACAGGGGTCAGG - Intergenic
949980838 3:9500866-9500888 CCTTCCCCTTGGCAGGGAGCAGG - Exonic
950262617 3:11553742-11553764 CCTCCCCTCAGCCTGGGAGCTGG + Intronic
950485243 3:13269493-13269515 CCATCCCCTACCCAGGGAACAGG + Intergenic
950810368 3:15645068-15645090 CCTTTCCCCAGACAGGGACCAGG - Exonic
950891822 3:16410927-16410949 CCTTGGCCCAGCCAGGCATAAGG + Intronic
954155357 3:48682221-48682243 CCTGCCCACAGCCAGGGCTCAGG - Intronic
954633205 3:52057792-52057814 CGCTCCCCCAGTCAGGGATGGGG - Intergenic
954642446 3:52109092-52109114 CCTTCCCCGACCCATGGTTCTGG - Intronic
956875071 3:73454490-73454512 CCTTCCCAAAGTCAGGTATCAGG - Intronic
957073166 3:75581189-75581211 CAGGCCCCCAGCCAGGGCTCAGG + Intergenic
959505543 3:107152594-107152616 GCTTCCCTCAGCCAGGGCTGTGG - Intergenic
960989635 3:123302016-123302038 CCCCCACCCAGCCTGGGATCTGG - Intronic
961184848 3:124905829-124905851 CCTTCTCCCAGCCAGTCTTCGGG + Exonic
961506468 3:127373938-127373960 CCACCCCCCAGCCTGGGCTCAGG + Intergenic
961692082 3:128677016-128677038 GGCTCCCCAAGCCAGGGATCTGG + Intronic
961710392 3:128823871-128823893 CCTTCCACCACCCATGGCTCTGG + Intergenic
961831243 3:129623976-129623998 CCTTCACTCAGCCGGGGCTCAGG + Intergenic
961873478 3:130003994-130004016 CAGGCCCCCAGCCAGGGCTCAGG + Intergenic
962811119 3:138960415-138960437 CCTTCCTCCACCCAGGAACCCGG - Intergenic
963605835 3:147411024-147411046 CCTTGCCACAGCCAGGGAAGGGG - Exonic
967872792 3:194246155-194246177 CCATCCCCTACCCAGGGATGGGG - Intergenic
968377438 4:54744-54766 CCTTCACCCACCCAGGCTTCCGG + Intronic
968401665 4:304015-304037 CCTTCCCCCACCCAGGCTTCTGG - Intronic
968472571 4:788763-788785 CCTCCCTCCAGCCAGGGGTGTGG + Intronic
968521760 4:1037419-1037441 CCCTCCCTCAGGCAGGGAGCTGG - Intergenic
968648873 4:1752638-1752660 CCGCCCACCAGCCAGGGGTCAGG + Intergenic
968964715 4:3764078-3764100 TCCTCCCCCAGCCTGGGAGCGGG - Intergenic
969365803 4:6693704-6693726 CTTTCCCCCAGCCAAGGCCCAGG - Exonic
969439713 4:7209915-7209937 CCTTCCCCCGGCAGAGGATCTGG - Intronic
969737194 4:8999832-8999854 CAGGCCCCCAGCCAGGGCTCAGG - Intergenic
970928925 4:21485953-21485975 GCTTCCCACAGCCTGGGATTTGG + Intronic
973571882 4:52248687-52248709 CCTTCCACAAACCAGGCATCAGG - Intergenic
977568789 4:98609350-98609372 CTCTCCCCCAGCCAGTGGTCGGG - Intronic
979858519 4:125664660-125664682 CCTTCCCCCAGCCAGGGCAAAGG + Intergenic
980291545 4:130852130-130852152 CATTGCCCCAGCCGTGGATCTGG + Intergenic
985292812 4:188404137-188404159 CCTTGTCCTAGCCAGGGACCTGG - Intergenic
985618960 5:943303-943325 CCTTCCCAGAGCCAGGGCTAAGG + Intergenic
986015453 5:3753435-3753457 CCTCCCCCCAGCCTGGTGTCTGG - Intergenic
986662667 5:10073358-10073380 CCTTCTCCAAGCCGGGGACCTGG - Intergenic
988919178 5:35925108-35925130 CATTCCCCCGGCCAGGCATGCGG + Intronic
991157608 5:63458052-63458074 ACTTCCCCCACCCAGGGAAGTGG + Intergenic
991447724 5:66717883-66717905 CCTTCCCTCAGGCAGTGAGCAGG - Intronic
993308502 5:86298698-86298720 CCTGCCCCCAACCAGGGCTAGGG - Intergenic
993939073 5:94036789-94036811 TCTTGCCCCAGTCAGGAATCAGG + Intronic
997467241 5:134096364-134096386 TCTGCCCCCAGCCAGGGACCGGG + Intergenic
999076808 5:148804178-148804200 CTTTCCCCCTGCCATGGATGGGG - Intergenic
999318707 5:150600404-150600426 CCATCCCCCAGGCAGGGAAGTGG + Intergenic
1001375066 5:171248617-171248639 CATTGCACCAGCCAGGGAACTGG + Intronic
1001421842 5:171593546-171593568 CCGTGGCCCAGCCAGGCATCTGG + Intergenic
1001912765 5:175534611-175534633 CCTTCCCACCGCCAAGGTTCAGG - Intergenic
1002575382 5:180171113-180171135 CCTTCCCCCAGCCCAGGAGTGGG + Intronic
1003053901 6:2802480-2802502 CCCTCCGTCAGCCAGGGCTCAGG + Intergenic
1005524592 6:26633420-26633442 ACTTTCCCCAGGCAGGGATTTGG - Intergenic
1005852047 6:29829307-29829329 CCTTCCCCACCCCAGGTATCTGG + Intronic
1006271602 6:32970304-32970326 CCTTCCCCCAGCCAGGGATCAGG - Intronic
1006653435 6:35569880-35569902 CCTTCTCCCACTGAGGGATCAGG - Intergenic
1006802098 6:36765856-36765878 CCATCCCCGAGCCAGGGCCCTGG - Intronic
1006828527 6:36954721-36954743 CCTTCTCCCGTCCAGGGGTCTGG - Exonic
1007251747 6:40500043-40500065 CCATCCCACAGGCAGGGAGCTGG - Intronic
1008885183 6:56424673-56424695 CCCTCCACCAGCCAGGAGTCAGG + Intergenic
1009223570 6:61003955-61003977 CCTTCCCCCACCCCGTGATATGG + Intergenic
1010670070 6:78676366-78676388 CCCTCCCCCAGCCAGGCTTGCGG - Intergenic
1012863926 6:104595349-104595371 CCTTCCCCCAGCAAGCTATGGGG - Intergenic
1013467655 6:110431252-110431274 GCTTCCCACAGCCAGCGATCTGG + Exonic
1013497396 6:110711884-110711906 CCGCCCCCCAGCCTGGGTTCAGG - Intronic
1016996576 6:149965548-149965570 CCTGACCCCAGCTAGGGTTCGGG - Intronic
1019738696 7:2662486-2662508 CCTTCCCCCACCCAGAGACTGGG + Exonic
1021451086 7:20784667-20784689 CCTTGCCGCAGCCCGGGATGTGG + Exonic
1023717434 7:43058369-43058391 CCTTCCCACAGCCAGCTATAAGG - Intergenic
1023840058 7:44091940-44091962 GCTTCCCCCAGCAAGAGATGGGG + Intergenic
1026038132 7:66844549-66844571 ACCTCCTCCAGCCAGGGACCGGG - Intergenic
1027229073 7:76261702-76261724 CCTTCCCACAGCCAGGCTGCGGG + Intronic
1028046820 7:86130704-86130726 CCTTCCACCAGCGAGGGCACAGG + Intergenic
1029775913 7:102683970-102683992 ACTGCGCCCAGCCAGGGAGCCGG + Intergenic
1031235575 7:119171647-119171669 CCATACCCAAGCCAGGAATCTGG + Intergenic
1032174510 7:129612167-129612189 CCTTCCCGCAGCTCGGGAGCGGG + Intronic
1032783532 7:135183293-135183315 CCCTGCCCCAGGCAGGGGTCAGG + Intergenic
1032784401 7:135188884-135188906 CCTTGCCCCAGCCCAGGCTCTGG + Intronic
1034218090 7:149422986-149423008 CCTTCCCCAAGCCAGGCCTCTGG - Intergenic
1034252692 7:149705071-149705093 CCCACCCCCAGCAAGGGCTCTGG + Intergenic
1034979100 7:155464925-155464947 CCTTCGCCCCGCCTGGGAGCAGG + Intergenic
1035056655 7:156040534-156040556 CCTGCACCCATCCAGGAATCCGG - Intergenic
1035303512 7:157915282-157915304 CTTTCCCTCTGCCAGGCATCTGG + Intronic
1036391031 8:8324503-8324525 CCTTCCCCCACCCAGTGCTGTGG - Intronic
1036428092 8:8664916-8664938 CCATCTCCCAGGCAGGGCTCTGG + Intergenic
1037668934 8:20997752-20997774 CCTGCCCCCTCCCATGGATCTGG + Intergenic
1038467227 8:27775025-27775047 CCTTCCCCTTCCCTGGGATCAGG - Intronic
1039776843 8:40745552-40745574 CCTTTCCCAAGCCAAGGATCTGG + Intronic
1041643182 8:60224926-60224948 AATTCCCCCATCCAGGGTTCAGG - Intronic
1046265369 8:111823421-111823443 CCTTCCCGCGGGCAGGGCTCGGG - Intergenic
1049420071 8:142512534-142512556 CCTTCTCCCAGCCCGGTGTCAGG + Intronic
1049717585 8:144100205-144100227 CCTTCTCCCAGCCTTGGCTCTGG + Intronic
1052854953 9:33401404-33401426 CCTTAACCCAGCCAAGGAACAGG + Intronic
1053294134 9:36901015-36901037 CCTTTCCACAGCCTGGGTTCAGG + Intronic
1053418079 9:37959220-37959242 CCTCCCCCAAGCCAGAAATCTGG - Intronic
1053682973 9:40497733-40497755 CCTTAACCCAGCCAAGGAACAGG + Intergenic
1054280741 9:63127195-63127217 CCTTAACCCAGCCAAGGAACAGG - Intergenic
1054296073 9:63333233-63333255 CCTTAACCCAGCCAAGGAACAGG + Intergenic
1054394089 9:64637728-64637750 CCTTAACCCAGCCAAGGAACAGG + Intergenic
1054428739 9:65142941-65142963 CCTTAACCCAGCCAAGGAACAGG + Intergenic
1054501641 9:65878602-65878624 CCTTAACCCAGCCAAGGAACAGG - Intronic
1057519858 9:95752017-95752039 CCTTCGCACAGCCAGGTAGCAGG + Intergenic
1058998038 9:110318924-110318946 TCTTCTCCCAGGCAGGGATTAGG - Intronic
1060727301 9:126015008-126015030 CGTCCCCCGAGCCAGGGAGCTGG + Intergenic
1061390891 9:130316485-130316507 CCTGCCACCAGCCTGGGATGGGG - Intronic
1061749910 9:132770433-132770455 CCCTACCCCAGCCAGCGTTCTGG - Intronic
1061968490 9:134029901-134029923 CCTTCATCCTGCCAGGGCTCAGG + Intergenic
1062116152 9:134810244-134810266 CCTTCCCCTAGGGAGAGATCGGG + Exonic
1062135996 9:134928869-134928891 CCTTCACCCACCCAGAGACCTGG + Intergenic
1062399496 9:136366221-136366243 CCTTCCCCCAGACAGGCAGAGGG + Intronic
1062507848 9:136887024-136887046 GCGCCCCCCAGCCAGGGGTCGGG + Intronic
1203571797 Un_KI270744v1:139502-139524 CCTTCACCCACCCAGGCTTCCGG - Intergenic
1189363283 X:40369618-40369640 CCTGCCCCAAGCCTGGGATGGGG - Intergenic
1189487744 X:41446034-41446056 CCTTCCCACAGAAAGGGTTCTGG - Intergenic
1189901035 X:45706426-45706448 CCTTCCCATAGGCAGGGATATGG + Intergenic
1193531416 X:82659012-82659034 CCATCCCACAGCCAAGGAACAGG - Intergenic
1200282063 X:154785326-154785348 CCTGCCCTCAGTCAGGGACCTGG + Intronic
1202583878 Y:26405456-26405478 CCCTGCCCCTGCCATGGATCTGG - Intergenic