ID: 1006275785

View in Genome Browser
Species Human (GRCh38)
Location 6:33004767-33004789
Sequence TTTGCAATATAGCCATGGGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 95}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006275785_1006275790 11 Left 1006275785 6:33004767-33004789 CCTCCCCATGGCTATATTGCAAA 0: 1
1: 0
2: 0
3: 5
4: 95
Right 1006275790 6:33004801-33004823 TTGCATGTGATCACACAAAGAGG 0: 1
1: 0
2: 1
3: 10
4: 149
1006275785_1006275791 12 Left 1006275785 6:33004767-33004789 CCTCCCCATGGCTATATTGCAAA 0: 1
1: 0
2: 0
3: 5
4: 95
Right 1006275791 6:33004802-33004824 TGCATGTGATCACACAAAGAGGG 0: 1
1: 0
2: 0
3: 19
4: 521
1006275785_1006275792 25 Left 1006275785 6:33004767-33004789 CCTCCCCATGGCTATATTGCAAA 0: 1
1: 0
2: 0
3: 5
4: 95
Right 1006275792 6:33004815-33004837 ACAAAGAGGGTTTCTGTTACTGG 0: 1
1: 0
2: 2
3: 13
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006275785 Original CRISPR TTTGCAATATAGCCATGGGG AGG (reversed) Exonic
906488019 1:46246822-46246844 TTGTCAGAATAGCCATGGGGGGG + Intergenic
907529585 1:55080994-55081016 TGTGGAAAATAGCCATGGTGTGG - Intronic
908172478 1:61519908-61519930 TATTCAATATAGCCAAGAGGTGG - Intergenic
916227541 1:162504448-162504470 TGTGCAATATAGCCTAGGTGTGG - Intronic
919821376 1:201474761-201474783 TTTTAAATATAGCCATAGTGGGG + Intergenic
921759039 1:218890788-218890810 TTTGCAATATAGCCAGCTGATGG + Intergenic
921921207 1:220671930-220671952 TTTGAAATATAGACAAGGTGTGG + Intergenic
924072550 1:240296955-240296977 TTTAAAATATAACCATTGGGAGG + Intronic
1062876336 10:945777-945799 TTTGAAAGAGAGCCATGGTGGGG - Intergenic
1064530650 10:16306073-16306095 TTTCCAAGAAAACCATGGGGAGG - Intergenic
1065660662 10:28001415-28001437 CTTGCACTCTAGCCATGGGCAGG - Intergenic
1072230684 10:93411693-93411715 TTTGCAATTTAGCCCAGGGTGGG + Intronic
1073469332 10:103713073-103713095 TATCCGATATGGCCATGGGGTGG + Intronic
1073669206 10:105568682-105568704 TCTGCAATATAGAAATAGGGGGG - Intergenic
1074307141 10:112289452-112289474 TCTGCAATATTGCTGTGGGGTGG + Intronic
1074364424 10:112846467-112846489 TTTGAAATATGGCCAGTGGGCGG + Intergenic
1078893442 11:15577913-15577935 TTTACAATAAACCCATGTGGTGG + Intergenic
1079364799 11:19799818-19799840 TGTGGAATATAGCAAGGGGGAGG - Intronic
1083209346 11:61173273-61173295 TTTGCCAAATGGGCATGGGGAGG - Intergenic
1085847085 11:80078213-80078235 TTTGCCATGTCCCCATGGGGTGG + Intergenic
1093158700 12:15719003-15719025 TGTGCTATATAGCAATGGGAAGG + Intronic
1098621709 12:72608903-72608925 TTTGCAATATGAACCTGGGGGGG + Intronic
1099208578 12:79757141-79757163 TTTGCAGTATAGGCCTGGAGAGG - Intergenic
1102408641 12:112697124-112697146 TTTGCCTTATTGCCATGGGTAGG - Intronic
1102697277 12:114809691-114809713 TTTGAAATGTACCCATGTGGTGG + Intergenic
1106635832 13:31527635-31527657 TTTGCAGTAGAGCCACGGGGCGG + Intergenic
1107856113 13:44616951-44616973 TTTAAAATATAACCATGGGTCGG + Intergenic
1117444739 14:55793331-55793353 CTTGCAAAATGGCCATGGGCTGG - Intergenic
1126398456 15:48244355-48244377 TCTGCAAGAGAGCCAAGGGGTGG - Intronic
1126836658 15:52673897-52673919 TTTGTAATATAGCCAAATGGAGG + Intronic
1130425396 15:83792904-83792926 TTTTCAAAATAGCCAAGGTGTGG + Intronic
1131552447 15:93369077-93369099 TTTGGGATATATCCATGGTGTGG - Intergenic
1133147307 16:3798640-3798662 TTTTTATTATAGCCATGTGGTGG - Intronic
1138764438 16:59584903-59584925 TTTGCAATATAGCAAAGATGTGG + Intergenic
1141493623 16:84391559-84391581 TTGGGAATATAGCCATGTGCTGG + Intronic
1144878426 17:18416536-18416558 TTTGCAATATAGACAGGCTGAGG - Intergenic
1145153807 17:20527857-20527879 TTTGCAATATAGACAGGCTGAGG + Intergenic
1153050653 18:900490-900512 TTTGCAATATGGGGATGGAGGGG + Intergenic
1153357631 18:4155206-4155228 ATTGCAATAAAGTCATGGGATGG + Intronic
1153904245 18:9646949-9646971 TTTGAAATATGGCTATGGAGAGG + Intergenic
1157154800 18:45255045-45255067 TTGGCAAGATGGCCATGTGGAGG - Intronic
1159867857 18:73727488-73727510 TTTGCTATGTAGCCTTGGGGAGG + Intergenic
1167313597 19:48751510-48751532 TTTTCAAGATAGCCATGGTTTGG + Intronic
926034441 2:9624507-9624529 TTGGCATTATTGGCATGGGGGGG + Intronic
928367536 2:30714171-30714193 TTGCCAATTTAGCCATAGGGAGG + Intergenic
928367668 2:30715153-30715175 TTGCCAATTTAGCCATAGGGAGG + Intergenic
932138402 2:69252432-69252454 TTAGCAATTTAGCAATAGGGAGG + Intergenic
932401754 2:71485622-71485644 TTTGCCATCTGGTCATGGGGTGG - Intronic
937081122 2:119140655-119140677 TTTGTCATATTGGCATGGGGGGG + Intergenic
941084587 2:161102215-161102237 CAGGCAATATAGCCATAGGGAGG + Intergenic
941260267 2:163288455-163288477 TTTGCACTATAGCCTGGGCGAGG - Intergenic
944915641 2:204357770-204357792 TTTGTAATTTAGCTATGAGGGGG - Intergenic
945328057 2:208505965-208505987 TTTGCAATCTATCCATCTGGTGG - Intronic
948536504 2:238651165-238651187 TTTGTACTATAGCCATGTGATGG - Intergenic
1170776894 20:19382874-19382896 TTTGCCGTAGAGACATGGGGCGG - Intronic
1173880925 20:46411674-46411696 TTAGCAATATAACATTGGGGTGG + Intronic
1177372628 21:20223461-20223483 CTGGCAAGATAGCTATGGGGTGG - Intergenic
1179174806 21:39000670-39000692 TTTGCAGCAGAGCCAGGGGGCGG - Intergenic
1185012787 22:48324918-48324940 TTTGCAATAAGGCTGTGGGGTGG + Intergenic
1185100045 22:48835412-48835434 TTTGCAGGAGAGCCATGTGGTGG + Intronic
952428126 3:33196183-33196205 ATTCCAATTTAGCCATGGTGTGG - Intronic
955690425 3:61585410-61585432 TTGGTACTATAGCCATTGGGTGG + Intronic
959620440 3:108393908-108393930 TTTCCCATACAGCCAGGGGGAGG - Intronic
959936490 3:112034660-112034682 TTTACAATATAGCAATGAGGCGG + Intergenic
961755456 3:129124425-129124447 TTTGCAATATAGGCCGGGTGCGG - Intronic
964310598 3:155387524-155387546 CTTTCAATTTAGCCATGAGGAGG + Intronic
965764946 3:172120552-172120574 TTTGTCATACAGGCATGGGGGGG + Intronic
970383295 4:15530298-15530320 TTTGCAATTTAGCTATGAGTTGG + Intronic
973857329 4:55026164-55026186 TTTGCAATAATGCAATGTGGTGG - Intergenic
975170025 4:71223019-71223041 TTTGCAAAATGGGCCTGGGGAGG + Intronic
975488258 4:74959257-74959279 TTTGTAAAATAGTGATGGGGGGG - Intronic
977104345 4:92861824-92861846 TTTGCAATATTTCAATGAGGTGG - Intronic
981614773 4:146634972-146634994 TTGGCAATAAACCCAAGGGGTGG - Intergenic
983889211 4:173013577-173013599 TTTGCATTTTAGCCTGGGGGTGG - Intronic
985842523 5:2319231-2319253 GTTGCAATAGAGGCATGAGGGGG + Intergenic
987919380 5:24258644-24258666 TTTGCAATAAACCTATAGGGTGG + Intergenic
991986165 5:72288955-72288977 TTTACAACATAGGCCTGGGGTGG + Intronic
996036286 5:118762530-118762552 TTGCCAAAATTGCCATGGGGAGG - Intergenic
997742671 5:136270896-136270918 TTTGAAGCATAGCCATGGAGAGG - Intronic
998838812 5:146231393-146231415 TTTGGACTATAGGCATGGTGCGG - Intronic
1001240193 5:170063054-170063076 TTTAGAATATAGCCCTTGGGTGG - Intronic
1003159453 6:3622819-3622841 TTTACAAGATTGCCATGGAGAGG + Intergenic
1005441114 6:25869972-25869994 ATTGTGATATAGCCATGGGGTGG - Intronic
1006275785 6:33004767-33004789 TTTGCAATATAGCCATGGGGAGG - Exonic
1011091803 6:83611206-83611228 TTTTTATTACAGCCATGGGGGGG - Intronic
1011484323 6:87826763-87826785 TTTGCAATATAGGCCGGGTGCGG + Intergenic
1020395588 7:7713470-7713492 TAAACAATATTGCCATGGGGGGG - Intronic
1024140802 7:46461425-46461447 TGTGCACTAGAGGCATGGGGTGG - Intergenic
1024838182 7:53549380-53549402 TTTGTAATATAGCCATAAGCTGG - Intergenic
1035639748 8:1175881-1175903 TTATCCACATAGCCATGGGGAGG + Intergenic
1038059896 8:23901365-23901387 GTTGCAATATACCCATGGCAAGG - Intergenic
1038676733 8:29629696-29629718 TTTGGAAAATAGCCTTGGAGAGG + Intergenic
1039795040 8:40905756-40905778 TTTAAAAAATAGCCATGTGGTGG - Intergenic
1043060808 8:75500333-75500355 TTTTCATTATAGCCATTGTGGGG - Intronic
1045903997 8:107320898-107320920 TATGCAATGTACACATGGGGAGG - Intronic
1051334587 9:16054594-16054616 TCTGGAATAGAGCCAGGGGGAGG + Intronic
1055273884 9:74592406-74592428 TTTGGAATATCGCCATGGCGTGG + Intronic
1185913198 X:4005156-4005178 TTTCCAATGAAGCAATGGGGAGG + Intergenic
1188634285 X:32408944-32408966 TTTTAAATATAGAGATGGGGTGG - Intronic
1192306966 X:69971444-69971466 CATGCAACATTGCCATGGGGTGG + Intronic
1193916559 X:87371315-87371337 TTTGTGATATAACCCTGGGGGGG - Intergenic