ID: 1006277884

View in Genome Browser
Species Human (GRCh38)
Location 6:33020741-33020763
Sequence AACTCAGGACCAGTGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006277884_1006277889 -7 Left 1006277884 6:33020741-33020763 CCTTCCACCACTGGTCCTGAGTT No data
Right 1006277889 6:33020757-33020779 CTGAGTTTTGGAGAAGACATAGG No data
1006277884_1006277890 -6 Left 1006277884 6:33020741-33020763 CCTTCCACCACTGGTCCTGAGTT No data
Right 1006277890 6:33020758-33020780 TGAGTTTTGGAGAAGACATAGGG No data
1006277884_1006277891 20 Left 1006277884 6:33020741-33020763 CCTTCCACCACTGGTCCTGAGTT No data
Right 1006277891 6:33020784-33020806 TGACAAAACTTTAGAAACAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006277884 Original CRISPR AACTCAGGACCAGTGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr