ID: 1006283520

View in Genome Browser
Species Human (GRCh38)
Location 6:33076122-33076144
Sequence TACCTGGAGTGGCCCTGCCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 1, 2: 1, 3: 25, 4: 294}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006283520_1006283529 14 Left 1006283520 6:33076122-33076144 CCAGGGCAGGGCCACTCCAGGTA 0: 1
1: 1
2: 1
3: 25
4: 294
Right 1006283529 6:33076159-33076181 ATTCTTGGAGGGTCTGGCTCAGG 0: 1
1: 1
2: 0
3: 13
4: 136
1006283520_1006283523 -1 Left 1006283520 6:33076122-33076144 CCAGGGCAGGGCCACTCCAGGTA 0: 1
1: 1
2: 1
3: 25
4: 294
Right 1006283523 6:33076144-33076166 AAGAGCCGAACTGCCATTCTTGG 0: 1
1: 0
2: 0
3: 3
4: 80
1006283520_1006283530 15 Left 1006283520 6:33076122-33076144 CCAGGGCAGGGCCACTCCAGGTA 0: 1
1: 1
2: 1
3: 25
4: 294
Right 1006283530 6:33076160-33076182 TTCTTGGAGGGTCTGGCTCAGGG 0: 1
1: 1
2: 0
3: 20
4: 217
1006283520_1006283524 2 Left 1006283520 6:33076122-33076144 CCAGGGCAGGGCCACTCCAGGTA 0: 1
1: 1
2: 1
3: 25
4: 294
Right 1006283524 6:33076147-33076169 AGCCGAACTGCCATTCTTGGAGG 0: 1
1: 0
2: 0
3: 3
4: 64
1006283520_1006283531 28 Left 1006283520 6:33076122-33076144 CCAGGGCAGGGCCACTCCAGGTA 0: 1
1: 1
2: 1
3: 25
4: 294
Right 1006283531 6:33076173-33076195 TGGCTCAGGGAACAATTCCTAGG 0: 2
1: 0
2: 2
3: 15
4: 148
1006283520_1006283532 29 Left 1006283520 6:33076122-33076144 CCAGGGCAGGGCCACTCCAGGTA 0: 1
1: 1
2: 1
3: 25
4: 294
Right 1006283532 6:33076174-33076196 GGCTCAGGGAACAATTCCTAGGG 0: 2
1: 0
2: 0
3: 13
4: 150
1006283520_1006283533 30 Left 1006283520 6:33076122-33076144 CCAGGGCAGGGCCACTCCAGGTA 0: 1
1: 1
2: 1
3: 25
4: 294
Right 1006283533 6:33076175-33076197 GCTCAGGGAACAATTCCTAGGGG 0: 2
1: 0
2: 0
3: 26
4: 220
1006283520_1006283527 8 Left 1006283520 6:33076122-33076144 CCAGGGCAGGGCCACTCCAGGTA 0: 1
1: 1
2: 1
3: 25
4: 294
Right 1006283527 6:33076153-33076175 ACTGCCATTCTTGGAGGGTCTGG 0: 1
1: 0
2: 3
3: 18
4: 147
1006283520_1006283525 3 Left 1006283520 6:33076122-33076144 CCAGGGCAGGGCCACTCCAGGTA 0: 1
1: 1
2: 1
3: 25
4: 294
Right 1006283525 6:33076148-33076170 GCCGAACTGCCATTCTTGGAGGG 0: 1
1: 0
2: 1
3: 4
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006283520 Original CRISPR TACCTGGAGTGGCCCTGCCC TGG (reversed) Exonic