ID: 1006283521

View in Genome Browser
Species Human (GRCh38)
Location 6:33076133-33076155
Sequence AGTTCGGCTCTTACCTGGAG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 60}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006283521_1006283524 -9 Left 1006283521 6:33076133-33076155 CCACTCCAGGTAAGAGCCGAACT 0: 1
1: 0
2: 1
3: 2
4: 60
Right 1006283524 6:33076147-33076169 AGCCGAACTGCCATTCTTGGAGG 0: 1
1: 0
2: 0
3: 3
4: 64
1006283521_1006283530 4 Left 1006283521 6:33076133-33076155 CCACTCCAGGTAAGAGCCGAACT 0: 1
1: 0
2: 1
3: 2
4: 60
Right 1006283530 6:33076160-33076182 TTCTTGGAGGGTCTGGCTCAGGG 0: 1
1: 1
2: 0
3: 20
4: 217
1006283521_1006283525 -8 Left 1006283521 6:33076133-33076155 CCACTCCAGGTAAGAGCCGAACT 0: 1
1: 0
2: 1
3: 2
4: 60
Right 1006283525 6:33076148-33076170 GCCGAACTGCCATTCTTGGAGGG 0: 1
1: 0
2: 1
3: 4
4: 52
1006283521_1006283533 19 Left 1006283521 6:33076133-33076155 CCACTCCAGGTAAGAGCCGAACT 0: 1
1: 0
2: 1
3: 2
4: 60
Right 1006283533 6:33076175-33076197 GCTCAGGGAACAATTCCTAGGGG 0: 2
1: 0
2: 0
3: 26
4: 220
1006283521_1006283529 3 Left 1006283521 6:33076133-33076155 CCACTCCAGGTAAGAGCCGAACT 0: 1
1: 0
2: 1
3: 2
4: 60
Right 1006283529 6:33076159-33076181 ATTCTTGGAGGGTCTGGCTCAGG 0: 1
1: 1
2: 0
3: 13
4: 136
1006283521_1006283527 -3 Left 1006283521 6:33076133-33076155 CCACTCCAGGTAAGAGCCGAACT 0: 1
1: 0
2: 1
3: 2
4: 60
Right 1006283527 6:33076153-33076175 ACTGCCATTCTTGGAGGGTCTGG 0: 1
1: 0
2: 3
3: 18
4: 147
1006283521_1006283532 18 Left 1006283521 6:33076133-33076155 CCACTCCAGGTAAGAGCCGAACT 0: 1
1: 0
2: 1
3: 2
4: 60
Right 1006283532 6:33076174-33076196 GGCTCAGGGAACAATTCCTAGGG 0: 2
1: 0
2: 0
3: 13
4: 150
1006283521_1006283531 17 Left 1006283521 6:33076133-33076155 CCACTCCAGGTAAGAGCCGAACT 0: 1
1: 0
2: 1
3: 2
4: 60
Right 1006283531 6:33076173-33076195 TGGCTCAGGGAACAATTCCTAGG 0: 2
1: 0
2: 2
3: 15
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006283521 Original CRISPR AGTTCGGCTCTTACCTGGAG TGG (reversed) Exonic