ID: 1006283522

View in Genome Browser
Species Human (GRCh38)
Location 6:33076138-33076160
Sequence ATGGCAGTTCGGCTCTTACC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 41}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006283522_1006283527 -8 Left 1006283522 6:33076138-33076160 CCAGGTAAGAGCCGAACTGCCAT 0: 1
1: 0
2: 0
3: 7
4: 41
Right 1006283527 6:33076153-33076175 ACTGCCATTCTTGGAGGGTCTGG 0: 1
1: 0
2: 3
3: 18
4: 147
1006283522_1006283536 30 Left 1006283522 6:33076138-33076160 CCAGGTAAGAGCCGAACTGCCAT 0: 1
1: 0
2: 0
3: 7
4: 41
Right 1006283536 6:33076191-33076213 CTAGGGGACGTTATCTTTAAGGG 0: 1
1: 0
2: 1
3: 5
4: 41
1006283522_1006283532 13 Left 1006283522 6:33076138-33076160 CCAGGTAAGAGCCGAACTGCCAT 0: 1
1: 0
2: 0
3: 7
4: 41
Right 1006283532 6:33076174-33076196 GGCTCAGGGAACAATTCCTAGGG 0: 2
1: 0
2: 0
3: 13
4: 150
1006283522_1006283535 29 Left 1006283522 6:33076138-33076160 CCAGGTAAGAGCCGAACTGCCAT 0: 1
1: 0
2: 0
3: 7
4: 41
Right 1006283535 6:33076190-33076212 CCTAGGGGACGTTATCTTTAAGG 0: 1
1: 0
2: 1
3: 4
4: 52
1006283522_1006283530 -1 Left 1006283522 6:33076138-33076160 CCAGGTAAGAGCCGAACTGCCAT 0: 1
1: 0
2: 0
3: 7
4: 41
Right 1006283530 6:33076160-33076182 TTCTTGGAGGGTCTGGCTCAGGG 0: 1
1: 1
2: 0
3: 20
4: 217
1006283522_1006283533 14 Left 1006283522 6:33076138-33076160 CCAGGTAAGAGCCGAACTGCCAT 0: 1
1: 0
2: 0
3: 7
4: 41
Right 1006283533 6:33076175-33076197 GCTCAGGGAACAATTCCTAGGGG 0: 2
1: 0
2: 0
3: 26
4: 220
1006283522_1006283531 12 Left 1006283522 6:33076138-33076160 CCAGGTAAGAGCCGAACTGCCAT 0: 1
1: 0
2: 0
3: 7
4: 41
Right 1006283531 6:33076173-33076195 TGGCTCAGGGAACAATTCCTAGG 0: 2
1: 0
2: 2
3: 15
4: 148
1006283522_1006283529 -2 Left 1006283522 6:33076138-33076160 CCAGGTAAGAGCCGAACTGCCAT 0: 1
1: 0
2: 0
3: 7
4: 41
Right 1006283529 6:33076159-33076181 ATTCTTGGAGGGTCTGGCTCAGG 0: 1
1: 1
2: 0
3: 13
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006283522 Original CRISPR ATGGCAGTTCGGCTCTTACC TGG (reversed) Exonic