ID: 1006283529

View in Genome Browser
Species Human (GRCh38)
Location 6:33076159-33076181
Sequence ATTCTTGGAGGGTCTGGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 1, 2: 0, 3: 13, 4: 136}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006283520_1006283529 14 Left 1006283520 6:33076122-33076144 CCAGGGCAGGGCCACTCCAGGTA 0: 1
1: 1
2: 1
3: 25
4: 294
Right 1006283529 6:33076159-33076181 ATTCTTGGAGGGTCTGGCTCAGG 0: 1
1: 1
2: 0
3: 13
4: 136
1006283522_1006283529 -2 Left 1006283522 6:33076138-33076160 CCAGGTAAGAGCCGAACTGCCAT 0: 1
1: 0
2: 0
3: 7
4: 41
Right 1006283529 6:33076159-33076181 ATTCTTGGAGGGTCTGGCTCAGG 0: 1
1: 1
2: 0
3: 13
4: 136
1006283521_1006283529 3 Left 1006283521 6:33076133-33076155 CCACTCCAGGTAAGAGCCGAACT 0: 1
1: 0
2: 1
3: 2
4: 60
Right 1006283529 6:33076159-33076181 ATTCTTGGAGGGTCTGGCTCAGG 0: 1
1: 1
2: 0
3: 13
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006283529 Original CRISPR ATTCTTGGAGGGTCTGGCTC AGG Intronic