ID: 1006283911

View in Genome Browser
Species Human (GRCh38)
Location 6:33078586-33078608
Sequence TTGCTAAGGGTTCCACAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 79}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006283908_1006283911 -3 Left 1006283908 6:33078566-33078588 CCGTGCTCTGGGCAACTCAATTG 0: 1
1: 0
2: 1
3: 6
4: 119
Right 1006283911 6:33078586-33078608 TTGCTAAGGGTTCCACAAACAGG 0: 1
1: 0
2: 1
3: 7
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006283911 Original CRISPR TTGCTAAGGGTTCCACAAAC AGG Intronic
903341139 1:22655190-22655212 TTGCTAAAGGTTTTACAAAATGG - Intronic
906807379 1:48792382-48792404 TTCCTAGGGATGCCACAAACTGG - Intronic
908551599 1:65214054-65214076 TTGCTAGGGCTGCCACAGACTGG - Intronic
911668657 1:100583927-100583949 TAGATAAGGGTTCTATAAACTGG + Intergenic
920125514 1:203691124-203691146 TAGCTAAGGCTTCCCCAACCTGG + Intronic
1064390708 10:14939515-14939537 TTGCTTAGGGTTCTAGAGACTGG - Intronic
1075114304 10:119613114-119613136 TTGCCAAGGGTTCCAAAGACAGG + Intergenic
1078255782 11:9657688-9657710 TTGCTAAGGGTGCCATAACAAGG + Intergenic
1080310528 11:30886399-30886421 CTGCTCAGGCTGCCACAAACTGG + Intronic
1090095533 11:123739045-123739067 CTACTAAGGGCTCCACAAAGTGG - Intronic
1090533006 11:127610717-127610739 TTGCTGGGATTTCCACAAACAGG - Intergenic
1093399781 12:18731645-18731667 TTGTTATTGGTTACACAAACTGG - Intronic
1096511066 12:52128977-52128999 TTGCTGGGGGTTGCACAAATTGG + Intergenic
1099190563 12:79557652-79557674 TTGCTAAGGTTTCCAAAAACTGG + Intergenic
1103054429 12:117807382-117807404 TTTCGAAGGTTTCCATAAACTGG + Intronic
1106679760 13:31997904-31997926 TTGCAAAGGGACACACAAACAGG + Intergenic
1115090927 14:29574305-29574327 TTGCTAAGGGTGCCCCCAAAAGG + Intergenic
1118015833 14:61659818-61659840 TTTCTAATGGTTTCATAAACTGG - Intergenic
1120460741 14:84792097-84792119 TTGCTAAGGATTCCTTAAAATGG - Intergenic
1122325600 14:100879364-100879386 CTCCTAAGGGTTCCAGAAAAGGG - Intergenic
1128709652 15:69862090-69862112 TTGCTGAGGCTTCAACACACAGG - Intergenic
1129908771 15:79208918-79208940 TTTCTCAGGGTTACACAACCAGG + Intergenic
1132803001 16:1763364-1763386 TCACTGAGGGTTCCACAGACCGG - Intronic
1133429188 16:5721796-5721818 TTGCGAAGGTTTCCACAGGCAGG - Intergenic
1141300006 16:82805934-82805956 TTGCTAAAGTTTTCACCAACTGG - Intronic
1143365970 17:6408796-6408818 TTGCTTAGAATTCCCCAAACGGG + Intronic
1144341192 17:14311593-14311615 TTGTTTAGGGTTGGACAAACGGG + Intronic
1147375918 17:40022486-40022508 TGGCAAAGGGTTCCAGAAAAAGG + Intronic
1150972180 17:70041207-70041229 TTGCTCATGATTCCTCAAACAGG - Intergenic
1152944470 17:83191539-83191561 TTGCTTTGCGTTCCACAAAGAGG - Intergenic
1156599058 18:38582731-38582753 TTGCTAACGGATCCACAGAATGG + Intergenic
1156779477 18:40834435-40834457 TTTCTAAGAGTTCCCCCAACTGG + Intergenic
1157075408 18:44461027-44461049 TTGAAAAGGGTTTCTCAAACGGG - Intergenic
1162894589 19:13757674-13757696 TTGCTGAGGGTTCCCCAACTAGG - Intronic
1162896916 19:13770129-13770151 TTGCTAACGGTTGCACAGCCAGG - Intronic
1165964782 19:39567246-39567268 TTGGTGAGGGTTCCACCAAATGG - Intergenic
1168024780 19:53635988-53636010 TTGAGTAGGGTTCCACAAAGAGG + Intronic
926172131 2:10559090-10559112 TTGCCCTGGTTTCCACAAACAGG - Intergenic
927344744 2:22024857-22024879 TTGCTTAAGGTCACACAAACTGG - Intergenic
928537424 2:32253992-32254014 CTGCTAAATGTTTCACAAACTGG + Intronic
947231431 2:227891806-227891828 TTGCTAAGGCTTCCATAATAAGG + Intronic
1173838926 20:46144377-46144399 TTCCTAAGTGTTCCAGAAATAGG - Intergenic
1174873819 20:54207425-54207447 ATGCTACGGATTCCAAAAACGGG + Intergenic
1177366119 21:20140057-20140079 TTTCTAATGGTGCCAAAAACGGG + Intergenic
1185233422 22:49696687-49696709 TTTCTAAGAGTTCCAAAAAAGGG + Intergenic
950610520 3:14124181-14124203 GTGCTAGGAGTTCCACTAACGGG - Intronic
957302076 3:78405194-78405216 TAACTAAATGTTCCACAAACTGG - Intergenic
959454471 3:106541621-106541643 TTGCTGATGGTTCCATAAAATGG + Intergenic
963976105 3:151481798-151481820 TTGCTAAGAGTTCCTCACAGTGG - Intergenic
964106490 3:153046011-153046033 TTGATAAGGATTCAACAAATGGG - Intergenic
967545882 3:190727268-190727290 TTGCTAAGAGTTCCTCATCCTGG + Intergenic
972292543 4:37703406-37703428 TTCCTAAGTGTTCCACATTCTGG + Intergenic
973004320 4:44989827-44989849 TATCAAAGGGTTCCATAAACTGG + Intergenic
980053484 4:128060062-128060084 TTGCTTAGGGTTGGGCAAACTGG + Intergenic
985585485 5:731004-731026 TTGCTAGAGCTTCCACAAGCAGG - Intronic
985599000 5:815325-815347 TTGCTAGAGCTTCCACAAGCAGG - Intronic
985599923 5:822431-822453 TTGCTAGAGCTTCCACAAGCAGG - Intronic
990386676 5:55271160-55271182 TTGCTATGGTTTCCTAAAACAGG + Intronic
993076002 5:83232290-83232312 TTCTTAAGGGGTTCACAAACAGG - Intronic
993297432 5:86159995-86160017 GTGCTAAGGGTTACACAGAATGG + Intergenic
993672337 5:90776529-90776551 TTGCTGAGGGTTCCCCAATGAGG - Exonic
998389646 5:141779316-141779338 TTGCTAAAGGTCACACAACCAGG + Intergenic
998494617 5:142576974-142576996 TAGCTAAAGGTTCCACAGATAGG - Intergenic
1001983121 5:176050206-176050228 CTGCTAAGGTCTCCACAAAATGG - Exonic
1002234346 5:177793846-177793868 CTGCTAAGGTCTCCACAAAATGG + Exonic
1006283911 6:33078586-33078608 TTGCTAAGGGTTCCACAAACAGG + Intronic
1007115941 6:39343369-39343391 CTGCTCAGGCTTCTACAAACAGG - Intronic
1008057271 6:46958013-46958035 TTGCTAAGAGCTACAAAAACTGG - Intergenic
1008198264 6:48553237-48553259 TTTCTAAGGCTTCCACATGCTGG - Intergenic
1009755306 6:67931288-67931310 TTGCTAAGGAGTCCACAAATTGG - Intergenic
1010642952 6:78353556-78353578 TGGCTCATGGTTCCACAGACTGG + Intergenic
1011043266 6:83054434-83054456 TTGCTAAGTGTTCCAGAGACAGG + Intronic
1019418719 7:939041-939063 CTGCTACGGGTTCCATGAACAGG - Intronic
1020801468 7:12737978-12738000 TTCCTAAGCATTCCACAAATTGG + Intergenic
1029702260 7:102254952-102254974 TCTCTAAGGGTTTCACAGACTGG - Exonic
1032650001 7:133867804-133867826 TTGCTCAGGGTTCTACAGAAAGG - Intronic
1033413960 7:141146154-141146176 TTGCTAAGGTTTCCACAAGTGGG + Intronic
1037084079 8:14825233-14825255 TTGCTAAGGATTTCACAGATGGG - Intronic
1037411287 8:18600698-18600720 TTGCTAATGGTCCCACAACTAGG + Intronic
1046328333 8:112679407-112679429 TTGCTATTGGGTCCACAAACAGG + Intronic
1051591515 9:18780405-18780427 TTTCTAAATGCTCCACAAACAGG + Intronic
1055504397 9:76932970-76932992 TAGCTAAGTGTTCCTGAAACAGG + Intergenic
1186833130 X:13410930-13410952 TGCCAAAGGGTTCCACAAAATGG - Intergenic
1187316985 X:18205731-18205753 TTGCAAAGTGGTCCACAAACTGG + Intronic
1193862798 X:86691778-86691800 TAGCTAAGGCTGCCACAGACAGG - Intronic
1194695008 X:97036323-97036345 TTTCTAAGATATCCACAAACAGG - Intronic
1195947044 X:110226291-110226313 TTGCCAATGGTTCTAAAAACAGG + Intronic
1200755925 Y:6989979-6990001 TTGCTATGGGTTCCACTAATGGG + Intronic