ID: 1006285706

View in Genome Browser
Species Human (GRCh38)
Location 6:33092403-33092425
Sequence CCTTGGGTTCTATCCCCTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006285706_1006285709 -7 Left 1006285706 6:33092403-33092425 CCAAAAGGGGATAGAACCCAAGG No data
Right 1006285709 6:33092419-33092441 CCCAAGGAGCCTACTGCCATTGG No data
1006285706_1006285712 7 Left 1006285706 6:33092403-33092425 CCAAAAGGGGATAGAACCCAAGG No data
Right 1006285712 6:33092433-33092455 TGCCATTGGCTGATTCTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006285706 Original CRISPR CCTTGGGTTCTATCCCCTTT TGG (reversed) Intergenic
No off target data available for this crispr