ID: 1006285710

View in Genome Browser
Species Human (GRCh38)
Location 6:33092420-33092442
Sequence GCCAATGGCAGTAGGCTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006285710_1006285721 28 Left 1006285710 6:33092420-33092442 CCAAGGAGCCTACTGCCATTGGC No data
Right 1006285721 6:33092471-33092493 TCCTATATTCACCAGATTAGGGG No data
1006285710_1006285712 -10 Left 1006285710 6:33092420-33092442 CCAAGGAGCCTACTGCCATTGGC No data
Right 1006285712 6:33092433-33092455 TGCCATTGGCTGATTCTTAAAGG No data
1006285710_1006285720 27 Left 1006285710 6:33092420-33092442 CCAAGGAGCCTACTGCCATTGGC No data
Right 1006285720 6:33092470-33092492 GTCCTATATTCACCAGATTAGGG No data
1006285710_1006285719 26 Left 1006285710 6:33092420-33092442 CCAAGGAGCCTACTGCCATTGGC No data
Right 1006285719 6:33092469-33092491 AGTCCTATATTCACCAGATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006285710 Original CRISPR GCCAATGGCAGTAGGCTCCT TGG (reversed) Intergenic