ID: 1006285712

View in Genome Browser
Species Human (GRCh38)
Location 6:33092433-33092455
Sequence TGCCATTGGCTGATTCTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006285708_1006285712 -9 Left 1006285708 6:33092419-33092441 CCCAAGGAGCCTACTGCCATTGG No data
Right 1006285712 6:33092433-33092455 TGCCATTGGCTGATTCTTAAAGG No data
1006285703_1006285712 21 Left 1006285703 6:33092389-33092411 CCTCGGTGGGGGCTCCAAAAGGG No data
Right 1006285712 6:33092433-33092455 TGCCATTGGCTGATTCTTAAAGG No data
1006285706_1006285712 7 Left 1006285706 6:33092403-33092425 CCAAAAGGGGATAGAACCCAAGG No data
Right 1006285712 6:33092433-33092455 TGCCATTGGCTGATTCTTAAAGG No data
1006285710_1006285712 -10 Left 1006285710 6:33092420-33092442 CCAAGGAGCCTACTGCCATTGGC No data
Right 1006285712 6:33092433-33092455 TGCCATTGGCTGATTCTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006285712 Original CRISPR TGCCATTGGCTGATTCTTAA AGG Intergenic
No off target data available for this crispr