ID: 1006285720

View in Genome Browser
Species Human (GRCh38)
Location 6:33092470-33092492
Sequence GTCCTATATTCACCAGATTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006285708_1006285720 28 Left 1006285708 6:33092419-33092441 CCCAAGGAGCCTACTGCCATTGG No data
Right 1006285720 6:33092470-33092492 GTCCTATATTCACCAGATTAGGG No data
1006285713_1006285720 12 Left 1006285713 6:33092435-33092457 CCATTGGCTGATTCTTAAAGGTT No data
Right 1006285720 6:33092470-33092492 GTCCTATATTCACCAGATTAGGG No data
1006285710_1006285720 27 Left 1006285710 6:33092420-33092442 CCAAGGAGCCTACTGCCATTGGC No data
Right 1006285720 6:33092470-33092492 GTCCTATATTCACCAGATTAGGG No data
1006285711_1006285720 19 Left 1006285711 6:33092428-33092450 CCTACTGCCATTGGCTGATTCTT No data
Right 1006285720 6:33092470-33092492 GTCCTATATTCACCAGATTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006285720 Original CRISPR GTCCTATATTCACCAGATTA GGG Intergenic