ID: 1006285721

View in Genome Browser
Species Human (GRCh38)
Location 6:33092471-33092493
Sequence TCCTATATTCACCAGATTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006285711_1006285721 20 Left 1006285711 6:33092428-33092450 CCTACTGCCATTGGCTGATTCTT No data
Right 1006285721 6:33092471-33092493 TCCTATATTCACCAGATTAGGGG No data
1006285714_1006285721 -10 Left 1006285714 6:33092458-33092480 CCACCACCCCAAGTCCTATATTC No data
Right 1006285721 6:33092471-33092493 TCCTATATTCACCAGATTAGGGG No data
1006285713_1006285721 13 Left 1006285713 6:33092435-33092457 CCATTGGCTGATTCTTAAAGGTT No data
Right 1006285721 6:33092471-33092493 TCCTATATTCACCAGATTAGGGG No data
1006285708_1006285721 29 Left 1006285708 6:33092419-33092441 CCCAAGGAGCCTACTGCCATTGG No data
Right 1006285721 6:33092471-33092493 TCCTATATTCACCAGATTAGGGG No data
1006285710_1006285721 28 Left 1006285710 6:33092420-33092442 CCAAGGAGCCTACTGCCATTGGC No data
Right 1006285721 6:33092471-33092493 TCCTATATTCACCAGATTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006285721 Original CRISPR TCCTATATTCACCAGATTAG GGG Intergenic