ID: 1006290665

View in Genome Browser
Species Human (GRCh38)
Location 6:33133627-33133649
Sequence ACCATGATTTGGAGTAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006290665_1006290668 -8 Left 1006290665 6:33133627-33133649 CCTGTTTTACTCCAAATCATGGT No data
Right 1006290668 6:33133642-33133664 ATCATGGTAAAAAGGACCTAAGG No data
1006290665_1006290673 27 Left 1006290665 6:33133627-33133649 CCTGTTTTACTCCAAATCATGGT No data
Right 1006290673 6:33133677-33133699 CTAGAAGACTGAAGGCCTCCTGG No data
1006290665_1006290670 19 Left 1006290665 6:33133627-33133649 CCTGTTTTACTCCAAATCATGGT No data
Right 1006290670 6:33133669-33133691 ATGCCCTTCTAGAAGACTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006290665 Original CRISPR ACCATGATTTGGAGTAAAAC AGG (reversed) Intergenic
No off target data available for this crispr