ID: 1006290667

View in Genome Browser
Species Human (GRCh38)
Location 6:33133638-33133660
Sequence AGGTCCTTTTTACCATGATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006290667_1006290673 16 Left 1006290667 6:33133638-33133660 CCAAATCATGGTAAAAAGGACCT No data
Right 1006290673 6:33133677-33133699 CTAGAAGACTGAAGGCCTCCTGG No data
1006290667_1006290670 8 Left 1006290667 6:33133638-33133660 CCAAATCATGGTAAAAAGGACCT No data
Right 1006290670 6:33133669-33133691 ATGCCCTTCTAGAAGACTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006290667 Original CRISPR AGGTCCTTTTTACCATGATT TGG (reversed) Intergenic
No off target data available for this crispr