ID: 1006290670

View in Genome Browser
Species Human (GRCh38)
Location 6:33133669-33133691
Sequence ATGCCCTTCTAGAAGACTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006290667_1006290670 8 Left 1006290667 6:33133638-33133660 CCAAATCATGGTAAAAAGGACCT No data
Right 1006290670 6:33133669-33133691 ATGCCCTTCTAGAAGACTGAAGG No data
1006290665_1006290670 19 Left 1006290665 6:33133627-33133649 CCTGTTTTACTCCAAATCATGGT No data
Right 1006290670 6:33133669-33133691 ATGCCCTTCTAGAAGACTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006290670 Original CRISPR ATGCCCTTCTAGAAGACTGA AGG Intergenic
No off target data available for this crispr