ID: 1006291871

View in Genome Browser
Species Human (GRCh38)
Location 6:33144102-33144124
Sequence CTGTAATCCCAGATACTCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006291862_1006291871 27 Left 1006291862 6:33144052-33144074 CCCCATCTCTACTAAAAATACAA 0: 82079
1: 170980
2: 171502
3: 107694
4: 70628
Right 1006291871 6:33144102-33144124 CTGTAATCCCAGATACTCGAGGG No data
1006291864_1006291871 25 Left 1006291864 6:33144054-33144076 CCATCTCTACTAAAAATACAAAA 0: 194929
1: 143151
2: 66814
3: 37831
4: 46551
Right 1006291871 6:33144102-33144124 CTGTAATCCCAGATACTCGAGGG No data
1006291863_1006291871 26 Left 1006291863 6:33144053-33144075 CCCATCTCTACTAAAAATACAAA 0: 86734
1: 238723
2: 156972
3: 78020
4: 57628
Right 1006291871 6:33144102-33144124 CTGTAATCCCAGATACTCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006291871 Original CRISPR CTGTAATCCCAGATACTCGA GGG Intergenic
No off target data available for this crispr