ID: 1006292624

View in Genome Browser
Species Human (GRCh38)
Location 6:33151675-33151697
Sequence CCATCTCAAGATGGTTTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006292624_1006292628 -10 Left 1006292624 6:33151675-33151697 CCATTAAAACCATCTTGAGATGG No data
Right 1006292628 6:33151688-33151710 CTTGAGATGGCCAGGTGCAGTGG No data
1006292624_1006292634 27 Left 1006292624 6:33151675-33151697 CCATTAAAACCATCTTGAGATGG No data
Right 1006292634 6:33151725-33151747 CCCAGCATTTTGGGATGCTGAGG 0: 57
1: 5378
2: 103182
3: 230315
4: 346839
1006292624_1006292636 30 Left 1006292624 6:33151675-33151697 CCATTAAAACCATCTTGAGATGG No data
Right 1006292636 6:33151728-33151750 AGCATTTTGGGATGCTGAGGCGG 0: 32
1: 3821
2: 73025
3: 160922
4: 173747
1006292624_1006292631 18 Left 1006292624 6:33151675-33151697 CCATTAAAACCATCTTGAGATGG No data
Right 1006292631 6:33151716-33151738 GCCTGTAATCCCAGCATTTTGGG 0: 9429
1: 235524
2: 277870
3: 222838
4: 263838
1006292624_1006292630 17 Left 1006292624 6:33151675-33151697 CCATTAAAACCATCTTGAGATGG No data
Right 1006292630 6:33151715-33151737 TGCCTGTAATCCCAGCATTTTGG 0: 4987
1: 103398
2: 243056
3: 299803
4: 254654

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006292624 Original CRISPR CCATCTCAAGATGGTTTTAA TGG (reversed) Intergenic
No off target data available for this crispr