ID: 1006294477

View in Genome Browser
Species Human (GRCh38)
Location 6:33163988-33164010
Sequence TGCCCAGCAGAGGCACACGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 202}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006294477_1006294482 26 Left 1006294477 6:33163988-33164010 CCACCGTGTGCCTCTGCTGGGCA 0: 1
1: 0
2: 1
3: 18
4: 202
Right 1006294482 6:33164037-33164059 TGCATTAACCTGTGTGACGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006294477 Original CRISPR TGCCCAGCAGAGGCACACGG TGG (reversed) Intronic
900406743 1:2496118-2496140 TGCCCAGGCGAGGGGCACGGAGG - Intronic
900710784 1:4112273-4112295 TGCCCTTCAGTGGCACACAGAGG + Intergenic
901228497 1:7628956-7628978 GGCCCAGCAGAGACAGAGGGTGG - Intronic
901472536 1:9467710-9467732 AGCCCAGGAGAGACACACGCAGG - Intergenic
901638707 1:10682359-10682381 AGCCCTGCAGAGGCAGAGGGAGG + Intronic
902722469 1:18313142-18313164 GCCCCAGCAGAGGGACAGGGAGG + Intronic
902949823 1:19873615-19873637 GGACAGGCAGAGGCACACGGAGG + Intergenic
903169339 1:21542373-21542395 TCCCCACCAGAGGCACACATAGG - Intronic
903262720 1:22139994-22140016 TGCCCAACAGCTGCACGCGGCGG + Intronic
905873082 1:41416116-41416138 TGCCCAGCAGGGGCCCACCAGGG + Intergenic
905901235 1:41583180-41583202 TTCTCAGGAGAGGCACAGGGGGG + Exonic
906102644 1:43273022-43273044 TGCGCAGCAGGGCCACATGGTGG - Exonic
906476844 1:46175119-46175141 TGACCATCACAGGCACACAGAGG + Exonic
908168023 1:61477235-61477257 TGTCCAGCAGATCCACACAGTGG - Intergenic
912318927 1:108692450-108692472 TGCCCAGCTGGGGCACAGCGAGG + Exonic
912555093 1:110510243-110510265 TGACCAGCAGAGGCAAGCTGAGG + Intergenic
917926570 1:179794123-179794145 GGCTGAGCAGAGGCACAAGGTGG - Intronic
919944023 1:202306976-202306998 TGCCTAGCAGAGGGACACGGTGG - Intronic
920054367 1:203181748-203181770 TGCCCTGGAGTGGCACAGGGAGG - Intronic
920276296 1:204807383-204807405 GACCCAGCAGAGGCACTAGGTGG - Intergenic
922704096 1:227779895-227779917 GGCCCAGCAGATGCAGAAGGTGG - Intronic
922714477 1:227859794-227859816 GGCCCCACAGGGGCACACGGGGG + Intergenic
1065797926 10:29324083-29324105 TGCCCATGAGAGGCACAGTGTGG - Intergenic
1067117593 10:43447143-43447165 AGTCCAGCAGAGGGAGACGGTGG + Intronic
1067344718 10:45428957-45428979 TGGCCAGTCGAGGCACACTGTGG + Intronic
1071135727 10:82451682-82451704 AGACAAGCAGAGGCACACAGAGG - Intronic
1071588131 10:86845552-86845574 TGCCCACCAGAGCCACAGTGCGG + Intronic
1074715164 10:116211448-116211470 TGGACAGCAGAGGCCCAGGGAGG + Intronic
1075941233 10:126391973-126391995 TGCCCAGAAGAGGTTCACTGGGG - Intergenic
1076887319 10:133268657-133268679 TGCCCAGCACGGGCCCATGGTGG - Intronic
1077100246 11:819368-819390 TGCCCAGCAGGGGCGGAGGGAGG + Intronic
1077466926 11:2737911-2737933 TGCCCAGGGGAGGCACACCTGGG + Intronic
1079138948 11:17794969-17794991 TGCCCAGCAGATGCAGAAGGGGG - Intronic
1083336127 11:61922885-61922907 TGCCCAGCAGAGGAAGGTGGGGG - Intergenic
1084144687 11:67258675-67258697 AGCCCTGCAGAGGCACCCAGTGG + Intergenic
1084795083 11:71500155-71500177 TGCACAACAGAGGCACACACAGG + Intronic
1085465934 11:76723344-76723366 TGGCCAGCAGGGGCTCACAGAGG + Intergenic
1087816622 11:102665319-102665341 AGCACAGCAGAGACACAAGGGGG + Intergenic
1088262867 11:107960828-107960850 AGCCCAGCAGAAGCAAACAGAGG + Intronic
1090102545 11:123815345-123815367 TGCCAAGCAGGGTGACACGGCGG - Intergenic
1091010594 11:131997279-131997301 TTCCTAGCAGAAGCACACTGAGG - Intronic
1091222858 11:133939660-133939682 AGCGCAGCAGGGGCGCACGGAGG + Intronic
1091334396 11:134755517-134755539 TGCCCAGCACAGGGACAGGATGG + Intergenic
1091653521 12:2326998-2327020 TTCCCAGCAGAGGAAGAAGGAGG - Intronic
1095259499 12:40082472-40082494 TGCCCAGCTGAGGCACTTGCCGG - Intronic
1096550950 12:52371159-52371181 TGGCCAGCAGAGGCAAAGGGCGG - Intergenic
1096581609 12:52589266-52589288 TGCCCAGCAGAGGAGGATGGTGG - Intronic
1096680745 12:53253573-53253595 TGCCCAACAGCAGCACGCGGCGG - Exonic
1099675536 12:85755932-85755954 TACCCTGCAGAGCCACAGGGTGG + Intergenic
1100662985 12:96720536-96720558 TGCTCTGCAGAGGCACCGGGCGG + Exonic
1101037143 12:100717178-100717200 TGCCCGGCAGAGGCGCGCCGCGG - Intergenic
1101844570 12:108352187-108352209 TGCCCAGCCCTGGCACACCGTGG + Intergenic
1105344634 13:19561300-19561322 TGCCGATCCCAGGCACACGGCGG + Intergenic
1107609876 13:42102457-42102479 TGCCCAGCAGACGCAGATGTTGG + Intronic
1108666776 13:52640662-52640684 TGCCCTCCAGAGACACACTGGGG + Intergenic
1118867995 14:69718314-69718336 TTCCCAGCAGCGGCCCAGGGTGG + Intergenic
1120851829 14:89178569-89178591 AGCCCAGCTGAGGCACTCAGTGG + Intronic
1121324926 14:93014293-93014315 TGCCCAGAAAAGGAACACAGCGG + Intronic
1122505583 14:102229824-102229846 TGCCCACTAGAGTCCCACGGGGG + Intronic
1124102990 15:26712963-26712985 TGCACAGCGAAGGCAGACGGAGG + Intronic
1125137402 15:36359462-36359484 AGCCCAGCAAAGGCAAATGGTGG + Intergenic
1127184983 15:56469491-56469513 AGCCCAGAAGAGGCAAACTGTGG + Intergenic
1128251640 15:66167928-66167950 TGCCCAGCAGGGGTTCAGGGGGG - Intronic
1129698225 15:77752729-77752751 TGACCAGCACAGGGACACAGTGG - Intronic
1130169127 15:81493858-81493880 GGCACAGCACAGGCACACGTGGG - Intergenic
1132730789 16:1360833-1360855 AGCTCAGCGGAGGCAGACGGAGG - Intronic
1132925170 16:2425503-2425525 TGTCCCACAGATGCACACGGGGG - Intergenic
1133257356 16:4525450-4525472 TGCCCAGCACAGGGACATGAAGG + Intronic
1133771945 16:8871784-8871806 TGACCAGGAGGGGCACAAGGTGG + Intergenic
1134762949 16:16730180-16730202 TGCACAGGAGAGTCACTCGGGGG + Intergenic
1134983103 16:18628969-18628991 TGCACAGGAGAGTCACTCGGGGG - Intergenic
1136736815 16:32474134-32474156 GGCCCGGGAAAGGCACACGGTGG + Intergenic
1137508310 16:49076049-49076071 TGCCCAGGTGAAGCACAGGGAGG - Intergenic
1140422462 16:74831849-74831871 TGTCCAGCAGAGGTACCCTGTGG - Intergenic
1141291723 16:82723983-82724005 TGCCCAGCAGAGCCAGATGCTGG + Intronic
1141934692 16:87229426-87229448 TGCCCAGAATTGGCGCACGGTGG - Intronic
1141984671 16:87572015-87572037 GGCCCAGCACAGCCCCACGGTGG - Intergenic
1142113986 16:88346960-88346982 TTCCCAGGAGAGGCACACTGAGG + Intergenic
1142292161 16:89198170-89198192 TGCCCAGCAGCAGCACGGGGCGG + Exonic
1143188002 17:5022219-5022241 TGCCCAGCAGTGGCAAGCGCAGG + Exonic
1143615854 17:8048661-8048683 GTCCCAGGAGAGGCACATGGGGG - Exonic
1143725602 17:8843088-8843110 TGCCCAGCAGAGGGACCAGGTGG - Intronic
1144759581 17:17699827-17699849 TGACCAGGAGAGGCACAGGGTGG - Intronic
1146466209 17:33088793-33088815 CCCCCTGCAGAGGCACAAGGAGG - Intronic
1146623612 17:34419416-34419438 GGCCCAGCAGAGGCCCAGAGAGG + Intergenic
1146917997 17:36690438-36690460 TGCCCAGCAGAGGCAGCGGCTGG + Intergenic
1147312159 17:39601817-39601839 TGGCCAGGAGAGCCACATGGAGG + Intergenic
1147635400 17:41960873-41960895 TGCCCTCCAGAGGCTCACAGGGG + Intronic
1152245161 17:79181649-79181671 TGGCCAGCAGTGGCAGAGGGTGG - Intronic
1152289481 17:79431150-79431172 GGCCCAGCTGAGGAACACGAAGG + Intronic
1152733151 17:81983381-81983403 TGACCTGCAGAGGCACAAGGCGG - Intronic
1152890561 17:82879341-82879363 GGCCCAGAAGCGGCACACGAAGG - Intronic
1153421896 18:4916494-4916516 TGCCCTGCAAAGCCACAGGGTGG - Intergenic
1156473237 18:37390468-37390490 TGCCCAGCAGAGGGAAAAAGAGG - Intronic
1157226169 18:45866686-45866708 TGCTCAGCAGAGGAAGTCGGAGG - Intronic
1157593110 18:48847994-48848016 GGTCCCGCAGAGGCACAGGGTGG + Intronic
1158328235 18:56333023-56333045 TGCCCAGCAGTGGGTCACTGGGG + Intergenic
1159345818 18:67201484-67201506 GGCCCAGCATAGGGACATGGAGG + Intergenic
1160672732 19:373899-373921 CCCCCAGCATAGGCACACGGCGG + Intronic
1162779917 19:13001745-13001767 TGCCCAGGAGAGGCGCCCGTGGG - Intronic
1162792451 19:13070084-13070106 TGCCCACCAGAGGCACAACGTGG - Intronic
1163108421 19:15141612-15141634 TCCCAGGCAGAGGCAAACGGTGG + Intergenic
1164713500 19:30375507-30375529 TCCCCAGCAGAGGCGCAAGGAGG - Intronic
1165149036 19:33750326-33750348 TCACCAGCATAGGCACACGCTGG + Intronic
1165157523 19:33797096-33797118 CGCCCAGCAGAGGGACAAAGCGG - Intronic
1165695631 19:37898851-37898873 TGGCCAGCAGAGGGCAACGGAGG + Intronic
1167291940 19:48629359-48629381 TGCCCAGCGGAGGCAGCAGGTGG - Exonic
1167472039 19:49680699-49680721 TGCGCAGCAGAGGGGCAGGGGGG - Intronic
1168406574 19:56113629-56113651 TGCCCACAAGAGGCACACCCCGG + Intronic
925069649 2:956287-956309 TGCCCAGCAGGGGCAGGCGCAGG - Intronic
925886972 2:8401700-8401722 GTCCCAGCATAGGCACACAGGGG + Intergenic
925909742 2:8565945-8565967 TGCCCGGCAGATGCACAAGAGGG + Intergenic
926111396 2:10186609-10186631 TGAACAGCAGAGGCACAGAGGGG - Intronic
927097296 2:19757324-19757346 TGCCCAGCAAAGGCACTGGTTGG + Intergenic
927249753 2:20987122-20987144 GGCCCAACACATGCACACGGAGG - Intergenic
928199695 2:29239751-29239773 TGCCCAGCACAGACACGCCGTGG + Exonic
928361018 2:30662481-30662503 GGCCCAGCAGCTGCACACAGTGG + Intergenic
929917548 2:46148585-46148607 TGCCCAGTAGATACACACAGTGG + Intronic
932764551 2:74461646-74461668 TGTCCAGCAGGGGCCCAAGGCGG + Exonic
933716532 2:85365543-85365565 TGACCAACAGAAGAACACGGGGG - Intronic
933775054 2:85766743-85766765 TGCCCAGAAGCGGGACACAGGGG - Intronic
933809230 2:86022145-86022167 TGTCCAGCAGGGGCAGAAGGAGG - Exonic
934524600 2:95043800-95043822 TGCCCAGGAGATGCCCAGGGAGG - Intronic
936081396 2:109434986-109435008 TGCACAGCAGAGGTAGAGGGAGG - Intronic
937077338 2:119116860-119116882 TGCCCAGCTGAGGCAAACTACGG + Intergenic
942277315 2:174332813-174332835 AGCCCAGCAGGGGGACCCGGGGG - Intergenic
942654832 2:178204461-178204483 TTTCCAGCAGTGGCACAGGGAGG - Intronic
944269063 2:197760458-197760480 TGCCCACCAGAGGCAGCCTGTGG - Intronic
947534708 2:230933438-230933460 TGCCCAGCAGCTGCACACCATGG - Intronic
947877641 2:233478229-233478251 TGCCCAGCAGATGCAGCAGGAGG + Intronic
948109002 2:235439573-235439595 TGTGCAGGAGAGGTACACGGTGG + Intergenic
948663985 2:239523339-239523361 TGCCCAGCAGCCGCACCCTGAGG + Intergenic
1169553162 20:6722040-6722062 TGGCCAACAGATGCACACAGTGG - Intergenic
1169593727 20:7175003-7175025 TGCACAGCATAGGCACAATGAGG - Intergenic
1172122653 20:32607943-32607965 TGCCCAGGAGGGGCACAGTGAGG + Intronic
1172174930 20:32966524-32966546 TGCCCAGAGGAAGGACACGGGGG + Intergenic
1172244653 20:33437694-33437716 GGCCCAGAACAGGCACAGGGAGG - Intronic
1172523305 20:35582986-35583008 TGCCCTGCCCAGGAACACGGGGG + Intergenic
1173614434 20:44393584-44393606 TACACACCAGAGGCACAGGGAGG - Intronic
1173841399 20:46159538-46159560 TGTCCAGCTGGGGCACAGGGAGG + Intergenic
1175641454 20:60633821-60633843 TGGGCAGCAGAGGCACATTGGGG + Intergenic
1177358406 21:20037929-20037951 TACCCTGCAGAGCCACAGGGTGG + Intergenic
1178316680 21:31572352-31572374 TGCCCAGAAGATGAACACAGGGG - Intergenic
1178363408 21:31968587-31968609 TGCCCTGCAGGGGCACCTGGAGG + Intronic
1179943435 21:44654476-44654498 GGCACAGCAGAGCCACACAGGGG + Exonic
1180535735 22:16391784-16391806 GGCCCGGGAAAGGCACACGGTGG - Intergenic
1181435913 22:22910758-22910780 TGACCAGCTGAGGCATACAGGGG - Intergenic
1183601592 22:38843519-38843541 GGCCCAGCAGGGGGACGCGGCGG - Exonic
1183977827 22:41523460-41523482 GGCCCTGCAGAGGCACTGGGGGG + Intronic
1184365709 22:44049867-44049889 TCCCCACCAGAGCCACACAGAGG - Intronic
1185413962 22:50699760-50699782 AGCTCAGCAGAGGCCCAGGGAGG + Intergenic
950149433 3:10675251-10675273 GACCCAGCAGAGGCACAAAGTGG - Intronic
950187982 3:10957231-10957253 TGCCCAGCAGATGCAGAAGCAGG + Intergenic
950477584 3:13223659-13223681 TGCCCACAAGAGACACACTGGGG + Intergenic
950614613 3:14148758-14148780 TGGCCAGCAGGGGAACAAGGCGG + Intronic
952089631 3:29868859-29868881 TGCACAGCAAAGGCTCACTGGGG - Exonic
952871574 3:37905599-37905621 TGCCCAGCTGTGGCACAAGGAGG - Intronic
953066763 3:39480357-39480379 TGCCAAGCACAGACACTCGGTGG - Intronic
953256651 3:41297170-41297192 TGCACAGCAGGCGCTCACGGAGG - Intronic
953505075 3:43477893-43477915 TGCACACCAGAGGCACACATAGG + Intronic
954117016 3:48472654-48472676 TGCCCAACAGAGGCCCAAGGAGG + Intronic
956619558 3:71207590-71207612 TGACCTGCAGAGGCAAATGGTGG - Intronic
961360819 3:126366036-126366058 GACACAGCTGAGGCACACGGAGG + Intergenic
962314914 3:134353298-134353320 AGCCCAGCAGAGGTACTCTGGGG + Intergenic
968129117 3:196182117-196182139 TTCACAGCAGAGGCTCAGGGAGG - Intergenic
968600300 4:1505507-1505529 AGCCCAGCTGAGGCCCACGTTGG - Intergenic
968654976 4:1774543-1774565 TGCCCAGAAGAGGCTCAGGGTGG + Intergenic
968755884 4:2416600-2416622 ACCCCGGCAGAGGCACATGGGGG + Intronic
968964807 4:3764478-3764500 TGCCAAGCAGGGGCGCACGTTGG - Intergenic
969623516 4:8290870-8290892 CTCCCAGTAGAGACACACGGGGG - Intronic
972571661 4:40316876-40316898 TTCTCAGCAGAGGCACAGAGTGG - Intergenic
974573758 4:63689422-63689444 TACCCTGCAGAGCCACAGGGTGG + Intergenic
977577485 4:98690640-98690662 TTCCCAGCAGCGGCAAAGGGAGG - Intergenic
985486541 5:154851-154873 TGCCAAGAAGAGGCACTCGTTGG - Intronic
985849026 5:2374955-2374977 AGCACAGCAGGGGCCCACGGAGG + Intergenic
988320320 5:29686413-29686435 TGCCCAGCAGAGACATGAGGTGG - Intergenic
988355957 5:30175083-30175105 TGTCCAGCAGATCCACACTGTGG + Intergenic
989415833 5:41174320-41174342 TCCACAGCAGAGGAACACTGAGG - Intronic
992557160 5:77915339-77915361 TGCCCAGCAGAGCTACAAGCAGG + Intergenic
993771320 5:91931455-91931477 TGAACAGCAGAGGCAGAAGGTGG - Intergenic
997421973 5:133776653-133776675 TGCCCATGAGAGGCACTCTGGGG + Intergenic
997625657 5:135329057-135329079 AGCCCAGCAGTGGCCCAAGGTGG + Intronic
999125196 5:149241062-149241084 GGCGCAGCAGGGGCACACAGCGG + Intronic
1002102076 5:176862625-176862647 TGCCCAGCAGAGTGCCACCGTGG + Exonic
1003513171 6:6798509-6798531 TGCTGAGCAGAGGCACAAAGAGG + Intergenic
1005927007 6:30452656-30452678 TCCCCAGGAGAGGCAAAGGGTGG + Intergenic
1006116951 6:31780617-31780639 TGCCCACCAGAGGCTCAGGGTGG + Intronic
1006294477 6:33163988-33164010 TGCCCAGCAGAGGCACACGGTGG - Intronic
1006296642 6:33172826-33172848 TCCCCAACAGAGACACAAGGTGG - Intronic
1006655060 6:35583980-35584002 TTCCCAGGAGAAGCACAAGGGGG + Intronic
1007282542 6:40723107-40723129 TGCCCAGCAGAGGCATATGAAGG - Intergenic
1012355433 6:98308328-98308350 TGCACAGCAGAGTCATAAGGAGG - Intergenic
1018358844 6:163045214-163045236 TGGCCAGCAGAGGGGCACGAGGG + Intronic
1019028692 6:168992263-168992285 TGGGGTGCAGAGGCACACGGGGG - Intergenic
1019440987 7:1046692-1046714 TGAGCAGCAGAGGGACAAGGTGG + Intronic
1021415470 7:20378387-20378409 TGCCCTGCAGTGCCACATGGAGG - Intronic
1023043396 7:36192061-36192083 TGCTCTGCACAGGCACACAGAGG + Intronic
1023705847 7:42941200-42941222 GGGCCAGCAGAGGAACACAGGGG - Intronic
1027220562 7:76211262-76211284 TGCCAGGCAGAGGCACAAGGAGG + Intronic
1028776936 7:94688095-94688117 TGCCCAGCAGAGGCATAGGTTGG - Intergenic
1034544209 7:151779330-151779352 AGCCCAGCAGTGGCACCAGGAGG - Intronic
1039232298 8:35461699-35461721 TCCCCAGCAGTGGCTCACTGGGG - Intronic
1044840192 8:96330632-96330654 TGCCCAGAAGAGCCACAGGCCGG - Intronic
1045036328 8:98179165-98179187 TGCTCAGCAAAGGGACATGGGGG - Intergenic
1048254939 8:132898498-132898520 TGCCCAGCAGATGTACAGAGGGG - Intronic
1049007238 8:139863341-139863363 TGCCCAGCTGCAGCACAGGGAGG + Intronic
1049164147 8:141116321-141116343 TGTCCAGCAGTGGCACAAGGAGG + Intergenic
1049502095 8:142972451-142972473 TGCCCACCAATGGCACACAGGGG - Intergenic
1049569562 8:143362809-143362831 GGCCCAGCCGAGGTACATGGAGG - Intergenic
1049647166 8:143740652-143740674 TGCCCAGCAGGGGCGCACCAGGG - Intergenic
1049724439 8:144138965-144138987 TGCCCAGCCCAGGGACACAGTGG + Intronic
1049733776 8:144192581-144192603 TGCCCAGTAGTGGCACATGCAGG + Intronic
1055799633 9:80021062-80021084 TGCCCAGCAGAAGGACCTGGTGG - Intergenic
1056275547 9:84991327-84991349 TGCCCAGCACAGAAATACGGAGG - Intronic
1056786767 9:89598095-89598117 TGCCCAGCTGTGGCACAGTGGGG + Intergenic
1060662227 9:125411149-125411171 TGACCAGCAGAGTCACTGGGGGG - Intergenic
1062175682 9:135161126-135161148 TGTCCAGCTGAAGCACACAGAGG + Intergenic
1191111277 X:56804581-56804603 TGCCCAGCACAGGAACACAGAGG - Intergenic
1194548846 X:95272179-95272201 TACCCTGCAGAGCCACATGGGGG - Intergenic
1199133284 X:144220053-144220075 TGCCCAGCAATGCCACACTGTGG - Intergenic
1200111888 X:153744662-153744684 GGCCCGGGAAAGGCACACGGTGG - Exonic
1200118983 X:153781586-153781608 GTCCCAGCAGAGCCAGACGGTGG - Exonic