ID: 1006294671

View in Genome Browser
Species Human (GRCh38)
Location 6:33164851-33164873
Sequence GCCTAGGGATGACGTCACGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 29
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 24}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006294671_1006294680 26 Left 1006294671 6:33164851-33164873 CCTGCGTGACGTCATCCCTAGGC 0: 1
1: 0
2: 1
3: 3
4: 24
Right 1006294680 6:33164900-33164922 GAAGTTGCAGAAAACTCGGAAGG 0: 1
1: 0
2: 1
3: 12
4: 220
1006294671_1006294679 22 Left 1006294671 6:33164851-33164873 CCTGCGTGACGTCATCCCTAGGC 0: 1
1: 0
2: 1
3: 3
4: 24
Right 1006294679 6:33164896-33164918 CTGTGAAGTTGCAGAAAACTCGG 0: 1
1: 0
2: 2
3: 24
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006294671 Original CRISPR GCCTAGGGATGACGTCACGC AGG (reversed) Exonic
901323724 1:8355158-8355180 GCCTAGGCAGGCAGTCACGCAGG + Intronic
1063777254 10:9277848-9277870 GCCTAGCAATGACCTTACGCTGG - Intergenic
1072780687 10:98249278-98249300 GCCTAGCGATTACATCACTCTGG + Intronic
1080452392 11:32389247-32389269 GCCTTGTGATGACTTCACTCGGG - Intronic
1083721891 11:64607520-64607542 GCCGGGGGCTGAGGTCACGCCGG + Exonic
1089090429 11:115869901-115869923 GCCTGGGGATGACCTCACCCTGG - Intergenic
1089353945 11:117837627-117837649 GCCCAGCGTTGACGTCAGGCAGG - Exonic
1101627706 12:106461814-106461836 GCCTTGTGATGACTTCACCCTGG + Intronic
1132609437 16:807854-807876 GACGAGCGCTGACGTCACGCGGG - Intronic
1149702476 17:58666913-58666935 GCCTATGCATGACGTCACGCCGG - Intronic
1160874282 19:1290046-1290068 ACCTGGGCATGACGTCAGGCAGG + Intronic
1163575831 19:18110312-18110334 GCCTCGGCATGAAGTCCCGCAGG + Intronic
928332206 2:30366431-30366453 GCCCAGGAAAGCCGTCACGCAGG + Intergenic
929869188 2:45743887-45743909 GCCTGGGGATGAGGTCATGCTGG - Intronic
932693451 2:73933433-73933455 GCCTAGAGATGAAGTGGCGCTGG + Intronic
935691147 2:105733430-105733452 CCCTAGGGAGGATGTCAGGCAGG + Intergenic
937909525 2:127068736-127068758 GCCTAGGGTGGACCTCACCCAGG + Intronic
949017840 2:241723491-241723513 GCAGAGGGATGCCGTCACCCAGG + Intronic
1182467497 22:30526258-30526280 GCCTGGGGTTGAGGTCAGGCAGG + Intronic
949414304 3:3799546-3799568 GCCTAGGGATGCCGCCGCCCGGG - Exonic
952432345 3:33235892-33235914 GCCTAGGGATGAAGCTAGGCTGG + Intergenic
967990359 3:195125817-195125839 GCCTAGGACTGTCCTCACGCAGG - Intronic
981005936 4:139875280-139875302 GCCTAGGTATGACATCAGGTAGG - Intronic
1006294671 6:33164851-33164873 GCCTAGGGATGACGTCACGCAGG - Exonic
1011165235 6:84439240-84439262 GCCTAGGGATGAAGTTACTCTGG - Intergenic
1042209764 8:66368497-66368519 GCATAGGGATGACTTCATCCAGG + Intergenic
1056778604 9:89532737-89532759 GCATAGGGATGGAGTCACCCTGG + Intergenic
1062258164 9:135640947-135640969 GCCCAGGGATGATGTCATGGAGG - Intergenic
1186117972 X:6325191-6325213 GCCAAGTGATGAGGTCATGCAGG + Intergenic