ID: 1006295000

View in Genome Browser
Species Human (GRCh38)
Location 6:33166401-33166423
Sequence CCTAACAAGCATAGTCCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 73}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006295000_1006295015 28 Left 1006295000 6:33166401-33166423 CCCTGAGGACTATGCTTGTTAGG 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1006295015 6:33166452-33166474 GCTGTGGGTGGGCAGCAGAGGGG 0: 1
1: 0
2: 9
3: 66
4: 617
1006295000_1006295005 2 Left 1006295000 6:33166401-33166423 CCCTGAGGACTATGCTTGTTAGG 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1006295005 6:33166426-33166448 GGTAGTTCCATGGAAGTCGTTGG 0: 1
1: 0
2: 0
3: 3
4: 54
1006295000_1006295014 27 Left 1006295000 6:33166401-33166423 CCCTGAGGACTATGCTTGTTAGG 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1006295014 6:33166451-33166473 GGCTGTGGGTGGGCAGCAGAGGG 0: 1
1: 1
2: 10
3: 90
4: 708
1006295000_1006295010 13 Left 1006295000 6:33166401-33166423 CCCTGAGGACTATGCTTGTTAGG 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1006295010 6:33166437-33166459 GGAAGTCGTTGGGAGGCTGTGGG 0: 1
1: 0
2: 1
3: 11
4: 211
1006295000_1006295007 6 Left 1006295000 6:33166401-33166423 CCCTGAGGACTATGCTTGTTAGG 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1006295007 6:33166430-33166452 GTTCCATGGAAGTCGTTGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 71
1006295000_1006295013 26 Left 1006295000 6:33166401-33166423 CCCTGAGGACTATGCTTGTTAGG 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1006295013 6:33166450-33166472 AGGCTGTGGGTGGGCAGCAGAGG 0: 1
1: 1
2: 13
3: 101
4: 735
1006295000_1006295012 17 Left 1006295000 6:33166401-33166423 CCCTGAGGACTATGCTTGTTAGG 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1006295012 6:33166441-33166463 GTCGTTGGGAGGCTGTGGGTGGG 0: 1
1: 0
2: 0
3: 31
4: 356
1006295000_1006295006 3 Left 1006295000 6:33166401-33166423 CCCTGAGGACTATGCTTGTTAGG 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1006295006 6:33166427-33166449 GTAGTTCCATGGAAGTCGTTGGG 0: 1
1: 0
2: 0
3: 4
4: 56
1006295000_1006295004 -8 Left 1006295000 6:33166401-33166423 CCCTGAGGACTATGCTTGTTAGG 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1006295004 6:33166416-33166438 TTGTTAGGCTGGTAGTTCCATGG 0: 1
1: 0
2: 0
3: 6
4: 77
1006295000_1006295009 12 Left 1006295000 6:33166401-33166423 CCCTGAGGACTATGCTTGTTAGG 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1006295009 6:33166436-33166458 TGGAAGTCGTTGGGAGGCTGTGG 0: 1
1: 0
2: 2
3: 36
4: 543
1006295000_1006295011 16 Left 1006295000 6:33166401-33166423 CCCTGAGGACTATGCTTGTTAGG 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1006295011 6:33166440-33166462 AGTCGTTGGGAGGCTGTGGGTGG 0: 1
1: 0
2: 1
3: 81
4: 1583

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006295000 Original CRISPR CCTAACAAGCATAGTCCTCA GGG (reversed) Intronic
901596177 1:10386973-10386995 CATCACAAGCATACTCCTCTGGG + Intergenic
909465283 1:75967019-75967041 CCTAAATAGCATAGTCCAAAGGG + Intergenic
916097984 1:161368170-161368192 TCCAACAAGCATAGCTCTCAGGG - Exonic
917798809 1:178552127-178552149 CCCAACACACAGAGTCCTCAGGG + Intergenic
1062764787 10:52902-52924 CACAACAAGTATACTCCTCAAGG + Intergenic
1066571680 10:36780315-36780337 CCTTAGAGGCATAGTACTCAAGG - Intergenic
1070144827 10:73766144-73766166 CCTAACAAGACCAGTCCTGATGG - Exonic
1071561393 10:86649187-86649209 CTTAGCAAGCATAGTCCTGTAGG - Intergenic
1071690568 10:87815390-87815412 CCTAACAAGCTTATTCTTCCGGG - Intronic
1085921579 11:80964069-80964091 CTTAACAAGGCTTGTCCTCAAGG - Intergenic
1087809425 11:102594402-102594424 CCTAACAGGCTTGGTTCTCAGGG + Intronic
1111987725 13:95081583-95081605 CCTTACAAGACTAGACCTCATGG + Intronic
1112187286 13:97139617-97139639 CCTAATAACCATTGTACTCATGG - Intergenic
1118098638 14:62569461-62569483 CTTAAGAAGCAAAGTCATCAAGG + Intergenic
1121726420 14:96155052-96155074 CATACCATTCATAGTCCTCAAGG + Intergenic
1122110316 14:99495905-99495927 CTTAAGAAGCAGAGTCCTAATGG - Intronic
1129876534 15:78979123-78979145 CCCCACAAGCACAGTCCACAGGG + Intronic
1130874598 15:88002430-88002452 CCTAGCAATCTTAGTCATCAGGG - Intronic
1132113674 15:99120427-99120449 CCACACTAGCACAGTCCTCAGGG - Intronic
1137693980 16:50448959-50448981 CCTAACCATCATAGACCTCTCGG + Intergenic
1142032194 16:87844193-87844215 CCTAAGAGGCATCTTCCTCAGGG + Intronic
1153989840 18:10386411-10386433 CCTTACAAGCTCATTCCTCAGGG - Intergenic
1155995441 18:32326377-32326399 CCTAACAAGCATAGGACTCTAGG - Intronic
1156129284 18:33950584-33950606 GTTAAGAAGCATAGTACTCAAGG + Intronic
1156808620 18:41220164-41220186 CAAAGAAAGCATAGTCCTCAAGG + Intergenic
1158058017 18:53304687-53304709 ACTTCCAAGCATAGTCCTGAAGG - Intronic
1163444744 19:17339707-17339729 CCTATCAAGCATGGATCTCAGGG + Intronic
926613251 2:14969205-14969227 CCTAACAAGCATTCACCCCACGG - Intergenic
938040673 2:128073484-128073506 CCTAAGAAGCAGACACCTCAAGG - Intergenic
941740422 2:169029538-169029560 CCTATCAGCCATAGCCCTCAGGG - Intronic
944636183 2:201678251-201678273 CCTAATGAGATTAGTCCTCATGG - Intronic
947011501 2:225571376-225571398 CTGAAGAAGCAGAGTCCTCATGG - Intronic
1182828854 22:33288555-33288577 TCTTACCAGCACAGTCCTCAGGG - Intronic
951659306 3:25044962-25044984 CCTTACAATCAAAGTCCTCCCGG + Intergenic
952850891 3:37728489-37728511 CTTAAAAAGCAGAGTCATCATGG - Intronic
961244286 3:125437825-125437847 CCTAACAGGCACATTCCTCTGGG - Intergenic
966303458 3:178504336-178504358 CCAAACAAGCTCATTCCTCATGG - Intronic
966505223 3:180693079-180693101 CCTAACAACCACACTCCTTAAGG + Intronic
968877253 4:3278366-3278388 ACTATCAAACATAATCCTCAGGG - Intergenic
972177634 4:36427616-36427638 TCTAGCAAGCATTGTCCTCTGGG - Intergenic
976155249 4:82137319-82137341 TCTACAAAGCATAATCCTCAAGG + Intergenic
982922023 4:161287794-161287816 CCTAACAAGCCTTGCCCTCAGGG + Intergenic
984189960 4:176593620-176593642 CCTTACCAGCATATTTCTCAAGG - Intergenic
986322754 5:6646403-6646425 CCTACCAACCAAATTCCTCAAGG - Intronic
988554464 5:32224122-32224144 CATTCCAAGCAGAGTCCTCAGGG + Intergenic
992893604 5:81227692-81227714 GCTCAAAAGCATAGTCCTGAAGG + Exonic
996306537 5:122053791-122053813 TCTAGCAAGCATTGTCCTCCTGG + Intronic
997848259 5:137307785-137307807 CCTTCCAGGCAAAGTCCTCAAGG - Intronic
1004003539 6:11618590-11618612 CCTATCTAGCACAGTCCACAAGG + Intergenic
1004542403 6:16563441-16563463 CCTAACCAGCCTAGACCTCATGG - Intronic
1006295000 6:33166401-33166423 CCTAACAAGCATAGTCCTCAGGG - Intronic
1009436567 6:63625133-63625155 CCTAAAAATCAAAGTCCTCAAGG + Intergenic
1012836554 6:104276765-104276787 CCTAACATCCAGAGTCTTCAAGG + Intergenic
1015635595 6:135271067-135271089 CCTAAAAATCATATTCCTCCTGG - Intergenic
1017348878 6:153416384-153416406 CCTGACCTTCATAGTCCTCATGG - Intergenic
1018698742 6:166410956-166410978 CCTAAAAAGCAAATTCATCATGG + Intronic
1021774636 7:24040665-24040687 CATAACACTCTTAGTCCTCAGGG + Intergenic
1023649170 7:42350787-42350809 TCTAACAAGAAGTGTCCTCATGG - Intergenic
1031331521 7:120471644-120471666 CCTCACAATCACTGTCCTCAGGG + Intronic
1032172000 7:129592641-129592663 CCTAACAAGAGCAGCCCTCAAGG - Intergenic
1034303996 7:150036796-150036818 CCTAACACCCACAGTCCTCCAGG + Intergenic
1034304514 7:150038692-150038714 CCTAACACCCACAGTCCTCCAGG + Intergenic
1038779825 8:30560604-30560626 CCAAATAATAATAGTCCTCAGGG + Intronic
1038864641 8:31426629-31426651 ACTAACAGCCATTGTCCTCATGG + Intergenic
1041185917 8:55300511-55300533 CCTCAGATGCATTGTCCTCATGG + Intronic
1044743890 8:95353967-95353989 CCTATCAAGCCTAGCTCTCAGGG + Intergenic
1045737218 8:105310283-105310305 CCTAAGAAGCAAAATTCTCATGG + Intronic
1046147063 8:110174107-110174129 CTTATTAACCATAGTCCTCATGG - Intergenic
1056240691 9:84643737-84643759 CCTAACAAATACAGACCTCAAGG - Intergenic
1056917337 9:90757138-90757160 CCTAATACCCATAGTCCTCCAGG + Intergenic
1060415531 9:123427095-123427117 CCCAACAAGTTTGGTCCTCAGGG - Intronic
1060440216 9:123631991-123632013 CAAAAGAAGCAAAGTCCTCATGG - Intronic
1062740453 9:138171357-138171379 CACAACAAGTATACTCCTCAAGG - Intergenic
1187582389 X:20621882-20621904 CCTGCCAAGCATAGTTCTTAAGG - Intergenic
1191690496 X:63933644-63933666 CCTGAAAAGCATATTCCCCAGGG - Intergenic
1194340236 X:92698032-92698054 CATCACAAGAATAGTCTTCATGG + Intergenic
1197621353 X:128753475-128753497 ACTAAAAAGCAGAGCCCTCATGG + Intergenic
1200395851 X:155987243-155987265 CCCAACAGGCAGAGCCCTCATGG + Intergenic
1200648606 Y:5814784-5814806 CATCACAAGCATAGTCTTCATGG + Intergenic