ID: 1006295624

View in Genome Browser
Species Human (GRCh38)
Location 6:33168842-33168864
Sequence AGCCGGGGGTATGGCAGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 235}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006295624_1006295633 -1 Left 1006295624 6:33168842-33168864 CCCACCCTGCCATACCCCCGGCT 0: 1
1: 0
2: 1
3: 21
4: 235
Right 1006295633 6:33168864-33168886 TTCCCAATACCCAAGCCCAGCGG 0: 1
1: 0
2: 1
3: 14
4: 172
1006295624_1006295638 10 Left 1006295624 6:33168842-33168864 CCCACCCTGCCATACCCCCGGCT 0: 1
1: 0
2: 1
3: 21
4: 235
Right 1006295638 6:33168875-33168897 CAAGCCCAGCGGCCACACAGAGG 0: 1
1: 0
2: 1
3: 23
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006295624 Original CRISPR AGCCGGGGGTATGGCAGGGT GGG (reversed) Intronic
900565976 1:3332035-3332057 AGCAGGGAGCCTGGCAGGGTGGG - Intronic
900616112 1:3566411-3566433 AGCCAGCGCTAAGGCAGGGTGGG + Intronic
900744679 1:4352932-4352954 AGCTGCAGGTGTGGCAGGGTGGG + Intergenic
902769005 1:18634906-18634928 AGCTGGGGGTCTGGCCAGGTGGG - Intronic
902816487 1:18919318-18919340 AGCAGGGCGTCTGGCAGGTTGGG - Intronic
903661518 1:24981581-24981603 AGCAGGGGGCAGGGCGGGGTGGG - Intergenic
905034127 1:34906322-34906344 AGTGGGGTGTAGGGCAGGGTTGG - Intronic
907259039 1:53202785-53202807 AGCAGGAAGTATGTCAGGGTGGG - Intronic
908842812 1:68295851-68295873 GGATGGGGGTATGGCAGGTTAGG + Intergenic
912806062 1:112758104-112758126 AGCCTGAGGGAGGGCAGGGTGGG - Intergenic
915615464 1:157034327-157034349 AGGCGGGACAATGGCAGGGTAGG + Intronic
915731646 1:158058409-158058431 AGCCTGGGGCAGGGCAGGGAGGG - Intronic
917598531 1:176553237-176553259 AGCGGTGGGTAAGGCAGGGAGGG + Intronic
918120869 1:181539104-181539126 AGCCAGAGGGATGGCAGGGTTGG - Intronic
919854448 1:201695827-201695849 TGCCGGGGTGGTGGCAGGGTGGG - Intronic
920674288 1:208028686-208028708 AGCAGGGGGTGTGGCAGGGAGGG + Intronic
922198525 1:223381283-223381305 AGCCAGGGAGAAGGCAGGGTAGG - Intergenic
922725343 1:227920410-227920432 AGCCGGGGAGGTGGCAGGGATGG + Exonic
923042964 1:230332950-230332972 GGCCGGGGGTGTGGCTGGGTTGG + Exonic
924583890 1:245345226-245345248 AGCTGCGGGTAGGGCAGGGGTGG - Intronic
1063199701 10:3776114-3776136 AGCCAGGTGTGTGGCAGGGCTGG + Exonic
1065679877 10:28218232-28218254 AGTCGGGGGTAGGGCAGCGGTGG + Intronic
1067069207 10:43119938-43119960 GGCCGGGGGTGTGGCATGGCAGG - Intronic
1069911964 10:71765358-71765380 AGAGGAGGGTATGGCAGGGCAGG + Intronic
1071334083 10:84587544-84587566 AGCTGGTGGTATGGCACGTTTGG - Intergenic
1072875910 10:99173069-99173091 AGCCTGGAGTATAGTAGGGTGGG + Intronic
1074098166 10:110331733-110331755 AGCAGGGGGCAGGGCAGGGGAGG - Intergenic
1074204954 10:111275152-111275174 AGCAGGGGCCATGCCAGGGTAGG + Intergenic
1074498049 10:113997180-113997202 AGCTGGGGCTATGGGAGGGCAGG + Intergenic
1074503152 10:114044090-114044112 GGCGGGGGGTGTGGCAGGGCTGG - Exonic
1074755418 10:116620999-116621021 AGCAGGGGATTTGGCAGGGCGGG + Intronic
1076634317 10:131872668-131872690 AGCCTGGGGTCTGGCTGAGTAGG - Intergenic
1076707141 10:132308115-132308137 AGCCGGGGGCGGGGCAGGGGCGG + Intronic
1076830976 10:132994056-132994078 GGCCGCGGCCATGGCAGGGTTGG + Intergenic
1077663157 11:4086798-4086820 AGAAGGGGGTGTGTCAGGGTAGG - Intronic
1077842988 11:5994938-5994960 GGCCGGGGGTCTGGCAGGAATGG - Intergenic
1080004472 11:27391949-27391971 AGCCTGGAGTATGGCAGATTAGG - Intronic
1080643175 11:34169830-34169852 AGCCTGGGGGAGGGCAGGATGGG - Intronic
1083297016 11:61720349-61720371 AGCTGGGGGCATGACAGGGTTGG - Intronic
1085041519 11:73329137-73329159 GGCCTGGGGTCAGGCAGGGTAGG - Intronic
1085384566 11:76149722-76149744 GGCAGGGGATATGGCTGGGTGGG + Intergenic
1089374354 11:117983943-117983965 AGGGCGGGGTATGGCCGGGTGGG + Intergenic
1090362812 11:126185361-126185383 AGCCTGGGGGAAGGCAGGGCTGG - Intergenic
1091558279 12:1592644-1592666 AGCTGGGAGTAGGGTAGGGTAGG + Intronic
1091753744 12:3038648-3038670 GGCCGGGGGTTTAGCAGAGTGGG - Intronic
1092293966 12:7183560-7183582 AGCCGGGGGAATGCTGGGGTAGG - Intergenic
1096634431 12:52949374-52949396 AGCCGGGGGTCTGGCAGGAATGG + Exonic
1097173486 12:57129649-57129671 AGCCTGGGGTAGGGCTGTGTTGG + Intronic
1097493227 12:60296398-60296420 AGCCCTGGGTAGGGCAGGGAAGG - Intergenic
1100712795 12:97275820-97275842 AGACGAGGGAATGGCAGGGTTGG - Intergenic
1101421740 12:104556354-104556376 ATCCTGGAGTTTGGCAGGGTGGG + Intronic
1104860286 12:131919859-131919881 AGCCAGGGCTGTGGCAGGGAGGG + Intronic
1106810151 13:33350720-33350742 AGCCAGGGGGAGGGCAGGGGAGG - Intergenic
1108406165 13:50104556-50104578 AGACATGGGTATGGCAGGATGGG - Intronic
1112000135 13:95202526-95202548 AACAGGTGGTATGGCGGGGTGGG - Intronic
1113542941 13:111123043-111123065 TGCCAGGGGCATGGGAGGGTTGG - Intronic
1113975659 13:114225603-114225625 AGCCGGGGGAGTGGAAGGGGAGG + Intergenic
1115761612 14:36582407-36582429 AGGCGGGGGCAGGGCAGGCTGGG + Exonic
1117376480 14:55122770-55122792 TGCCAGGGCTGTGGCAGGGTGGG - Intergenic
1118309561 14:64682411-64682433 AGCCGTGGGCAGGGCAGGGCTGG + Intergenic
1118692438 14:68352888-68352910 AGGTGGGGGTCTGGCACGGTCGG + Intronic
1119204372 14:72783190-72783212 AGCAAAGGGTAGGGCAGGGTTGG - Intronic
1119423702 14:74522937-74522959 AACAGAGGTTATGGCAGGGTGGG + Intronic
1119753471 14:77097915-77097937 AGCCGGGGGTGGGGCCGGCTTGG - Intergenic
1122353212 14:101109366-101109388 GGCCGGGGGAATGGCAGAGCAGG - Intergenic
1202931113 14_KI270725v1_random:32085-32107 AGGCCAGGGTATGGCAGGGCAGG - Intergenic
1124504443 15:30261232-30261254 AGCCGGGGGCAGAGCAGGATGGG - Intergenic
1124713259 15:32031889-32031911 ACCCTGGAGTGTGGCAGGGTGGG + Intronic
1124739108 15:32277403-32277425 AGCCGGGGGCAGAGCAGGATGGG + Intergenic
1125489286 15:40135023-40135045 AGTGGGGGGTAGGGCAAGGTTGG + Intergenic
1126692215 15:51296369-51296391 AGGTGGGGGCATGACAGGGTTGG + Intronic
1126801887 15:52305476-52305498 AGTGGGGGGTATGTCAGGCTAGG + Intergenic
1128616470 15:69114353-69114375 AGCCTGGGGTGTGGCAGGGAAGG - Intergenic
1132064483 15:98719337-98719359 GGCCAGGGGTAAGGCAGGGGTGG - Intronic
1133284880 16:4686027-4686049 AGCGGGAGGTATGGGAGGGAGGG + Intronic
1136272274 16:29155351-29155373 AGCCGGGGGCATGTGAGGGCTGG + Intergenic
1136344457 16:29665790-29665812 AGCCTGGAGCATGGCTGGGTGGG + Exonic
1139481208 16:67231736-67231758 GCCCAGGGGTATGTCAGGGTTGG + Exonic
1139548344 16:67660208-67660230 AGCCGTGGGGATGGCAGGTTCGG - Exonic
1141480178 16:84301178-84301200 ATCCAGGTGTCTGGCAGGGTTGG - Intronic
1142234025 16:88913017-88913039 GGCAGGGGCTTTGGCAGGGTGGG - Intronic
1142673393 17:1498029-1498051 CGCCGGCGGTATGGGAGTGTCGG + Exonic
1143119972 17:4600361-4600383 AGCCTGGGGGCAGGCAGGGTGGG + Intronic
1143868928 17:9944152-9944174 AGGCAGGGGAATGGCAGGGAAGG - Intronic
1145012695 17:19378707-19378729 AGCCGGGGGCCCGCCAGGGTCGG - Intronic
1145871476 17:28277115-28277137 GGCCGGGGGTCTGGCAGGAATGG - Intergenic
1147203613 17:38821147-38821169 TGCCTTGGGTATGGAAGGGTGGG - Intronic
1147792410 17:43021845-43021867 CGCCGGGGGTGTGGCAGGGCGGG - Intronic
1147936012 17:44011629-44011651 AGAAGGGAGTATGGCAGGGCTGG - Exonic
1150128576 17:62653942-62653964 AGCCAGGGGTGGTGCAGGGTGGG + Intronic
1151955515 17:77378277-77378299 AGTGAGGGGTATGGCAGTGTAGG + Intronic
1152624045 17:81380138-81380160 AGCGGGGGGGATGGGAGAGTGGG - Intergenic
1152636132 17:81431211-81431233 GGCCGAGGGTATGGGAGGGCTGG - Intronic
1152656710 17:81523292-81523314 GGCAGGGGGCAGGGCAGGGTTGG - Intronic
1152857684 17:82675483-82675505 AACTGGGGGTGGGGCAGGGTAGG + Intronic
1153285599 18:3451995-3452017 AGCCGGGTGTCTGCCGGGGTGGG + Exonic
1155229259 18:23757283-23757305 AGCCGGGGGCATGAAGGGGTGGG - Intronic
1156460699 18:37319856-37319878 AGCCCAGGGTGTGGCAGGGTTGG + Intronic
1158343238 18:56488847-56488869 AACCTGGGGCATGGCAGGGACGG - Intergenic
1160291958 18:77603092-77603114 AGCCGGAGGTAGGGCCTGGTGGG - Intergenic
1160503215 18:79412397-79412419 AGCCCGGGGTATTCCAGGCTGGG + Intronic
1160797728 19:953491-953513 AGCCGGGGGAGTGTCAGGGTCGG + Intronic
1160857421 19:1223801-1223823 AGCCGGGAGCATGGCGGGGAGGG - Intronic
1161086535 19:2338106-2338128 AGCTGGGGGCCTGGCAGGGCTGG + Intronic
1161210557 19:3063096-3063118 AGCCGGGAGAATGGCAGGGTAGG + Exonic
1161396078 19:4045606-4045628 AGAAGGGGGTATGGGGGGGTCGG + Exonic
1161564283 19:4991251-4991273 AGATGGGGGTAGGGCAGGGGGGG - Intronic
1163314984 19:16535567-16535589 AGCGGGGGCTGTGGCAGGGGTGG + Exonic
1163489130 19:17606667-17606689 AGGCGCGGGTATCTCAGGGTGGG - Intronic
1163637760 19:18445351-18445373 AGAAGGGGGCATGGGAGGGTGGG + Intronic
1165161321 19:33818507-33818529 AGCCTGGGATGTGGCGGGGTAGG - Intergenic
1165413313 19:35675806-35675828 AGCAGGGGGTCAGGCAGGCTCGG - Intronic
1166802771 19:45468516-45468538 AGCCAAGGCTATGGCCGGGTTGG - Exonic
1168398665 19:56069967-56069989 AGCCAGGTGTAAGGTAGGGTAGG + Intergenic
925224095 2:2167585-2167607 AGCGGGAGGGAAGGCAGGGTGGG - Intronic
926198985 2:10780065-10780087 AGCCAGGGGGACGGCAGGGAGGG - Intronic
926731461 2:16038835-16038857 AGCCCGGCGGGTGGCAGGGTGGG + Intergenic
927180897 2:20446392-20446414 AGCTGGGGGTTGGGAAGGGTAGG + Intergenic
927856963 2:26533929-26533951 AGCCTGGGGGATGACAGGGCAGG - Intronic
928805039 2:35140409-35140431 AGGAGGGGGTTTGGCAGGGTTGG + Intergenic
931225029 2:60322095-60322117 AGCCGGGGGCCTGGGAGAGTGGG + Intergenic
931239861 2:60442415-60442437 AGGTGGGGGTGTTGCAGGGTGGG + Intergenic
931259288 2:60603175-60603197 AGCCAGAGGTGAGGCAGGGTGGG - Intergenic
932773515 2:74514400-74514422 GGCTGGGGGTAGGGCAGGGGCGG - Intronic
933171248 2:79128277-79128299 AGCTGGGGATAGGGTAGGGTGGG + Intergenic
934162833 2:89268572-89268594 AGCAGGGGATAGGGCAGGCTGGG + Intergenic
934204441 2:89913952-89913974 AGCAGGGGATAGGGCAGGCTGGG - Intergenic
934233613 2:90209935-90209957 AGCAGGGGGCAAGGCAGGCTGGG - Intergenic
934268579 2:91521156-91521178 AGCCGGGGGGATGGCTTGGCTGG + Intergenic
934269520 2:91525364-91525386 AGCCGGGGGGATGGCTTGGCTGG + Intergenic
934462057 2:94217754-94217776 AGGCCAGGGTATGGCAGGGCAGG - Intergenic
935563406 2:104581764-104581786 AGCCTGGGGTAAGTCAGGGAGGG + Intergenic
935627192 2:105180987-105181009 AGCCGTGGATATGGCTGGCTTGG - Intergenic
937278922 2:120704117-120704139 GGCCGGGGGTGGGGCAGGGCAGG - Intergenic
941772957 2:169363175-169363197 AGGCGGGGGTAGGGAAGGGAAGG + Intergenic
942460282 2:176163655-176163677 AGGTGGGGGTTTGGCAGGGGAGG - Intronic
942538472 2:176990322-176990344 AGCCGGGGGGTTGGCAGTGGGGG + Intergenic
942541756 2:177022324-177022346 AGCCGGGGGTCTGGGCGGGTGGG - Intergenic
942971423 2:181962256-181962278 GGCCGGGGGTCTGGCAGGAATGG - Intronic
944590565 2:201213548-201213570 AGTGGGGGGTAGGGCAAGGTTGG + Intronic
944855782 2:203765388-203765410 GGCCGGGGGTCTGGCAGGAATGG - Intergenic
946188574 2:217995509-217995531 ACCCGGGGGGAGGGCTGGGTAGG - Intronic
947523477 2:230865250-230865272 AGCCCGGGGTGGAGCAGGGTTGG + Intronic
948421525 2:237863332-237863354 GGCAGGGGGTATGGCAGGCTGGG - Intronic
948430202 2:237913796-237913818 AGCCCGGGCCATGGCTGGGTCGG + Intergenic
1168999890 20:2161201-2161223 TGGCTGGGGTAGGGCAGGGTGGG - Intronic
1169360943 20:4948416-4948438 AGCAGGGGGTATGGTGTGGTGGG - Intronic
1172188531 20:33047733-33047755 AGTCAGGAATATGGCAGGGTCGG + Intergenic
1172483458 20:35285082-35285104 AGCCGGAGGAAGGGCAGGTTTGG + Intergenic
1174574008 20:51524221-51524243 AGCTTGGGGTTTGGCATGGTGGG - Intronic
1175262553 20:57684005-57684027 AGCCGGGGGTGGGGCGTGGTGGG - Intronic
1175339481 20:58219002-58219024 AGCCGGTGGGATGGCAGTGATGG - Intronic
1176195285 20:63834079-63834101 AGACGGGGGGATGCCAGGCTGGG + Intergenic
1176593136 21:8660707-8660729 AGGCCAGGGTATGGCAGGGCAGG - Intergenic
1178090482 21:29157788-29157810 AGCTGGGGGTGAGGCAGGGAAGG + Intronic
1178140414 21:29676609-29676631 AACTGGGGTTCTGGCAGGGTTGG - Intronic
1178293064 21:31386285-31386307 AGCCAGGGGCAGGGCAGGATAGG - Intronic
1178631912 21:34268733-34268755 AGCCGGGGGTGGGGCAGGAGAGG + Intergenic
1179101912 21:38361582-38361604 AGGCGGGAGTGTGGCAGGGGAGG - Intergenic
1180038667 21:45264631-45264653 AGCCGGGGCGAGGGCAGGGACGG + Exonic
1180275982 22:10637834-10637856 AGGCCAGGGTATGGCAGGGCAGG - Intergenic
1180995026 22:19961307-19961329 AGCCGGGGCAGTGCCAGGGTGGG + Intronic
1181052833 22:20245868-20245890 AGCTGGGGCCATGGCAGGGCTGG - Intronic
1181266647 22:21634576-21634598 AGCCAGGGCCATGGCTGGGTGGG + Intronic
1181983283 22:26781679-26781701 GGCTGGGGGTCTGGCAGGCTGGG + Intergenic
1182376038 22:29848831-29848853 AGTCGGGGGGATGGCAGAATGGG + Intergenic
1183115208 22:35686547-35686569 AGCAAGGGGTCTGGCAGGGCCGG - Intergenic
1183366355 22:37409214-37409236 AGCTGGGGGTGGGGCCGGGTAGG - Intronic
1184066715 22:42125615-42125637 AGCCCGGGGTGGGGAAGGGTGGG + Intergenic
1184069183 22:42137767-42137789 AGCCCGGGGTGGGGAAGGGTGGG + Intergenic
1184652002 22:45923760-45923782 AGCGGGAGAGATGGCAGGGTGGG - Intronic
1184795134 22:46727838-46727860 AGCCGCGGGGGTGGCAGGGCCGG - Intronic
1185318034 22:50187140-50187162 AGGAGGGGGCCTGGCAGGGTGGG + Intronic
950528040 3:13536076-13536098 AGCCGGGGTTGGGGCAGGGGTGG + Intergenic
950746398 3:15093367-15093389 TGTCGGGGGTAAGGCAGGGTGGG + Intronic
951579431 3:24146450-24146472 AGGAGGTGGTATGACAGGGTAGG + Intronic
952897529 3:38087848-38087870 AGCCAGGGGTGGGTCAGGGTTGG + Intronic
952923949 3:38307860-38307882 TGGCGGGGGTGTGGCAGCGTGGG + Intronic
953019057 3:39102652-39102674 AGTGTGGGGTATGGCAGGGCAGG - Intronic
953391274 3:42535272-42535294 AGCCAGGGGTGGGGCAGGGCTGG + Intronic
954579028 3:51693083-51693105 AGCCTGGGGTATTGAGGGGTGGG - Intronic
957000381 3:74877186-74877208 AGTCGGGGGGATGCCCGGGTAGG + Intergenic
957593088 3:82225544-82225566 AGCCTGGGGGATGCAAGGGTGGG + Intergenic
961662564 3:128477438-128477460 AGCCTGGGGCTTGGCAGGGTAGG - Intergenic
968500084 4:945830-945852 AGCCGGGGGCAGGACAGGCTGGG - Intronic
968745471 4:2357565-2357587 AGCAGTAGGTATGGGAGGGTGGG + Intronic
968887282 4:3341490-3341512 AGATGGGGGTATGGCGGGGAGGG + Intronic
970628056 4:17911874-17911896 GGCCGGGGGTCTGGCAGGAAAGG + Intronic
972538670 4:40020440-40020462 GGCCGGGGGTCTGGCAGGAATGG + Intergenic
978061631 4:104345964-104345986 AACAGGTGCTATGGCAGGGTGGG - Intergenic
978225745 4:106333012-106333034 AGCAGGGGGTTGGGAAGGGTAGG - Intronic
978749520 4:112231677-112231699 GGCCGGGGGTGTGGCAGCGTTGG + Intergenic
979024342 4:115549096-115549118 GGCTGGGGGTGGGGCAGGGTGGG - Intergenic
979050203 4:115920889-115920911 GGCCGGGGGTCTGGCAGGAGTGG + Intergenic
987912765 5:24170174-24170196 TGCCGAGGGCAGGGCAGGGTGGG + Intronic
991898005 5:71425773-71425795 AGCTGGGGGGATGTCAGAGTAGG + Intergenic
992877950 5:81076383-81076405 AGCTGGGAGCATGGCAGGGAAGG + Intronic
995735527 5:115296474-115296496 AGCCGGGGCTGTGGCAGGGGCGG - Exonic
996629668 5:125612463-125612485 AGCCGTGGGTCTGGTAGGATAGG - Intergenic
996775329 5:127126824-127126846 AGCCAGGGCAAAGGCAGGGTAGG - Intergenic
997714171 5:136029585-136029607 GGCCGGGGGCCTGGCTGGGTTGG - Intronic
1001255977 5:170183887-170183909 AGCCTGGGAAGTGGCAGGGTGGG - Intergenic
1003186865 6:3839745-3839767 AACCTGGGGTATGGGAGGGAGGG - Intergenic
1004397726 6:15260885-15260907 ATCCTGGGGTATGTCAGTGTTGG - Intronic
1006295624 6:33168842-33168864 AGCCGGGGGTATGGCAGGGTGGG - Intronic
1006429272 6:33985128-33985150 AGGTGGGGGTTTGGCATGGTGGG + Intergenic
1007049429 6:38811907-38811929 TACTGGGGGTATGGCAGGTTTGG + Intronic
1007921442 6:45613660-45613682 AGCTGGGGCTATGACAGAGTAGG - Intronic
1008416427 6:51245880-51245902 CTCTGGGGGCATGGCAGGGTGGG + Intergenic
1011169917 6:84493904-84493926 AGCCAGGGGTATGACAGGCCAGG + Intergenic
1011242552 6:85287920-85287942 GGCCGGGGGTCTGGCAGGAATGG + Intergenic
1013013913 6:106144127-106144149 AGCCAGGGGGATGGGAGGGTGGG - Intergenic
1013667383 6:112362504-112362526 GGCCGGGGGTCTGGCAGGAATGG - Intergenic
1022102230 7:27175407-27175429 AGCTGAGGGTATGGGAGGGAGGG - Intronic
1023407900 7:39855295-39855317 TGCCTGGGGTATGGAAGGGCAGG - Intergenic
1025043449 7:55668844-55668866 AGCTGTGGGTATTACAGGGTGGG + Intergenic
1025209611 7:57013263-57013285 GGCCGGGGATCTGGAAGGGTGGG + Intergenic
1025662340 7:63563587-63563609 GGCCGGGGATCTGGAAGGGTGGG - Intergenic
1026845667 7:73697704-73697726 AGCCTGGGAGCTGGCAGGGTGGG + Intronic
1027232839 7:76282281-76282303 AACCGGGGGTAGCTCAGGGTGGG - Intronic
1027239064 7:76315477-76315499 AGCAGAGGGTGTGACAGGGTGGG - Intergenic
1027314760 7:76978667-76978689 AGCTGTGGCTATGGCAGGATGGG + Intergenic
1031072684 7:117179692-117179714 AGCTGGGGGTGTGGGGGGGTAGG + Intronic
1032086828 7:128888829-128888851 AGCAGGGGGAATGGAAGGGCAGG + Intronic
1034474437 7:151274497-151274519 CGCCTGGGGCAGGGCAGGGTTGG + Intronic
1037764392 8:21763406-21763428 AGAGAGGGGAATGGCAGGGTTGG - Intronic
1040478686 8:47803950-47803972 TCCAGGGGGTGTGGCAGGGTGGG + Intronic
1040897672 8:52385658-52385680 AGCAGGAGGTATGGCAGAGTGGG - Intronic
1042301269 8:67285098-67285120 AGGGGGGGGTGGGGCAGGGTGGG + Intronic
1042893729 8:73642724-73642746 GGCCTGGGGAATGTCAGGGTAGG + Intronic
1043400472 8:79879530-79879552 AACTGGGAGTATGGCAGGGTGGG + Intergenic
1044939009 8:97321581-97321603 GGCCTGGGGTATGGAAGGGATGG - Intergenic
1045598637 8:103687661-103687683 AGACTGGGGTATGGGAGGTTAGG - Intronic
1049135420 8:140893620-140893642 GGCTGGGGGTAGGGCAGAGTTGG + Intronic
1049198702 8:141329526-141329548 AGTTGGGGGTAGGGCAGGGCCGG - Intergenic
1049324816 8:142016392-142016414 AGCCTGGGATGTGGCAGGATGGG - Intergenic
1049758008 8:144319337-144319359 ACCCAGGCGTCTGGCAGGGTTGG - Intronic
1049954825 9:682860-682882 AGCCAGGCTCATGGCAGGGTAGG + Intronic
1050832230 9:10028943-10028965 AGCCTAGGAGATGGCAGGGTGGG + Intronic
1053434701 9:38067394-38067416 AGCTGGGGGTGGGGCAGGGCAGG + Intronic
1054254665 9:62800736-62800758 ATCCGTGGGTGTGTCAGGGTGGG - Intergenic
1057891247 9:98871714-98871736 AGCAGTGGGGATGGCAGGGAGGG - Intergenic
1060348554 9:122837745-122837767 GGCCGGGGGTCTGGCAGGAATGG + Intergenic
1060404249 9:123365427-123365449 AGGCGGGGTTATTGGAGGGTTGG - Intronic
1062119397 9:134826105-134826127 AGCCCGGGGTCAGGAAGGGTTGG + Intronic
1203376352 Un_KI270442v1:381038-381060 AGCCGGGGGAAGGGGCGGGTAGG + Intergenic
1203623179 Un_KI270749v1:139514-139536 AGGCCAGGGTATGGCAGGGCAGG - Intergenic
1189928586 X:45983562-45983584 GGCCGGGGGTCTGGCAGGAATGG + Intergenic
1192101773 X:68271957-68271979 AGGCGGGGTTGGGGCAGGGTGGG - Intronic
1192427765 X:71092557-71092579 AGACAGGGAAATGGCAGGGTGGG - Intergenic
1193775178 X:85632451-85632473 AGCCTGAGATATGGCAGGGGAGG - Intergenic
1195174909 X:102305848-102305870 TGCCGGGGGTGCGGGAGGGTGGG + Intergenic
1195183956 X:102381245-102381267 TGCCGGGGGTGCGGGAGGGTGGG - Intronic
1195923636 X:110004437-110004459 AGCCCAGGGCACGGCAGGGTTGG - Intronic
1200085929 X:153605127-153605149 GGCCGGGGGTCTGGCAGGAATGG - Intergenic
1200099781 X:153684816-153684838 AGCTGGGGGGAGGGCAGGGGAGG - Intronic
1200299449 X:154957971-154957993 AGCTGGGGGTGAGGGAGGGTAGG + Intronic
1200883123 Y:8241213-8241235 GGATGGGGGTATGGCAGGGGAGG + Intergenic