ID: 1006296907

View in Genome Browser
Species Human (GRCh38)
Location 6:33173804-33173826
Sequence TCAGGATGTTGAGGGAGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 418
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 377}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006296901_1006296907 -7 Left 1006296901 6:33173788-33173810 CCAGCTGTCCCCGAGGTCAGGAT 0: 1
1: 0
2: 1
3: 24
4: 138
Right 1006296907 6:33173804-33173826 TCAGGATGTTGAGGGAGAGCTGG 0: 1
1: 0
2: 3
3: 37
4: 377

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006296907 Original CRISPR TCAGGATGTTGAGGGAGAGC TGG Intronic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
902901051 1:19516408-19516430 TCAGGAAGGTGAGGGAAAGCAGG + Intergenic
903216070 1:21843997-21844019 TCAGGAAGTTGAGAGCGGGCTGG - Intronic
903341568 1:22658251-22658273 TTAGGATGTTGAGGATCAGCAGG - Intronic
903936117 1:26896202-26896224 TCAGGAAATAGAGGTAGAGCTGG - Intronic
904789772 1:33010712-33010734 TGAGGATGGTGAGGGAGGGCTGG - Intronic
904883283 1:33716521-33716543 TCAGGTTGTTGATGGCGAGATGG + Intronic
904960974 1:34332553-34332575 TCAGGAGATGGAGAGAGAGCAGG - Intergenic
904969894 1:34411266-34411288 TCAGGATGATTTGGGGGAGCAGG - Intergenic
905485784 1:38295350-38295372 TCAAAATGTGGAGGGAGGGCAGG - Intergenic
905548834 1:38819714-38819736 GCAGGGAGTTGTGGGAGAGCTGG - Intergenic
905988127 1:42306662-42306684 TCTGGATAGTGAGGGATAGCAGG - Intronic
906559481 1:46745788-46745810 TCTGCATGTTGCGGGAGAGACGG - Intergenic
906696083 1:47824342-47824364 GCAGGCTGTTGAGGGGGCGCTGG - Intronic
907178879 1:52552984-52553006 GCAGGAGGCGGAGGGAGAGCAGG - Intronic
907828296 1:58039394-58039416 TCAGGAGGTAGAGGGAAGGCAGG - Intronic
907869825 1:58432948-58432970 ACAGGATGCTGAGGCAAAGCTGG - Intronic
907890293 1:58630724-58630746 TGAGGATGGTGAGGGAGGGCTGG - Intergenic
910676742 1:89822315-89822337 TCAGGATGTAGGCGGAGAGATGG + Intronic
911417332 1:97591128-97591150 TGAGGAAGTTGAGGGAAAGTAGG - Intronic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
912686832 1:111774591-111774613 TCAGCATCTTCAGGGAGATCAGG + Intronic
912849630 1:113111471-113111493 TCAGAATGGAGAGGGTGAGCGGG - Intronic
915633683 1:157171796-157171818 TCAGGATGGGGAGAGAGGGCTGG + Intergenic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
915936387 1:160092483-160092505 CCAGGATGGTGTGGCAGAGCTGG - Exonic
919995119 1:202740673-202740695 TCAGGATGTAGAGGGCCTGCAGG - Exonic
920252875 1:204633756-204633778 TGAGGAAGTGGAAGGAGAGCTGG - Intronic
920398555 1:205663166-205663188 TGAGGAAGATGAGGGTGAGCAGG + Exonic
921173694 1:212572408-212572430 TCAGGAGGCTGAGGCAGAGAAGG + Intronic
921673444 1:217951349-217951371 TATGGATGTTGAGTCAGAGCAGG + Intergenic
923518666 1:234719410-234719432 TGAGAATGTGGAGGGAGAGGAGG + Intergenic
924813199 1:247421188-247421210 GCAGGATGATGATGTAGAGCTGG + Intronic
924908790 1:248486322-248486344 TCAGTAAATTGAGGGGGAGCAGG - Intergenic
924915317 1:248561740-248561762 TCAGTAAATTGAGGGGGAGCAGG + Intergenic
1063512079 10:6655444-6655466 ACAGAAGGTAGAGGGAGAGCTGG - Intergenic
1065608052 10:27441533-27441555 TCAGGATGTGGAGGTTGACCAGG + Intergenic
1065948859 10:30633252-30633274 CCAGGATGTTGAGGGATACCAGG + Intergenic
1067697937 10:48548888-48548910 TCAGCAGGCTGAGGAAGAGCAGG + Intronic
1068701614 10:60025729-60025751 TGAGGATGTTGGGGGAAATCAGG + Intergenic
1069779133 10:70943871-70943893 TCAGGAGGTAGAGGCAAAGCTGG + Intergenic
1069791650 10:71026505-71026527 TCTGGCTGTGGAGGGAGAGATGG - Intergenic
1069792142 10:71029729-71029751 TCAGCATGGAGAGGGTGAGCTGG - Intergenic
1070939308 10:80329292-80329314 TGAGGAAGTTGAGGCAGAGCAGG + Intergenic
1071024864 10:81100305-81100327 TCAGGATGTTGAGCGGGAAGAGG - Intergenic
1071598918 10:86946817-86946839 TCAGGATCCCCAGGGAGAGCGGG + Intronic
1073851080 10:107619060-107619082 TCAGGAGGAAGAGAGAGAGCTGG + Intergenic
1076734292 10:132451872-132451894 TCAGGATGTTCAGGGCCAGAGGG + Intergenic
1076929972 10:133525687-133525709 TCAGGGTGGAGAGGCAGAGCAGG - Intronic
1079494741 11:21029456-21029478 ACAGGATTGTGAGGGAGAGGAGG - Intronic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1082775118 11:57238591-57238613 TCAGGAAGTTGAGCTAGAGGAGG + Intergenic
1083078002 11:60061466-60061488 TGAGGAAGAAGAGGGAGAGCAGG - Intronic
1083895980 11:65619968-65619990 TCAGGCTGTTGGGGGAAGGCGGG - Intronic
1084670401 11:70603425-70603447 TCAGGATGTGGAGGGACACTGGG - Intronic
1085779806 11:79397739-79397761 TCAGAATTTTTAGGGAGGGCTGG + Intronic
1085779874 11:79398384-79398406 TCAGGGTCCTGAGAGAGAGCTGG + Intronic
1085885500 11:80517321-80517343 GCAGGAGGAAGAGGGAGAGCCGG - Intergenic
1087586704 11:100130997-100131019 TCAAGATGGTAACGGAGAGCAGG + Intronic
1088261811 11:107951168-107951190 TCAGGATCTTAAGTGAGGGCAGG + Intronic
1088637205 11:111833936-111833958 TAATGATGTTGAGAGAAAGCTGG - Intronic
1088728022 11:112656549-112656571 TCAGAATCTTCAAGGAGAGCAGG - Intergenic
1088831894 11:113543998-113544020 TCAGGAGGCAGAGGGAGAGCTGG + Intergenic
1088939502 11:114439379-114439401 CCAGGCTGTTGAGGGCGAGCCGG + Exonic
1089320707 11:117624977-117624999 ACAGTATGTTGCGGGAGACCAGG - Intronic
1089462394 11:118660836-118660858 GCAGGAGGGTGAGGGAGGGCTGG - Intronic
1090764514 11:129865097-129865119 TGAGGCTGTGGAGGGAAAGCAGG + Exonic
1090774423 11:129950573-129950595 TGAGGAGGTTGAGGGGGAGGTGG - Intronic
1091081202 11:132670000-132670022 TCAGGATGTGGAGGAAGGGAGGG - Intronic
1091635628 12:2194382-2194404 TCAGGAAGAGGAGGGGGAGCAGG - Intronic
1093242638 12:16697135-16697157 TCAGCAAGTTGAGCGATAGCTGG - Intergenic
1095321429 12:40832959-40832981 TCAGGAGGCAGAGGGAGAGAGGG - Intronic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1096242099 12:49965048-49965070 TCAGGGAGTTGGGGAAGAGCAGG - Exonic
1096690272 12:53316341-53316363 TCAGGAGGCTGAGGCAGGGCAGG + Intronic
1096827412 12:54290466-54290488 TCAGGAGGCTGAGGCAGAGAAGG + Intergenic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097152211 12:56987382-56987404 TCAGGGTGTTGATGGACAGGAGG + Intergenic
1098131478 12:67355114-67355136 TCAGGATGTTTGGGCAGAGGAGG + Intergenic
1098213305 12:68188533-68188555 GCAGGAGGTTGAGGGAGCGATGG + Intergenic
1098753115 12:74321565-74321587 ACAGGAAGTGGAGGCAGAGCTGG - Intergenic
1099469054 12:83023858-83023880 TTAGGATGTTTAGGAAGAGAGGG + Intronic
1101877773 12:108606971-108606993 CAAGGAAGTGGAGGGAGAGCAGG - Intergenic
1102471675 12:113163041-113163063 TCAGGCTGCAGAGGGAGAGTGGG + Exonic
1102547951 12:113670230-113670252 CCAAGATGTTGCGGGAGAGAAGG + Intergenic
1102567880 12:113808909-113808931 TCAGGGTGTGGAGGGAGAGGAGG + Intergenic
1102650638 12:114439877-114439899 TAGGGAAGTTCAGGGAGAGCTGG - Intergenic
1105686882 13:22792913-22792935 TCGGGATGTGGAGGGAGAAAGGG + Intergenic
1107004518 13:35593217-35593239 TCAAGATGTGGAGGCAGATCAGG - Intronic
1107614128 13:42146995-42147017 TCAGGATGTTCAGGGAAACCAGG + Intronic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1108337790 13:49463826-49463848 TCTCTATGTTGAGGGAGTGCTGG + Intronic
1108743787 13:53368387-53368409 TCAGGATGTAGAGGGAGGGGAGG - Intergenic
1109487402 13:63045043-63045065 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1111855073 13:93626969-93626991 TCAGGATGAAGAGAGAGAGAGGG + Intronic
1112157465 13:96833218-96833240 TCAGGAGGGGGAGGGTGAGCAGG + Exonic
1113616024 13:111681210-111681232 TCAGCATGTTGAGGAGGTGCAGG - Intergenic
1113621492 13:111766103-111766125 TCAGCATGTTGAGGAGGTGCAGG - Intergenic
1113740958 13:112712129-112712151 TCAGGGTGGGGAGGGAGAACGGG - Intronic
1115645302 14:35365208-35365230 GAGGGATGTGGAGGGAGAGCCGG + Intergenic
1115851125 14:37591568-37591590 TGAGGTTGTTGATGGAGAACGGG + Exonic
1117676748 14:58163244-58163266 TCAGGATGGTGGGGAAGAGGCGG - Intronic
1117683447 14:58228783-58228805 TCAGGAGGCTGAGGCAGAGCAGG - Intronic
1119224932 14:72937785-72937807 GAAGGATGTTGGGGGAGTGCTGG + Intronic
1119672488 14:76530151-76530173 ACAGGATGTTCAGGGAAAGGCGG - Intergenic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1121804539 14:96805201-96805223 TCAGGATTTTGAAGAACAGCTGG - Intronic
1122022657 14:98851899-98851921 GCTGGATGTTCAGGGAGAGGAGG - Intergenic
1122647539 14:103205378-103205400 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1122775012 14:104113243-104113265 TCAGGAGCTTCAGGCAGAGCAGG - Exonic
1123028480 14:105439613-105439635 TAAGGGTGTTGAGGGAGGGCAGG + Intronic
1123218635 14:106836579-106836601 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1123668399 15:22628651-22628673 TCAGAATGAGGAGGGAGAGATGG - Intergenic
1124524378 15:30435112-30435134 TCAGAATGAGGAGGGAGAGATGG - Intergenic
1124534287 15:30531111-30531133 TCAGAATGAGGAGGGAGAGATGG + Intergenic
1124764361 15:32476500-32476522 TCAGAATGAGGAGGGAGAGATGG - Intergenic
1124774273 15:32572598-32572620 TCAGAATGAGGAGGGAGAGATGG + Intergenic
1126851000 15:52796686-52796708 TCAGGTGGTTGATGGAGACCAGG - Intergenic
1127840486 15:62827278-62827300 TAAGGACGTTGAGGAGGAGCGGG + Intronic
1127873103 15:63089562-63089584 GCAGGATGTGGAGTGAGAGAGGG + Intergenic
1128600568 15:68992161-68992183 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1129886683 15:79042992-79043014 TCAGGATGGGAAGGAAGAGCTGG - Intronic
1130192821 15:81752573-81752595 TCAGGGCGTGGAGGGAGGGCAGG - Intergenic
1130207167 15:81887866-81887888 AGAGGATATTGAGGGAGAGAGGG - Intergenic
1130412989 15:83662900-83662922 GCAGAGGGTTGAGGGAGAGCTGG - Intronic
1132902191 16:2263203-2263225 GCTGGATGCTGAGGAAGAGCTGG + Exonic
1134544229 16:15095247-15095269 GGAGGATGTAGAGGGAGAGCAGG + Intronic
1134895854 16:17886269-17886291 GTAGGATGTAGAGGGAGAGAAGG - Intergenic
1135361792 16:21821418-21821440 GGAGGATGTAGAGGGAGAGCCGG + Intergenic
1135615820 16:23910086-23910108 TCAGCATGTTCAGGGTGTGCTGG - Intronic
1136070045 16:27782244-27782266 TCAGCATGTGGAGGGAAAGGAGG - Intergenic
1136185994 16:28589356-28589378 TCTGGCTGCTGAGGGAGAACTGG - Intronic
1136260858 16:29074765-29074787 GGAGGATGTAGAGGGAGAGCAGG - Intergenic
1139486538 16:67259964-67259986 TCAGGATTTTGAGGGGGTGGAGG + Intronic
1139672417 16:68500771-68500793 TCAGGAGGTTGAGGTTGAGGTGG + Intergenic
1140822765 16:78678707-78678729 TCAAGATTTTGACGGAGGGCTGG + Intronic
1141339784 16:83192496-83192518 AGAGCATGTGGAGGGAGAGCTGG - Intronic
1141441444 16:84032089-84032111 TGAGGATGGTGAGGCAGAGGTGG - Intronic
1142222685 16:88863472-88863494 TCTGGGTGTTGAGGGAGGGGAGG - Exonic
1143168272 17:4910131-4910153 TGAGGATTTTCAGGGAGGGCAGG + Intergenic
1143515440 17:7417346-7417368 CCAGGATGTTGAGGAAGAGGAGG - Exonic
1143785558 17:9252999-9253021 TCATCATGATGATGGAGAGCAGG - Intronic
1144131462 17:12250979-12251001 TCAGGAGGCAGAGGGAGAGGGGG + Intergenic
1145074703 17:19842651-19842673 GCAGGATGTTGGGGGAGAGGAGG + Intronic
1145092785 17:19999690-19999712 TCAGGAGGATGAGGAAGAACCGG + Intergenic
1145312415 17:21707877-21707899 TCAGGAGCAGGAGGGAGAGCAGG - Intergenic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1145361109 17:22213165-22213187 TCCCAATGTTGAGGGAGTGCTGG - Intergenic
1145970892 17:28955861-28955883 ACAGGAGGTGGAGGGACAGCAGG + Exonic
1146165375 17:30584236-30584258 TCAGGAGGATGAGGAAGAACCGG + Intergenic
1146207213 17:30915171-30915193 TCAGGGGGATGAGGGTGAGCTGG + Intronic
1148419351 17:47531955-47531977 TCAGGTGGTTGAGGCAGAGCGGG - Intronic
1148718405 17:49732496-49732518 TAAGGATGGGGCGGGAGAGCTGG - Intronic
1148745588 17:49916235-49916257 TCAGGCTGCTGTGGGAGGGCAGG + Intergenic
1148764896 17:50032331-50032353 TCAGGAGGCTGAGGTAGAGGTGG - Intergenic
1148821179 17:50360526-50360548 ACAGGAAGGTGAGGAAGAGCTGG - Exonic
1149869444 17:60168824-60168846 TCAGTACTTTGAGGGAGAGTGGG + Intronic
1151935314 17:77257548-77257570 TCAGGATGTGGAGGTGGAGGAGG - Intergenic
1152030720 17:77841123-77841145 TGAAGATGTTCAGGGAGAGTTGG - Intergenic
1152042724 17:77915008-77915030 TCAGGATGGTGAGGGGGAGTGGG - Intergenic
1152106802 17:78334952-78334974 CCAGGATGGGGAGGGCGAGCTGG - Intergenic
1152783632 17:82237160-82237182 TCAGCATGATGAGCGAGGGCTGG - Exonic
1153901491 18:9621213-9621235 TCAGGATATTGAGTGAGAAACGG - Intergenic
1153965952 18:10182210-10182232 TCAGGATAGTGGGGGAAAGCCGG + Intergenic
1155438058 18:25833635-25833657 TCAGGACGCTGAGGGAGGGCTGG - Intergenic
1155638587 18:27985003-27985025 GCAGGATGATGATGCAGAGCAGG + Exonic
1155732701 18:29180717-29180739 TCCGTATGTTGAGGGAATGCTGG + Intergenic
1156284397 18:35676628-35676650 TGAGGAGCTTGAGAGAGAGCAGG + Intronic
1156386017 18:36606051-36606073 TTAGGGTGTTCAGGGAAAGCAGG + Intronic
1156743895 18:40366127-40366149 TCAGGGAGGTGAGGGAGAGATGG + Intergenic
1158140841 18:54253725-54253747 TCAGGAGGCTGAGGCAGGGCAGG + Intergenic
1158497407 18:57968927-57968949 TCCGGAAGTTGAGGGGAAGCTGG - Intergenic
1159996826 18:74972414-74972436 ACAGGAAGCTGAGGGAGAGGAGG - Intronic
1160313659 18:77820959-77820981 ACAGGCTGTGCAGGGAGAGCCGG + Intergenic
1161679372 19:5671991-5672013 TGAGGATGGTGGGGAAGAGCAGG - Intergenic
1162348586 19:10135750-10135772 CCAGGATGTTGCCGAAGAGCCGG + Exonic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1163402622 19:17103379-17103401 TCAGGAGGCTGAGGGAGAGAGGG + Intronic
1163681575 19:18685317-18685339 TCAGGATGTAGAGAAAGAGATGG + Intronic
1163883214 19:19945219-19945241 TCATGATGTTGACGGGGAGGGGG - Intergenic
1163916817 19:20247309-20247331 TCAGGTTCTTGAGGGAGAAAGGG - Intergenic
1164385065 19:27765173-27765195 TTAGAATGTTCAGGGACAGCTGG + Intergenic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1165638722 19:37365635-37365657 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1165712034 19:38018536-38018558 ACATGATGTTGAGTGAAAGCCGG - Intronic
1165790493 19:38488813-38488835 TCATTATGTTGACTGAGAGCTGG + Intronic
1166074426 19:40405440-40405462 CCAGGACTTGGAGGGAGAGCAGG + Intronic
1167385541 19:49160909-49160931 TGAGGGTGATGAGGGAGAGAGGG + Intronic
1167496281 19:49820597-49820619 TCTCTATGTTGAGGGAGTGCTGG + Intronic
925562470 2:5211656-5211678 ACAGGATGTTGTCTGAGAGCAGG - Intergenic
926108838 2:10169537-10169559 CCAGGACGGTGAGGGTGAGCTGG + Intronic
926175638 2:10589272-10589294 TCAGGAAGAGGAGGAAGAGCCGG - Exonic
926296735 2:11574419-11574441 GCAGGATGTTGAGTGAGGGCTGG + Intronic
926999230 2:18775015-18775037 CCATGATGCTAAGGGAGAGCTGG + Intergenic
927132717 2:20073982-20074004 TCCCTATGTTGAGGGAGGGCTGG - Intergenic
927199667 2:20570559-20570581 TCAGGATGGTGGGAGAGAGATGG + Intronic
928049711 2:27978277-27978299 GCAGGAGGTGAAGGGAGAGCAGG - Intronic
928951655 2:36818635-36818657 CTAGGATGGTGAGAGAGAGCAGG + Intergenic
929819677 2:45262967-45262989 TCAGGAAGATGAGGCAGAGTGGG - Intergenic
929938938 2:46315718-46315740 GCAGGATGTAGAGGGAGGGCAGG + Intronic
930997086 2:57733015-57733037 TGAGGGTGACGAGGGAGAGCTGG + Intergenic
932411241 2:71549261-71549283 ACAGGCTGTGGATGGAGAGCTGG - Intronic
933358051 2:81239753-81239775 TGAGGTTGTTGAGGGAGTGGAGG - Intergenic
933668234 2:84982325-84982347 TAAGGATGTTGAAGTAGAGCAGG + Intronic
933839579 2:86275682-86275704 TCAGGAGGCTGACGGAGAGTGGG - Intronic
935050465 2:99520995-99521017 TCAAGATGCTGAAGCAGAGCAGG + Intergenic
935152363 2:100449496-100449518 TCAGGATGTCATGGGTGAGCAGG - Intergenic
935337994 2:102034757-102034779 TCAGGAGGCTGAGGGAGTGAGGG + Intergenic
936633930 2:114234317-114234339 TCAGGGAAGTGAGGGAGAGCTGG + Intergenic
937594081 2:123652009-123652031 TCAGCATGGTGAGGGGCAGCAGG + Intergenic
938151992 2:128895058-128895080 TGAGGATGTGGAGGGAGGGAAGG + Intergenic
938308310 2:130268984-130269006 TCAGGTGGTTGAGGGAGAGCTGG - Intergenic
938370907 2:130767881-130767903 TCTGGAGCTTGAGGAAGAGCAGG - Exonic
938447019 2:131387852-131387874 TCAGGTGGTTGAGGGAGAGCTGG + Intergenic
939067865 2:137505806-137505828 TCAGGAAGCAGAGGGAGTGCAGG + Intronic
940263638 2:151813055-151813077 TCACGGAGTTGAGGAAGAGCTGG - Intronic
943616119 2:190094787-190094809 TAAGGATGATAAGGGAGAGGTGG + Intronic
943890032 2:193275328-193275350 AGAGGGTGTGGAGGGAGAGCTGG - Intergenic
945198422 2:207258477-207258499 TCAGGATGCTGGGGGAGAAGAGG - Intergenic
947312680 2:228821385-228821407 TCAGCTTGTTGAGGGAGACAAGG - Intergenic
947339731 2:229125438-229125460 TAAGTATGTTGAGGAAGAACAGG - Intronic
947889243 2:233602486-233602508 TCAGAATGTGGAAGCAGAGCAGG + Intergenic
948402666 2:237694858-237694880 TCAGTATGTGGAAAGAGAGCGGG - Intronic
948657674 2:239486855-239486877 ACAGGTTTTTGAGGGAGGGCAGG - Intergenic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
948781681 2:240325360-240325382 TCAGGATGCTGCCGGAGTGCTGG - Intergenic
1168989428 20:2081421-2081443 TGAGGAGGTGGAGGGAAAGCAGG - Intergenic
1171123013 20:22582080-22582102 TGAGGTTGTTGATGGAGAACGGG + Exonic
1171210997 20:23316829-23316851 TTTGGATGTTGAGGCAGGGCTGG + Intergenic
1171258381 20:23709672-23709694 TAGGGATGCTGAGGGTGAGCAGG - Intergenic
1171275614 20:23854706-23854728 TAGGGATGCTGAGGGTGAGCAGG - Intergenic
1172312240 20:33927657-33927679 TGAGCAAGTTGAGGCAGAGCGGG + Intergenic
1173503632 20:43570703-43570725 AAATGATGTTGAGGGAGTGCAGG - Exonic
1174197929 20:48786388-48786410 TCAGGGAGAGGAGGGAGAGCAGG + Intronic
1174249966 20:49211801-49211823 TCAGGAGGCTGAGGCAGAGTGGG - Intergenic
1174259309 20:49282231-49282253 TCAGGAGGCTGAAGGAGAGTAGG - Intergenic
1175039414 20:56032861-56032883 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1175598236 20:60252662-60252684 TCAGGCAGTGGAAGGAGAGCTGG + Intergenic
1176182707 20:63758410-63758432 TCAGGAGGCAGAGGGAGAGGGGG - Intronic
1176725994 21:10432868-10432890 CCAGGCTGTTGAAGGAGAGAGGG + Intergenic
1178149033 21:29773020-29773042 TGGTGATGTTGAGGGAGAGGAGG + Intronic
1178415712 21:32403439-32403461 TCAGAAGGGTGAGGGAGAGGTGG - Intergenic
1178777402 21:35565378-35565400 TCAGGAGGCTGAGGGAGTGAGGG + Intronic
1179134144 21:38664734-38664756 TGAGGGTGGTGAGGGAGAGAGGG - Intergenic
1179443310 21:41411230-41411252 CCAGGAAGGTGAGGGAAAGCTGG - Intergenic
1179629113 21:42665883-42665905 TCAGGAGCTTGAGGGATAGACGG - Intronic
1179656341 21:42847476-42847498 GCAGGATGCTGAGGAATAGCAGG + Intronic
1179904255 21:44414024-44414046 GCAGGATGTTGGTGAAGAGCAGG - Exonic
1180288380 22:10774245-10774267 CCAGGCTGTTGAAGGAGAGAGGG - Intergenic
1180748031 22:18105115-18105137 TCATGATGTTGAGGGAGGCTGGG - Exonic
1181376167 22:22459896-22459918 TCAGGAGGGTGAGGAAGAGAGGG - Intergenic
1181580885 22:23827469-23827491 TCAGGATTTAGAGGCAGAGGCGG + Intronic
1181670887 22:24425008-24425030 TCAGGATGGCGACGGAGGGCTGG - Intronic
1182422873 22:30257121-30257143 TGAGGATGTTGAGGCTAAGCAGG - Intergenic
1182725363 22:32441078-32441100 GCAGGGGGTTGGGGGAGAGCAGG - Intronic
1183404460 22:37623666-37623688 GCAGGAGGTGGAGGGAGAGGGGG - Intronic
1183748798 22:39707443-39707465 CCAGGATGCTCAGTGAGAGCCGG + Intergenic
1184195091 22:42922311-42922333 TAAGGGTGTTAAGGGGGAGCTGG - Intronic
1184285223 22:43466854-43466876 TCAGGAGGTGGAGGGTGAGGGGG - Intronic
1184387494 22:44184546-44184568 TCAGGAGTTTGAGGCCGAGCTGG - Intronic
949650892 3:6157856-6157878 TTAAGATGTAGAAGGAGAGCAGG - Intergenic
950200028 3:11036191-11036213 ACAGGGTGTTTAGGGAGTGCCGG + Intronic
950481603 3:13247732-13247754 TCTGGATCTGGAGGGAGGGCCGG + Intergenic
950776847 3:15357476-15357498 GCAGGATGTTGATGGAGTGGAGG - Intergenic
951426057 3:22546071-22546093 TCAGGAGGTTGAGGCAGAATAGG + Intergenic
952194868 3:31064737-31064759 TCAGGGGGTTGAGGGATAGAGGG + Intergenic
952866050 3:37855803-37855825 TCAGGATGTTGAGGAAGCATGGG + Intergenic
953071846 3:39528422-39528444 TCTAGATGTTGAGAGAAAGCAGG + Intronic
953833774 3:46325813-46325835 GCAGAAGGTTAAGGGAGAGCTGG + Intergenic
954071042 3:48142979-48143001 TCAGGAAGGAGAGGGAAAGCAGG + Intergenic
954417940 3:50403199-50403221 TGAGGATGTGGATGGAGAGCAGG + Intronic
954682972 3:52355821-52355843 GAAGGATGGTGAGGGAGAGTCGG - Intronic
955049989 3:55401004-55401026 TCAGGATATTCAGGGACTGCTGG - Intergenic
956109256 3:65854451-65854473 TCAGGATTTTCATGGAGAGATGG - Intronic
958543247 3:95508175-95508197 TCAGGAGGCTGAGGCAGGGCAGG + Intergenic
959195110 3:103170374-103170396 TCAAGATGTGGAGGAAGAGAAGG + Intergenic
959913843 3:111794312-111794334 TCTGCATGTTGGGGGAGAGAGGG - Intronic
960380241 3:116951355-116951377 TCAGGAGGTCGAGGGAAAGATGG - Intronic
961108532 3:124263252-124263274 TCAGGATGTTGAGGGACGATGGG - Intronic
961467771 3:127091953-127091975 TCATGATTATGAGAGAGAGCTGG + Intergenic
961503529 3:127355013-127355035 TCAGGGTGTAGGGGGAGAGAGGG - Intergenic
962326826 3:134441385-134441407 TCTGGATATTAATGGAGAGCAGG - Intergenic
964619412 3:158706270-158706292 TCAGAAAGCTGAGGGACAGCAGG + Intronic
965719951 3:171650528-171650550 ACGGGATGTGGAGGGAGAGGAGG + Intronic
967090832 3:186133466-186133488 ACATCATGATGAGGGAGAGCTGG + Intronic
968070090 3:195779355-195779377 TCTGGATGCTGAGGAAGGGCTGG + Exonic
968071020 3:195784443-195784465 TGAGGATGCTGAGGAAGAGCTGG + Exonic
968071152 3:195785163-195785185 TGTGGATGTTGAGGAAGGGCTGG + Exonic
968970639 4:3791764-3791786 GCAGGATGTTTTGGGGGAGCAGG - Intergenic
969297326 4:6277716-6277738 TGGGGATGTTCAGGGATAGCTGG + Intronic
969591331 4:8123442-8123464 TCAGGAATTTGAGGGGGAGACGG - Intronic
969857922 4:10014890-10014912 TCAGGACCTTTAGGCAGAGCAGG + Intronic
971278853 4:25224407-25224429 TCCTTATGTTGAGGGAGTGCTGG + Intronic
973105898 4:46336691-46336713 TCAGGATGGTGAAAGAGAACAGG + Intronic
973223172 4:47752065-47752087 TCCGGGAGGTGAGGGAGAGCCGG - Intronic
974803937 4:66856167-66856189 TCAGTTTCTTGAGGGTGAGCTGG - Intergenic
975126553 4:70788802-70788824 GCAGGATGTTGAGAAAGAACTGG + Exonic
975699342 4:77047857-77047879 TCAGGATGCTGAGGGGGAACAGG + Exonic
976073744 4:81272943-81272965 TCAGGATTTTGAGTGTTAGCAGG - Intergenic
976662872 4:87558473-87558495 TAAGGATGAGGATGGAGAGCGGG + Intergenic
978533346 4:109736183-109736205 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
981827477 4:148960234-148960256 TCAGAAATTTGAGGCAGAGCTGG - Intergenic
982717860 4:158827694-158827716 TTAGCGTGTTGAGGGAGTGCTGG + Intronic
982819281 4:159926446-159926468 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
984742519 4:183179555-183179577 ACAGGATGTTGACGGAGAGGGGG + Intronic
986256117 5:6102142-6102164 TCGGGATGGTGAGGGAGGGAAGG + Intergenic
986346452 5:6839797-6839819 TCAGGATGCTGTGTGAGGGCAGG + Intergenic
987824302 5:23008579-23008601 TAATGATGTTGAGAGAGAGATGG + Intergenic
988182342 5:27813179-27813201 TAAGGATTTTGAGGGTGAGGGGG + Intergenic
989667014 5:43866444-43866466 TCAGGGTGGTCAGGGAGAACAGG + Intergenic
990989328 5:61669839-61669861 TCAGAAAGGAGAGGGAGAGCAGG - Intronic
994115647 5:96059031-96059053 TCAGGAGGTTTAGGGAGAGCTGG - Intergenic
995971103 5:117972849-117972871 ACAGAATGTGAAGGGAGAGCAGG + Intergenic
998384640 5:141749740-141749762 TCTGGAGGTTCAGGAAGAGCTGG + Intergenic
999692289 5:154158527-154158549 TCTGCATGTGTAGGGAGAGCAGG - Intronic
1000089655 5:157919291-157919313 TCAGGAAGTTAAGGGAGAAAAGG - Intergenic
1000293470 5:159892478-159892500 TCAGAGTGTTGAGGGGGAGAAGG - Intergenic
1001023135 5:168200580-168200602 TCAAGATGTTGGGAGAGAGGTGG + Intronic
1001241904 5:170077692-170077714 TCAGGCTGTGGTGGGAGAACAGG - Exonic
1002660556 5:180788518-180788540 ACAGATGGTTGAGGGAGAGCCGG - Intergenic
1003213976 6:4091954-4091976 TCGCTATGTTGAGGGAGTGCTGG - Intronic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1003552041 6:7108577-7108599 GGAGGATGTCGAGGGAGAGAGGG - Intronic
1004516374 6:16325576-16325598 TCAGGAGGTGGAGGGAGTGAGGG - Intronic
1005569581 6:27131982-27132004 TCAGGATGCAGAGGAAGGGCGGG + Intronic
1006011923 6:31049652-31049674 CCAGGATGTGGAGGGAAAGATGG + Intergenic
1006217372 6:32455960-32455982 TAAGAATGGTGAGGGAGGGCCGG - Intergenic
1006296907 6:33173804-33173826 TCAGGATGTTGAGGGAGAGCTGG + Intronic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1007727890 6:43927686-43927708 TGAGGATGCGGAGGGGGAGCTGG - Intergenic
1007818421 6:44541623-44541645 TCAAGATGTCAAGGGAGAACAGG - Intergenic
1007905905 6:45460512-45460534 TCAGGATGTTTAAAGGGAGCAGG + Intronic
1008502866 6:52200762-52200784 TCAGGATGTTGTGGGAAGTCAGG - Intergenic
1008654144 6:53594113-53594135 GCAGGATGTGCAGGGAGAGAAGG + Intronic
1012420694 6:99061734-99061756 CCAGGATGGTGTGAGAGAGCTGG + Intergenic
1015389432 6:132664489-132664511 CCAGGATGTTCAGGGTGAGTCGG + Intergenic
1016340721 6:143059730-143059752 AGAGGATGTGGAGGGAGGGCTGG - Intergenic
1018360262 6:163060826-163060848 CCAGAATGCTGAGAGAGAGCTGG + Intronic
1018507930 6:164491397-164491419 TCAGTAAGTTTAGGGAGATCTGG - Intergenic
1018838355 6:167501649-167501671 TCACTATGTTGAGGGAGAGAAGG + Intergenic
1019062216 6:169264772-169264794 TCAGCATGGTGGGAGAGAGCAGG + Intergenic
1019536883 7:1533880-1533902 ACAGGATGCTGATGGGGAGCTGG + Intronic
1019788607 7:2995834-2995856 TCAGGACGGGGAGGGATAGCAGG - Intronic
1020714737 7:11657520-11657542 GCAGGTTATTGAAGGAGAGCAGG - Intronic
1022444421 7:30457992-30458014 GCAGGAGGAAGAGGGAGAGCCGG + Intronic
1022664175 7:32394699-32394721 TCAGGAGGTTGAGGTGGAGGTGG + Intergenic
1022674064 7:32481929-32481951 TCCGTATGTTGAGGGAATGCTGG - Intergenic
1023133480 7:37027149-37027171 TCAGAAAGTTGGGGGAGAGAGGG - Intronic
1024423614 7:49199979-49200001 TCTGTATGTTGAGGGAGTGCTGG - Intergenic
1027915894 7:84320748-84320770 TCATGATGTAGTGAGAGAGCAGG + Intronic
1028837957 7:95395955-95395977 GCAGAATGTTGAGGGCGAGCTGG + Intronic
1029278291 7:99420462-99420484 GCAGGCTGTGGAGGCAGAGCTGG - Intronic
1029529926 7:101118563-101118585 TCAGGCTGATGAGGTAGTGCAGG - Intergenic
1030541446 7:110835466-110835488 TCAGGATGTTTGGGGAAAGCAGG - Intronic
1032655106 7:133919533-133919555 TCAGGCTGTTGAGGGAGGGAGGG - Intronic
1032670497 7:134077950-134077972 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1034611927 7:152379017-152379039 CCAGGCTGTTGAAGGAGAGAGGG - Intronic
1036594783 8:10201724-10201746 TCTGGATGTTGAAGGGGATCGGG - Intronic
1037115027 8:15215552-15215574 TCAGGATGATCAGGGCCAGCTGG + Intronic
1037702075 8:21284453-21284475 TGAGGATGAAGAGGAAGAGCAGG + Intergenic
1038437064 8:27543733-27543755 TCAGGATCTGGGGGGAGAACAGG - Exonic
1039798431 8:40934592-40934614 TTAGGATGTGAAGGGAGAGTGGG - Intergenic
1042785680 8:72544353-72544375 GCAGGTTGTTGGGGGAGAGAGGG + Intronic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1046156329 8:110294715-110294737 TGAGGAGGTTGGGGGAGAGATGG - Intergenic
1046432722 8:114150527-114150549 TCAGGATTTTCAGGGACAGTGGG - Intergenic
1046444982 8:114306671-114306693 GCAGGATGAGGAGGAAGAGCTGG - Intergenic
1046893808 8:119451199-119451221 TCAGAATGTTGCAGGAGAGATGG - Intergenic
1047255089 8:123208173-123208195 TCTGGATGTTTCGGGAGAGTTGG + Exonic
1047398826 8:124528798-124528820 TCCTTATGTTGAGGGAGTGCTGG - Intronic
1048086372 8:131185301-131185323 GCAGAATGTGAAGGGAGAGCAGG - Intergenic
1049069318 8:140344816-140344838 TCAGGAAGTGGAGGGAAAGCCGG - Intronic
1049566191 8:143340357-143340379 TCAGGACATGGAGGGAGAGAAGG + Intronic
1050784928 9:9388922-9388944 TCAGGATCATTAGGGAGAGTTGG + Intronic
1051793484 9:20836071-20836093 TTAGGATGATGAGAGAGGGCAGG - Intronic
1052441605 9:28503776-28503798 TCAGAATGTTGGTGGTGAGCAGG + Intronic
1053781720 9:41616612-41616634 TCCCTATGTTGAGGGAGCGCTGG + Intergenic
1054944177 9:70776941-70776963 TCAGGATATTTAGGGGGAGCTGG + Intronic
1055093364 9:72385466-72385488 TTAGTATGTTGAGGGAGTTCAGG - Intergenic
1055456294 9:76475071-76475093 TCAGTATGTTCAGAGAAAGCCGG - Intronic
1056578648 9:87874182-87874204 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1057035959 9:91811735-91811757 GCAGGAGGCTGAGGGAGTGCAGG - Intronic
1057165505 9:92922016-92922038 TCAGGAGGTTGAGGCTGAGGTGG - Intergenic
1057294845 9:93828816-93828838 TCAGGACATTGGGGGTGAGCAGG - Intergenic
1058129004 9:101228187-101228209 TCAAGAAGTTTAGGGAGAGCAGG + Intronic
1060097519 9:120805362-120805384 TCCTGATGTTGAGGGAGTGCTGG + Intergenic
1060529279 9:124338997-124339019 TCAGGATGGGGCTGGAGAGCTGG - Intronic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1186122026 X:6373595-6373617 GCAGGAAGGAGAGGGAGAGCAGG + Intergenic
1186238694 X:7543028-7543050 TCAGCATGGTGAGGGACAACTGG + Intergenic
1187298337 X:18024487-18024509 TCAGGGTGGGGAGGTAGAGCAGG + Intergenic
1188569099 X:31560681-31560703 TGAGGAGGTGGAGGGAGAGGAGG - Intronic
1191257345 X:58285372-58285394 GGAGGAGGTTGAGGGAGGGCTGG - Intergenic
1191645369 X:63474910-63474932 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1192079978 X:68038404-68038426 GAAGGATGGTGAGGGAGAGGAGG + Intergenic
1192342859 X:70278308-70278330 TCACGATGCTGAGCGAGGGCAGG + Intronic
1192582752 X:72298614-72298636 TCTGAATGGGGAGGGAGAGCAGG - Intronic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1195067869 X:101253885-101253907 TAAGGATGTAGAGGACGAGCAGG - Intronic
1196458518 X:115906517-115906539 ACAGGATCTTGAGGGAGGGGAGG - Intergenic
1196464806 X:115960777-115960799 TCAGGAAAGTGAGGGAAAGCTGG - Intergenic
1198224615 X:134633725-134633747 TCAGGATGTGGATGGAGTACAGG - Intronic
1199440077 X:147857822-147857844 TCCCAATGTTGAGGGAGACCCGG - Intergenic
1199711209 X:150470810-150470832 TGCGGCTGTTGAGTGAGAGCAGG - Exonic
1199953276 X:152722752-152722774 TCAGGAGCCTGAGGGAGAGAAGG + Intergenic
1199956406 X:152745698-152745720 TCAGGAGCCTGAGGGAGAGAAGG - Intergenic
1199980221 X:152916679-152916701 GGAGGCTGTTGAGGGAGATCAGG + Intronic
1200114196 X:153762973-153762995 TGAGGATGTGGAGGCAGACCAGG - Intergenic
1200184453 X:154173084-154173106 TCAGGAGGCTGAGCGGGAGCGGG - Intergenic
1200190105 X:154210222-154210244 TCAGGAGGCTGAGCGGGAGCGGG - Intergenic
1200195858 X:154248024-154248046 TCAGGAGGCTGAGCGGGAGCGGG - Intergenic
1200201512 X:154285142-154285164 TCAGGAGGCTGAGCGGGAGCGGG - Intronic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1201264905 Y:12196680-12196702 TCTGTATGCTGAGGGAGTGCTGG - Intergenic
1201269066 Y:12236819-12236841 TAAGGCTCTTGTGGGAGAGCAGG + Intergenic
1201475248 Y:14374701-14374723 GCAGGAAGGAGAGGGAGAGCAGG - Intergenic
1201722410 Y:17114479-17114501 TCAGGATGCTGAGGAGGAGGAGG - Intergenic