ID: 1006300845

View in Genome Browser
Species Human (GRCh38)
Location 6:33192853-33192875
Sequence TATGGAGACCTGATTATGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006300845_1006300854 17 Left 1006300845 6:33192853-33192875 CCACCCATAATCAGGTCTCCATA No data
Right 1006300854 6:33192893-33192915 GCCCCGTGTAATTACAGAGCCGG No data
1006300845_1006300864 29 Left 1006300845 6:33192853-33192875 CCACCCATAATCAGGTCTCCATA No data
Right 1006300864 6:33192905-33192927 TACAGAGCCGGGCCGGGGCGGGG No data
1006300845_1006300856 18 Left 1006300845 6:33192853-33192875 CCACCCATAATCAGGTCTCCATA No data
Right 1006300856 6:33192894-33192916 CCCCGTGTAATTACAGAGCCGGG No data
1006300845_1006300859 22 Left 1006300845 6:33192853-33192875 CCACCCATAATCAGGTCTCCATA No data
Right 1006300859 6:33192898-33192920 GTGTAATTACAGAGCCGGGCCGG No data
1006300845_1006300863 28 Left 1006300845 6:33192853-33192875 CCACCCATAATCAGGTCTCCATA No data
Right 1006300863 6:33192904-33192926 TTACAGAGCCGGGCCGGGGCGGG No data
1006300845_1006300861 24 Left 1006300845 6:33192853-33192875 CCACCCATAATCAGGTCTCCATA No data
Right 1006300861 6:33192900-33192922 GTAATTACAGAGCCGGGCCGGGG No data
1006300845_1006300860 23 Left 1006300845 6:33192853-33192875 CCACCCATAATCAGGTCTCCATA No data
Right 1006300860 6:33192899-33192921 TGTAATTACAGAGCCGGGCCGGG No data
1006300845_1006300862 27 Left 1006300845 6:33192853-33192875 CCACCCATAATCAGGTCTCCATA No data
Right 1006300862 6:33192903-33192925 ATTACAGAGCCGGGCCGGGGCGG No data
1006300845_1006300865 30 Left 1006300845 6:33192853-33192875 CCACCCATAATCAGGTCTCCATA No data
Right 1006300865 6:33192906-33192928 ACAGAGCCGGGCCGGGGCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006300845 Original CRISPR TATGGAGACCTGATTATGGG TGG (reversed) Intergenic
No off target data available for this crispr