ID: 1006301614

View in Genome Browser
Species Human (GRCh38)
Location 6:33196441-33196463
Sequence CCTGGGGGAACCGGGGGTAG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 328}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006301614_1006301622 -7 Left 1006301614 6:33196441-33196463 CCGCTACCCCCGGTTCCCCCAGG 0: 1
1: 0
2: 2
3: 15
4: 328
Right 1006301622 6:33196457-33196479 CCCCAGGACCCTCAACGCCCTGG 0: 1
1: 0
2: 2
3: 17
4: 207
1006301614_1006301630 29 Left 1006301614 6:33196441-33196463 CCGCTACCCCCGGTTCCCCCAGG 0: 1
1: 0
2: 2
3: 15
4: 328
Right 1006301630 6:33196493-33196515 CCACAGCAAGCTCTGCCTCCAGG 0: 2
1: 161
2: 13899
3: 98792
4: 125071

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006301614 Original CRISPR CCTGGGGGAACCGGGGGTAG CGG (reversed) Exonic
900116900 1:1032934-1032956 GCCGGGGGATCCGGGGGTAAGGG - Intronic
900136641 1:1120447-1120469 GCTGGGGGAAGCAGGGGTGGGGG + Intergenic
900633454 1:3650933-3650955 CCTGCGGGAGCCAGGGGTGGAGG - Intronic
901002463 1:6155448-6155470 CCTGGGGGAGCTGGAGGGAGGGG - Intronic
902376275 1:16031479-16031501 CATGGGGGACCAGGGGGTTGGGG + Intronic
902701521 1:18175592-18175614 CCGGGAAGAACCTGGGGTAGCGG + Intronic
903027340 1:20438739-20438761 CATGGGGGAACCCGGGCCAGAGG + Intergenic
903261970 1:22136387-22136409 GCTGAGGGAACCTGGGGTTGGGG + Intronic
903341015 1:22654316-22654338 CCTGGGGAAGCCAGGGGCAGGGG - Intronic
903829324 1:26165093-26165115 CCTTGGGGAACTGGGGTTGGGGG + Intergenic
904300387 1:29550055-29550077 CCTTGGGGAACTGGGGGCTGGGG + Intergenic
904607395 1:31705258-31705280 CCTCGGCTAACCCGGGGTAGGGG + Intergenic
905032623 1:34897771-34897793 CCTGGAAGAACCGGTGGCAGTGG + Intronic
905363525 1:37436236-37436258 CCTGGAGGATCCAGGGGTGGTGG + Intergenic
906555073 1:46704163-46704185 CTTGAGGGAACTGGGGGCAGTGG + Intronic
907677491 1:56532185-56532207 CCTGGGGGAACAGTGGGAGGGGG - Intronic
908462346 1:64357593-64357615 CCTGGGGGCGGCGGGGGTGGGGG - Intergenic
908501359 1:64745772-64745794 GCGGGGGGGAGCGGGGGTAGAGG + Intronic
908611347 1:65864977-65864999 CCTGGGGGAAGGGGCGGTTGTGG - Intronic
909957725 1:81800835-81800857 GCTCGGGGACCTGGGGGTAGGGG + Intronic
910940665 1:92530331-92530353 CCTGGGGGAAGGGGCGGTTGGGG + Intronic
911127405 1:94353248-94353270 CCTGTGGGAATCGGGGCTTGGGG + Intergenic
912488093 1:110045173-110045195 CCTGCAAGAACCTGGGGTAGAGG + Intronic
914454879 1:147826643-147826665 CTTGGGGGAAGCGTGGGAAGAGG - Intergenic
915122967 1:153643343-153643365 CGTGGCGGAATCGGTGGTAGAGG + Exonic
916057113 1:161075302-161075324 CTTGAGGGAACTGGAGGTAGTGG + Intronic
919103598 1:193122404-193122426 CCCAGGGGAAACGGGGGGAGGGG - Intronic
919854374 1:201695461-201695483 CCAGGGGGAAAAGGGGGTATGGG + Intronic
919897604 1:202018756-202018778 CCTGGGGGAAGTGGGTGAAGGGG + Intergenic
920379233 1:205526246-205526268 CTTGTGGGAGCTGGGGGTAGAGG + Intronic
920955463 1:210616336-210616358 CCTGGGGGAAAAGGGGGTGTTGG - Intronic
921714226 1:218401787-218401809 ACTGAGGGAGCCCGGGGTAGGGG - Intronic
922717893 1:227886576-227886598 CCTGGGGGAAGGTGGGGGAGAGG - Intergenic
922752660 1:228077929-228077951 CCGGGGGGATCCTGGGGGAGAGG - Intergenic
923460506 1:234205895-234205917 CCTGGGGGTGCAGGGGGTGGTGG + Intronic
1065651789 10:27899858-27899880 CCTGGGGGAAGGGGTGGCAGTGG + Intronic
1067223049 10:44357585-44357607 CCGGGTGGGACCGGGGGCAGTGG - Intergenic
1067796513 10:49325712-49325734 CCCGGGGGAGCCGGGGTTGGGGG - Exonic
1069650364 10:70042785-70042807 CTTGGGGGATCTGAGGGTAGTGG - Intergenic
1070632540 10:78096917-78096939 CCTGGGGGAAGGGGCGGTTGTGG + Intergenic
1071049301 10:81427451-81427473 AGTGGGGGAACTGGGGGTGGGGG - Intergenic
1071190108 10:83089725-83089747 CCTGGGGGAAGGGGTGGTTGTGG + Intergenic
1073323768 10:102630893-102630915 CCTGGTGGAGCCCGGGGCAGGGG + Exonic
1073444960 10:103575104-103575126 CCTGAGGCTACCTGGGGTAGAGG - Intronic
1074360501 10:112821333-112821355 CCTGGGGGAGGCCGGGGAAGTGG - Intergenic
1076404729 10:130204061-130204083 CCTCGGGGAACCTGAGGCAGGGG - Intergenic
1076441899 10:130485924-130485946 GCTGGGGGAGTCGGGGGCAGCGG - Intergenic
1076822636 10:132947011-132947033 GCTGGAGGTACTGGGGGTAGTGG - Intergenic
1077052079 11:571511-571533 CCTGGGGGAGGCAGGGGCAGGGG - Intergenic
1077166039 11:1139290-1139312 GCTGGGGGAGGCGGGGGTGGTGG + Intergenic
1077242427 11:1517601-1517623 CCTGGGGGAGCCAGAGGTGGGGG - Intergenic
1077358000 11:2127486-2127508 CCCGGGGGAACCAGGGTGAGTGG + Intergenic
1077442365 11:2574676-2574698 CATGGGGGAAGCGGCGGTTGAGG - Intronic
1077497686 11:2894323-2894345 CCTGGGGTAACCCAGGGAAGGGG - Intronic
1077578655 11:3403063-3403085 CCTGGGGACAGCGGGGGTGGTGG + Intergenic
1078898874 11:15622837-15622859 CCTGGTGGACCCGAGGGTTGGGG + Intergenic
1079111589 11:17608100-17608122 CCTGGGGGATCCTGGGGACGGGG - Intronic
1079116835 11:17645542-17645564 CCTGGGGGGACAGGGGGATGAGG - Exonic
1081651448 11:44826822-44826844 CCTTGGGGAGCCTGGGGTAGGGG + Intronic
1082641873 11:55670729-55670751 CCTGGGGCAACTGTGGGTAAGGG + Intergenic
1083203222 11:61132343-61132365 ACTGGGCGCACCGGGGGTGGTGG + Exonic
1083399634 11:62414816-62414838 TCTGGGGGCACCGGGGGCACTGG - Intronic
1084162549 11:67357656-67357678 TCTGGGGGAAGTGGGGCTAGAGG - Intronic
1084662908 11:70557625-70557647 CCTGGGGGAGCTGTGGGTGGGGG + Intronic
1084795469 11:71502025-71502047 CCTGGGGCAACCCGGGAGAGAGG - Intronic
1085893328 11:80607494-80607516 CCTTGGGGGACGGGGGGAAGGGG - Intergenic
1086312245 11:85548585-85548607 CCTGGGGGAAGGGGCGGTTGGGG - Intronic
1086735602 11:90302238-90302260 CCTGGGGGAAGGGGTGGTTGTGG - Intergenic
1087182440 11:95153102-95153124 GCTGGGGGAACCGGGGCTCAGGG - Intergenic
1090552857 11:127841799-127841821 CTTGGGGGAACGGGTGGGAGGGG - Intergenic
1092145284 12:6210479-6210501 CTTGGGGGCAGTGGGGGTAGTGG - Intronic
1096658275 12:53105209-53105231 CCTGGGGGAGGTGGGGGCAGAGG - Exonic
1096854000 12:54465612-54465634 CCTGTGGAAATGGGGGGTAGGGG - Intronic
1097069783 12:56346475-56346497 CCCGGGGGATTCGGGGATAGAGG + Exonic
1097269558 12:57765762-57765784 ACTGGGGGAACCGGAGGAATTGG - Intronic
1100136325 12:91557326-91557348 CCTGGGGGAAGGGGCGGTTGTGG + Intergenic
1102258546 12:111429843-111429865 CCGGGGGGCACCAGGGGCAGGGG + Intronic
1103779499 12:123389397-123389419 CCCGGGGGAAGCGGGGGAGGGGG - Intronic
1104595744 12:130119011-130119033 CTTGGGGGCACCCGGGGTTGGGG + Intergenic
1104956599 12:132469656-132469678 CCAGGGGGAGGCGGGGGTATTGG + Intergenic
1106612251 13:31295411-31295433 CCTGGGGGAAGGGGTGGCAGTGG - Intronic
1113874532 13:113585520-113585542 CGTCGGGGACCTGGGGGTAGTGG + Intronic
1117697286 14:58378486-58378508 CTTGGGGGAACGGGTGGGAGGGG - Intergenic
1118348991 14:64960177-64960199 CCTCTGGGCACCGGGGGCAGGGG + Intronic
1119046355 14:71321205-71321227 CCTGGGGGGAGCGGGGGTGCAGG + Intronic
1119410004 14:74424690-74424712 GCTGGGAGAAGAGGGGGTAGGGG + Intronic
1119494802 14:75069518-75069540 CCCGGGGCGACCGGGGGTGGGGG - Exonic
1122230681 14:100305225-100305247 CCTGGCGGAAGAGTGGGTAGCGG - Intronic
1122922182 14:104884731-104884753 TCGTGGGGAACCGGGGGTGGAGG + Intronic
1123036926 14:105475324-105475346 CCCGGGGGAAGCGGGTGTAGGGG - Intronic
1123733320 15:23163834-23163856 GCTGGGGGCTCCGGGGGCAGAGG - Intergenic
1123751454 15:23361226-23361248 GCTGGGGGCTCCGGGGGCAGAGG - Exonic
1124283823 15:28385130-28385152 GCTGGGGGCTCCGGGGGCAGAGG - Exonic
1124298874 15:28526484-28526506 GCTGGGGGCTCCGGGGGCAGAGG + Exonic
1124959338 15:34383026-34383048 GCTGGGGCATCCGGGGGCAGTGG + Exonic
1124975964 15:34529247-34529269 GCTGGGGCATCCGGGGGCAGTGG + Exonic
1124999070 15:34753043-34753065 CCTGGAGGAACTGGGGGTGGGGG - Exonic
1125317002 15:38442120-38442142 CCTGGGGGTAGCAGGGGCAGAGG + Intergenic
1125521022 15:40347890-40347912 CCTGGGGGAAGAGGGGGCTGCGG + Intergenic
1125674430 15:41494683-41494705 ACTGGGCGAAGCGGGGGTAGCGG + Intronic
1127773100 15:62246011-62246033 GCTGGGGGCTCCGGGAGTAGGGG + Intergenic
1128852470 15:70973579-70973601 CCTGGGGGAAGTGGCGGTTGTGG - Intronic
1129262861 15:74378539-74378561 CCTGGGGGAACCGGGTGAAGGGG - Intergenic
1129854228 15:78812186-78812208 CCTGGGAGCACAGGGGGAAGGGG - Intronic
1130224017 15:82044670-82044692 CCTGGGGTAACCGCGGGGACCGG + Intronic
1132548206 16:543341-543363 CCTGGGACTACCGGGGGTGGCGG + Intronic
1132932144 16:2464273-2464295 CCTTGAGGACCCGAGGGTAGGGG + Intronic
1133347263 16:5079213-5079235 CCTGGGGACAGCGGGGGTGGTGG + Intronic
1134176744 16:12013045-12013067 TCTGGGAGAACCGGGGTTGGAGG + Intronic
1134264412 16:12681115-12681137 ACGGGGGGAAACGGGGGTCGGGG - Intronic
1135480005 16:22814418-22814440 CCAGGGGGTCCCGGGGGCAGCGG - Exonic
1136544536 16:30948054-30948076 CCTGGGGGAGCCGGGGTGTGAGG + Exonic
1136547719 16:30965060-30965082 CCTGGTGGAGGCGGGGGTGGAGG + Exonic
1137442275 16:48507669-48507691 AATGGGGGAAGTGGGGGTAGGGG + Intergenic
1137551042 16:49437767-49437789 TCTTGGGGAACTTGGGGTAGGGG - Intergenic
1137726756 16:50661934-50661956 CCTGGGGGACCCTGGGAGAGAGG + Intergenic
1140165293 16:72544048-72544070 CCTGGGGGAAGGGGTGGTTGTGG + Intergenic
1141094592 16:81154016-81154038 CCAGGGGGAACAGGGTGGAGAGG + Intergenic
1142132548 16:88437565-88437587 CCCGGGGGCACCGGGGGCACAGG - Exonic
1142234403 16:88915063-88915085 CCTGGGAGTCCTGGGGGTAGCGG + Intronic
1142289380 16:89185778-89185800 CCCTGGGGAACCGTGGTTAGTGG - Intronic
1142305280 16:89281020-89281042 TCCGCGGGAACCGGGGGCAGGGG + Exonic
1142361678 16:89630580-89630602 GCTGGGGGAGCCGGGGCTGGGGG + Intronic
1142361716 16:89630654-89630676 GCTGGGGGAGCCGGGGTTGGGGG + Intronic
1142361740 16:89630699-89630721 GCTGGGGGAGCCGGGGCTGGGGG + Intronic
1144454065 17:15404603-15404625 CCTGGGGGAGCTGGGGCCAGGGG + Intergenic
1147057757 17:37847208-37847230 CCTGGGGTTACTGGGGGTAATGG - Intergenic
1147161862 17:38573069-38573091 CCTGGTGGAAGCCGGGGGAGGGG + Intronic
1147565613 17:41534843-41534865 CCTGGCGGACCCAGGGGTGGGGG - Intergenic
1150005377 17:61465797-61465819 CCTGGGGGAGCCGAGGGGTGAGG - Exonic
1151731440 17:75913866-75913888 GCTGGGGGTGCCGGGGGCAGGGG + Intronic
1151979350 17:77499460-77499482 ACTGGGGGATGAGGGGGTAGGGG - Exonic
1152089218 17:78237706-78237728 CCTGGGAGAAGCAGGGGTGGGGG - Intronic
1152396488 17:80036303-80036325 GCTGGGGGCACCGGGGGCCGGGG - Intergenic
1152409190 17:80113301-80113323 CCTGGTGGAACAGTGTGTAGAGG - Intergenic
1152751398 17:82064086-82064108 CATGGGGGCACCTGGGGCAGGGG - Intronic
1203169451 17_GL000205v2_random:134838-134860 GCTGGGGGAATCGGGGATGGGGG + Intergenic
1153489028 18:5629599-5629621 CCTGGGGAAACGCGGGGGAGGGG - Intronic
1156321239 18:36025417-36025439 ACTGGGGGAAAAGGGGGTTGTGG + Intronic
1157517350 18:48320446-48320468 CCTAGGAGAACTGGGGGCAGAGG + Intronic
1158659296 18:59371716-59371738 CCTGGGGGAAGGGGTGGTTGTGG - Intergenic
1160659398 19:291255-291277 CCTTGGGGACCCGGGTGTTGGGG - Intronic
1160731409 19:643213-643235 CCTGGGGGAGGCGGGGGTCGGGG - Exonic
1160980997 19:1816569-1816591 CCTGGGGGAACGGGCAGGAGGGG + Exonic
1161060555 19:2212658-2212680 GCCGGGGGAAGCGGGGGCAGGGG + Intronic
1161484016 19:4525115-4525137 GCTGGGGGAGCTGGGGGTCGGGG + Intronic
1162457758 19:10796230-10796252 CCTTGTGGAAACGGGGGTACGGG + Intronic
1162915828 19:13873893-13873915 CCTGGGGGCACCCGGGGCGGGGG + Intronic
1162923711 19:13919047-13919069 CCTGGGGGTTCCGGGGGAGGTGG + Intronic
1163023418 19:14495865-14495887 CCCAGGGGAAGCGGGGGTGGGGG - Intronic
1163297313 19:16420789-16420811 CCTGGGGGAAAGAGGGGTTGAGG + Intronic
1163659302 19:18567295-18567317 TCTGGGGAAACCTGGGGTGGGGG + Intronic
1164674117 19:30090586-30090608 GCTGGGGAAACCGGTGGGAGAGG + Intergenic
1165475362 19:36027101-36027123 ACTGGGGAAACCAGGGGGAGAGG - Intronic
1165696763 19:37906858-37906880 CCCGGGGGAAACGGGGGAAGCGG - Intergenic
1165786308 19:38463858-38463880 CCCAGGGGAGCCGGGGGTTGGGG + Intronic
1166830895 19:45639180-45639202 GCTGGGGGAACTGCGGGTGGGGG - Intronic
1166975566 19:46603225-46603247 GCTGGGGGAAAATGGGGTAGCGG - Intronic
1167738709 19:51311765-51311787 CCTGGGGGGAGAGGGGGGAGGGG - Intergenic
1168217859 19:54939606-54939628 CCTGCGGGAACCGGCTGCAGAGG + Exonic
1168224259 19:54982994-54983016 CCTGCGGGAACCGGCTGCAGAGG - Exonic
1168309346 19:55452693-55452715 CCTTGGGGAGCCGGGGGTGGCGG + Intergenic
926585033 2:14676069-14676091 CCTGGGGAAACTGGGAGGAGTGG + Intergenic
927156731 2:20225134-20225156 CCTGGCGGAGCTGGGGGTGGGGG - Intronic
930264678 2:49186093-49186115 CCTGGGGGAAGGGGCGGTTGTGG - Intergenic
932962313 2:76428035-76428057 TTTGGGGGATCCTGGGGTAGAGG + Intergenic
934702785 2:96455242-96455264 CCTGGGGGAAGGGGTGGCAGTGG + Intergenic
935152605 2:100451039-100451061 CCTGAGGGTACAGGTGGTAGGGG + Intergenic
936452615 2:112645359-112645381 CCTGGGGGAAGCGGGGGGGTGGG - Intergenic
937043042 2:118835827-118835849 CCCGGGAGAACCGGGGGTGAGGG + Intergenic
937421053 2:121755666-121755688 CCGGGGGGACGCGGCGGTAGCGG + Exonic
942068893 2:172297663-172297685 CCTGGGAGAACAGGGGGTGCTGG - Intergenic
942898804 2:181089761-181089783 CCTGGGGGAACGGGCGGCTGTGG + Intergenic
943660539 2:190554701-190554723 CCTGGGGGAAGGGGCGGTTGTGG + Intergenic
943806648 2:192132667-192132689 CCTGGGGGAAGCGGGCCTGGAGG - Intronic
945045295 2:205776382-205776404 CATAGCGGAACCGGTGGTAGTGG - Intronic
945067096 2:205956507-205956529 CCTGGGGGATGAGGGGGAAGTGG - Intergenic
945409841 2:209495229-209495251 CCTGGGGGAAGAGGGGGATGTGG + Intronic
946321967 2:218959732-218959754 CCCGGGGGACCCGGCGGTGGGGG - Exonic
946391571 2:219419508-219419530 CCTGGGGGAGGTGGGGGGAGGGG + Intronic
1169196785 20:3687458-3687480 CCTGGGGGTAGGGGGGGTGGTGG + Exonic
1169417837 20:5432845-5432867 CTTGGGGGGACAGGGGGTGGGGG + Intergenic
1172533794 20:35654637-35654659 ACTGGGGGAATCGGGGGCACAGG + Exonic
1172590388 20:36113565-36113587 CCTGGGGGTGGTGGGGGTAGGGG + Intronic
1172814930 20:37678735-37678757 CTTGGGAGAACCCGGGGGAGGGG + Intergenic
1173613641 20:44388798-44388820 CCTGGGGCAACCGCGGGATGAGG + Intronic
1174037479 20:47677180-47677202 CCTGGGGGAACGGGGGGTCGTGG - Intronic
1174494774 20:50931517-50931539 CCTGGGGAAAAGGGGGTTAGGGG - Intergenic
1175569753 20:60009948-60009970 CATGGGGGAGCTGGGGGCAGGGG - Intronic
1175755990 20:61530531-61530553 TCTGGGGGAGCCAGGGGAAGAGG - Intronic
1175816408 20:61885301-61885323 GCTGGGGGAGCTGGGGGTAAGGG - Intronic
1175873921 20:62220602-62220624 CCTGTGGGGACCCGGGGTGGGGG + Intergenic
1176077724 20:63255962-63255984 CCTGGAGGAACCAGGGTTATGGG - Intronic
1176091262 20:63319615-63319637 GCTGGGGGAACGGGGGAGAGGGG - Intronic
1176124558 20:63469702-63469724 CCTGGGGCAGCCGGGAGTGGGGG - Intronic
1176310516 21:5146557-5146579 CCTGGGGGAACCGCAGGAAGAGG + Intronic
1176402306 21:6324311-6324333 GCTGGGGGAATCGGGGATGGGGG - Intergenic
1176434851 21:6664793-6664815 GCTGGGGGAATCGGGGATGGGGG + Intergenic
1176459113 21:6991863-6991885 GCTGGGGGAATCGGGGATGGGGG + Intergenic
1176520523 21:7820886-7820908 CCAGCAGGAACTGGGGGTAGAGG - Intronic
1177107003 21:16969331-16969353 ACTGGGGGCACTGGGGGCAGAGG + Intergenic
1178204433 21:30447065-30447087 GCTGGGGGAACCCTGAGTAGAGG - Intergenic
1178654545 21:34450898-34450920 CCAGCAGGAACTGGGGGTAGAGG - Intergenic
1178812302 21:35895387-35895409 CCTGGGGGAAAGGGTGGGAGGGG + Intronic
1179039254 21:37787283-37787305 CTTGAAGGAACTGGGGGTAGAGG + Intronic
1179438240 21:41376611-41376633 GCTTGGGGAACGGGGGGCAGTGG - Intronic
1179846539 21:44115478-44115500 CCTGGGGGAACCGCAGGAAGAGG - Intronic
1180843907 22:18971266-18971288 GCTGGGGGAATCAGGGGTGGTGG + Intergenic
1181320644 22:22003250-22003272 CCTGAGGGGGCCGGGTGTAGTGG + Intergenic
1181546113 22:23603568-23603590 CCTGGGGGACACGGAGGGAGAGG - Intergenic
1181957353 22:26597616-26597638 CCTGGTGGAACGGGGTGTCGGGG - Intergenic
1182557356 22:31136526-31136548 CCTGGGGCAGCAGGGGGTAGAGG + Intronic
1183574885 22:38681854-38681876 ACTGGAGGACCCGGGGCTAGAGG + Intergenic
1184230396 22:43155547-43155569 CCTGGAGGAAATGGGGCTAGTGG + Intronic
1184980046 22:48089555-48089577 GATGGGGGAACCGGGTGCAGAGG + Intergenic
949131415 3:506296-506318 CCTGTTGGCAGCGGGGGTAGGGG - Intergenic
950077631 3:10198410-10198432 CCTGGGGGAATTGGGGCTGGTGG + Intronic
953876214 3:46668223-46668245 CCTGGGGGAAGCAGGACTAGAGG + Intergenic
954421716 3:50422336-50422358 CCTGTGGCAACCTGGGGGAGTGG - Intronic
954456019 3:50600316-50600338 CCTGGGGTAAGTGGGGGGAGAGG - Intergenic
960993437 3:123326069-123326091 CCAGGGGGTACCGGAGGGAGAGG + Intronic
963049877 3:141132128-141132150 CCTGGGGGAAAGGGTGGGAGGGG - Intronic
963445968 3:145407856-145407878 CTTGGGGGAAACGGTGGGAGGGG + Intergenic
965165140 3:165188189-165188211 CCTGGGGGAGGCTGTGGTAGTGG - Exonic
966187414 3:177240580-177240602 CTTGGTGCAACCGGGGTTAGTGG - Intergenic
967805998 3:193715094-193715116 CCTGGTGGAGCTGGGGGAAGAGG + Intergenic
968582201 4:1400391-1400413 CCTGGTGGAAATGGGGGTGGTGG + Intergenic
969357803 4:6640886-6640908 GCTGGCGGAACCGGAGGAAGTGG + Exonic
970471574 4:16384597-16384619 CCTTGGGGAACGGGGGGATGAGG + Intergenic
971186498 4:24382781-24382803 CCTGGGGGAAGGGGTGGTTGTGG + Intergenic
972255832 4:37354441-37354463 CCTGGGGGAAGGGGCGGCAGTGG - Intronic
973321861 4:48817949-48817971 CCTGGGGGAAGGGGTGGTTGTGG + Intronic
973923725 4:55715810-55715832 GTTGGGGGAACTGGGGGCAGGGG - Intergenic
975379462 4:73681532-73681554 CCTGGGGGTGGTGGGGGTAGGGG + Intergenic
976484469 4:85585479-85585501 CCTGGGGGAATCTGTGGGAGAGG + Intronic
981202129 4:141992608-141992630 CCTGGGGGAAAGGGTGGTTGTGG - Intergenic
982794495 4:159629309-159629331 CCTGGGGGAAGCGGCGGCTGTGG - Intergenic
984382556 4:179014367-179014389 CCTAGGGGAACCTGGGTAAGAGG - Intergenic
984903001 4:184601222-184601244 CCTGGGGGAAGTGGTGGTTGTGG + Intergenic
987528154 5:19080275-19080297 CCTGGGGGAAGAGGTGGTTGTGG - Intergenic
987687636 5:21225802-21225824 CCTGGGGGAAGCGGTGGCTGTGG + Intergenic
992229762 5:74652648-74652670 CCTGGGGGTAGTGGGGGTAAGGG - Intronic
992625864 5:78635374-78635396 CCTGGGGGAAGAGGGGGCGGTGG - Intronic
992977653 5:82137813-82137835 CCTGGGGGAAGAGGTGGCAGTGG - Intronic
993410423 5:87567121-87567143 CCTGGGGGAAGGGGCGGTTGTGG - Intergenic
994625996 5:102219794-102219816 CCTGGGGGAAAGGGTGGGAGAGG - Intergenic
995464458 5:112436480-112436502 CCTGGGGGAAGCGGTGGATGTGG + Intergenic
997344415 5:133176348-133176370 ACTGGGGGCACGGGGGGTAGCGG - Intergenic
997838518 5:137216795-137216817 CCTGGAGGAATCAGGGGTCGGGG + Intronic
999798672 5:155012006-155012028 GCTGGGGGAATGGGGGGCAGGGG - Intergenic
1000037737 5:157461521-157461543 CCTGGGAGAACATGGGCTAGGGG - Intronic
1000738401 5:164934025-164934047 CCTGGGGGAAGGCGGGGTTGTGG - Intergenic
1001270867 5:170310738-170310760 CCTGGGGGTAACGAGGGCAGTGG + Intergenic
1001523523 5:172412802-172412824 TCTGGGGGGAGCGCGGGTAGTGG - Intronic
1001650493 5:173312399-173312421 GCTGGGGCAACCGGGGCTGGAGG - Intergenic
1003868122 6:10381699-10381721 CCTGGGGGAAGCGAGAGGAGAGG + Intergenic
1005492677 6:26361086-26361108 CCTGAGGGAAGCTGGGGTGGGGG - Intergenic
1005826118 6:29632743-29632765 GCTGGGGGAAGCGGGGCTGGGGG - Intronic
1006162951 6:32048594-32048616 CCTGGGGGAGCTGGCGGTGGCGG - Intronic
1006301614 6:33196441-33196463 CCTGGGGGAACCGGGGGTAGCGG - Exonic
1006635694 6:35459788-35459810 CCTGGGGGAACAGGTGGCAGTGG - Intronic
1007091036 6:39185160-39185182 CCTGAGGGAACCGTGGGGACTGG + Intergenic
1007482356 6:42158442-42158464 TCTGGGGGCAGCAGGGGTAGGGG - Intronic
1007547319 6:42704336-42704358 CCTGGGCCAGCTGGGGGTAGAGG - Intronic
1007605522 6:43115429-43115451 CCTGGGGGCACAGGGGGATGAGG - Intronic
1007949660 6:45860077-45860099 CCTATGGGAATCTGGGGTAGTGG + Intergenic
1008418323 6:51268710-51268732 TCTGGAGGAACAGGGGGAAGAGG - Intergenic
1009844209 6:69115442-69115464 ACTGGGGGATCGGGGGTTAGGGG + Intronic
1010446953 6:75959464-75959486 CCTGGGGGAAGGGGGGGCTGTGG - Intronic
1015282557 6:131449588-131449610 CCTGGTGGAACTGGGGGAACAGG - Intergenic
1017968653 6:159290130-159290152 CCTGGGGGAAACGGTGGCTGTGG - Intergenic
1019750274 7:2724902-2724924 CCTGGCGGATCCGGGTGTGGCGG - Intronic
1020035370 7:4960178-4960200 AGTGGGGGACCCGAGGGTAGGGG + Intergenic
1020143000 7:5622605-5622627 CCTGGGGGATGCGAGGGGAGGGG + Exonic
1020519537 7:9168965-9168987 CCTGGGGGAAGGGGCGGCAGTGG - Intergenic
1021805685 7:24352682-24352704 CCTGGGGGAAGGGGCGGTTGTGG + Intergenic
1022506030 7:30909076-30909098 CCAGGGGGACCAGGGGGAAGTGG - Intergenic
1022752807 7:33249474-33249496 CCTGTGGGGATGGGGGGTAGAGG - Intronic
1023061642 7:36333051-36333073 CCTGGGGGAAGGGGTGGCAGTGG + Intronic
1023257665 7:38328130-38328152 CCTGGACTATCCGGGGGTAGGGG + Intergenic
1023418236 7:39951152-39951174 GCCGGGGGAACGGGGGGCAGCGG + Exonic
1024372865 7:48606810-48606832 CCTGGGGGAAGGGGTGGTTGGGG - Intronic
1025807852 7:64852732-64852754 CCTGGGGACACAGGGGGCAGTGG - Intergenic
1029123059 7:98281346-98281368 CCTGGGAGATCGGGGCGTAGGGG + Intronic
1029180003 7:98693533-98693555 CCTGGGTGCACCGTGGGTACAGG + Intergenic
1031917739 7:127578913-127578935 CCTGGGGGAAAAGGGGGATGAGG + Intergenic
1032458062 7:132088430-132088452 CCTTGAGGAAGAGGGGGTAGGGG - Intergenic
1034159601 7:148983240-148983262 CCACGGGGAACCGGGGGTGGGGG + Intergenic
1035860487 8:3022457-3022479 CCTGTGGGAACAGAGGCTAGTGG - Intronic
1037355338 8:18013376-18013398 CCTGGGGCCACTGGGAGTAGAGG - Intronic
1038540356 8:28385886-28385908 CCTGGGGGGTCCGGGGGTCTGGG - Intronic
1040779952 8:51095514-51095536 CCTGGGGGAAAGGGCGGTTGTGG + Intergenic
1042721341 8:71830095-71830117 CCTGGGAGAAACTGAGGTAGGGG - Intronic
1045440511 8:102204020-102204042 TCTTTGGGAAACGGGGGTAGAGG + Intergenic
1045951874 8:107861343-107861365 CGTGGGGGAAAGGGCGGTAGGGG - Intergenic
1049217004 8:141412887-141412909 CCAGGGGGCACCTGGGGTGGAGG + Intronic
1049272145 8:141701457-141701479 CCTGGGGGTACTGGTGGGAGGGG + Intergenic
1049549290 8:143249386-143249408 CCAGGGGGATTCGGGGGTGGAGG + Intronic
1049763865 8:144343866-144343888 CTTCAGGGAACCTGGGGTAGGGG - Intergenic
1049993439 9:1011471-1011493 CCCAGGGGAAGCGGGGGCAGAGG - Intergenic
1050084491 9:1950372-1950394 GCTGGGGGGGCCGGGGGTGGGGG + Intergenic
1052052671 9:23866199-23866221 CCTGGGGGAACGGGCGGCTGTGG - Intergenic
1053553665 9:39110613-39110635 CCTAGGGGAACCTGGGGTCCTGG + Intronic
1053817774 9:41930760-41930782 CCTAGGGGAACCTGGGGTCCTGG + Intronic
1054108027 9:61074429-61074451 CCTAGGGGAACCTGGGGTCCTGG + Intergenic
1054612830 9:67256696-67256718 CCTAGGGGAACCTGGGGTCCTGG - Intergenic
1056331815 9:85527508-85527530 CCTGGGTGAACTTGTGGTAGGGG - Intergenic
1056573527 9:87836880-87836902 AGTGAGGGAACCCGGGGTAGGGG - Intergenic
1056910600 9:90696755-90696777 GCTGGGGGCACTGGGGGCAGAGG - Intergenic
1057274363 9:93668492-93668514 CCTGGGGGTCCTGGGGGTTGGGG + Intronic
1057487960 9:95500668-95500690 CCTGGGGGGACAAGGGGGAGTGG + Intronic
1058187430 9:101871420-101871442 CCTGTGGGAGTCGGGGGTGGTGG - Intergenic
1059417125 9:114169030-114169052 CCTGGTAGAACCAGGAGTAGGGG - Exonic
1060327586 9:122632569-122632591 CTTGGGGGAAGCGGTGGAAGGGG - Intergenic
1060478440 9:124001714-124001736 GCTGGGGGTAGGGGGGGTAGGGG + Intronic
1060822330 9:126668815-126668837 CCTGGGGGATGTGGGGTTAGGGG - Intronic
1062365768 9:136208256-136208278 CGTGGGGGGAGCGGGGGGAGGGG + Exonic
1062495177 9:136828147-136828169 CTTGGGGGAGCTGGGGGGAGGGG + Intronic
1062586070 9:137250680-137250702 CCTGGGGGCACAGAGGCTAGAGG - Intergenic
1203436685 Un_GL000195v1:143854-143876 GCTGGGGGAATCGGGGATGGGGG - Intergenic
1185884520 X:3770562-3770584 CTTGGGGGGAACGGGGGAAGGGG - Intergenic
1186610995 X:11138791-11138813 CCAGGGGGGACCGTGGGTGGTGG - Exonic
1189689341 X:43599571-43599593 CCTGTAGGAACAGGGTGTAGAGG + Intergenic
1189937812 X:46087665-46087687 CCTGGGGGAACGGGCGGCTGTGG + Intergenic
1190716880 X:53112120-53112142 CTTGGGGGAACGGGTGGGAGGGG - Intergenic
1190764938 X:53468189-53468211 CCTGGTGGAGCCTGGGGGAGTGG - Intergenic
1191227023 X:58054456-58054478 CCTGGGAGAAGCCGGGGCAGAGG - Intergenic
1191793832 X:64999985-65000007 CCTGGGGGAAGGGGCGGTTGTGG + Intronic
1192712568 X:73607077-73607099 CCTGGGGGAACGGGCGGCTGTGG - Intronic
1192964225 X:76159861-76159883 CCTGGGGGAAGGGGCGGTTGGGG + Intergenic
1192999571 X:76550040-76550062 CCTGGGGGAACGGGAGGCTGAGG - Intergenic
1193112310 X:77742473-77742495 CCTGGAGGAACCTGGGGAATGGG + Intronic
1193341263 X:80352260-80352282 CCTGGAGGAAGCGGGGGCTGTGG - Intronic
1193389218 X:80906650-80906672 CCTGGGGGAAGGGGCGGTTGTGG + Intergenic
1193640940 X:84009006-84009028 CCTGGAGGCACAGGGGGTAGGGG + Intergenic
1194403071 X:93461718-93461740 CCGGGAGCAACAGGGGGTAGGGG + Intergenic
1194901260 X:99514458-99514480 CCTGGGGGAAGGGGAGGCAGTGG + Intergenic
1195915686 X:109932929-109932951 GCTGGGTCAACCTGGGGTAGGGG - Intergenic
1196269749 X:113697505-113697527 CCTGGGGGAAGGGGCGGTTGGGG - Intergenic
1196384654 X:115136281-115136303 CATGGGTGAGGCGGGGGTAGGGG - Intronic
1196545671 X:116962172-116962194 CCTGGGGGAAGGGGCGGTTGTGG - Intergenic
1198479942 X:137031850-137031872 CGTGCGGAAACCCGGGGTAGGGG - Intergenic
1199972903 X:152873686-152873708 CCTGGGGGATCAGGAGCTAGTGG - Intergenic
1200137903 X:153883764-153883786 CATGGGAGAACCTGGGGTAGTGG - Intronic
1200365364 X:155657212-155657234 CCTGGGGGAAGGGGTGGCAGTGG - Intronic
1200803365 Y:7407230-7407252 CCTGGGGGAAGGGGTGGTTGTGG + Intergenic