ID: 1006301616

View in Genome Browser
Species Human (GRCh38)
Location 6:33196447-33196469
Sequence GAGGGTCCTGGGGGAACCGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 320}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006301616_1006301630 23 Left 1006301616 6:33196447-33196469 CCCCCGGTTCCCCCAGGACCCTC 0: 1
1: 0
2: 2
3: 20
4: 320
Right 1006301630 6:33196493-33196515 CCACAGCAAGCTCTGCCTCCAGG 0: 2
1: 161
2: 13899
3: 98792
4: 125071

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006301616 Original CRISPR GAGGGTCCTGGGGGAACCGG GGG (reversed) Exonic
900131288 1:1088316-1088338 GGGGGTCCTGGGGGAGGCCGTGG - Intronic
900226307 1:1535057-1535079 GAGGGTCCTGGGGGGCAGGGAGG - Intergenic
900362252 1:2294756-2294778 GAGGGCCCTGGGAGAGCAGGTGG - Intronic
900367053 1:2315574-2315596 CAGGGACCTGGGGGACTCGGTGG + Intergenic
900488186 1:2933391-2933413 GAGGGTGCTGGGGGAACGTAAGG + Intergenic
900694431 1:4001038-4001060 GTGGGTCCTGGAGGTACCTGGGG + Intergenic
901055886 1:6448454-6448476 GAGGGTCATGGGGGCCTCGGTGG - Intronic
901476721 1:9495090-9495112 GTGTGTCCTGGGAGAGCCGGAGG + Intergenic
902187080 1:14733629-14733651 AGGGGCCCTGGGAGAACCGGGGG - Intronic
902603577 1:17556191-17556213 GAGGGGCCTGGGAGCACAGGGGG + Intronic
902677588 1:18019540-18019562 GTGGGTCCTGGGGCAGCCTGGGG + Intergenic
903883926 1:26530367-26530389 GAGGGCCCTGGGAGAAGTGGGGG - Intronic
904015442 1:27416479-27416501 GAGAGTCCTTGGGGAACTGGTGG - Intronic
904045819 1:27607545-27607567 GAGGGACCTGGGGGAGACAGAGG + Intergenic
904406331 1:30290853-30290875 AAGGATGCTGGGGGAACTGGAGG + Intergenic
905105696 1:35562373-35562395 GGGGGTCCTGTGGCAACAGGTGG + Exonic
905733496 1:40311672-40311694 GGGGGTCCTGGGGGCCCCGATGG + Exonic
905734350 1:40315618-40315640 GGCGGTCCCGGGGGACCCGGGGG + Exonic
906035351 1:42747286-42747308 GAGGGTCCAGGGTGAACCACAGG + Exonic
906206934 1:43991953-43991975 GAGGATTCTGGGGGAGGCGGCGG + Exonic
907513647 1:54980226-54980248 TAGGGTCCTGGAGGGACGGGAGG + Intergenic
907650120 1:56286905-56286927 GAAGGTCCTGGAGGATCCAGTGG - Intergenic
907663024 1:56411122-56411144 GAGGACCCTGGAGGAACCTGAGG - Intergenic
908483152 1:64564047-64564069 GAGGGTACTTGGGGAACAGCAGG + Intronic
912489436 1:110053798-110053820 GAGTGTCCTGGGCCAACGGGTGG + Exonic
913597537 1:120393262-120393284 GAGGGTCCCAGGGGAGCAGGGGG - Intergenic
914089793 1:144486052-144486074 GAGGGTCCCAGGGGAGCAGGGGG + Intergenic
914308817 1:146448164-146448186 GAGGGTCCCAGGGGAGCAGGGGG - Intergenic
914512510 1:148346326-148346348 GAGGGTCCCAGGGGAGCAGGGGG + Intergenic
914593291 1:149124967-149124989 GAGGGTCCCAGGGGAGCAGGGGG + Intergenic
914918662 1:151833292-151833314 GAGGGTGCTGGGGGGGCGGGGGG - Intergenic
915287503 1:154862305-154862327 GAGGGTCATGAGGGACCCAGGGG + Intronic
916576245 1:166069779-166069801 GAGGGTGCTGGGGAAATGGGTGG - Intronic
917730698 1:177871961-177871983 GAGGGTACTGAGGGATCCTGGGG - Intergenic
920002215 1:202807888-202807910 GAGGAGCGTGGGAGAACCGGGGG - Intronic
920071446 1:203305762-203305784 GAGGGGCCTGGCGCCACCGGGGG + Intronic
922414016 1:225403863-225403885 GGGGGAGCTGGGGGAACTGGGGG - Intronic
923108143 1:230869428-230869450 GAGGGGCTTGGGGGAAGTGGGGG - Intronic
923407758 1:233679816-233679838 GAGGTCCCTGGGGGTTCCGGTGG + Intergenic
1062932602 10:1362993-1363015 GCGGGTGCAGGGGGAACGGGCGG - Intronic
1062954770 10:1532892-1532914 GAGGCTCCTGGGGCAGCCTGAGG - Intronic
1066315441 10:34241402-34241424 GAGGGTGGTGGGAGACCCGGTGG + Intronic
1067083518 10:43226540-43226562 GGGGCTCCTGAGGGAACCCGGGG - Intronic
1067151968 10:43743263-43743285 GAGGTTCTTGGGGGAGACGGAGG + Intergenic
1067281178 10:44874390-44874412 TTGGGTCCTGGAGGAACCAGTGG + Intergenic
1067371489 10:45687734-45687756 TAGGTTTCTGGGGGAACAGGTGG + Intergenic
1067388294 10:45838416-45838438 TAGGTTTCTGGGGGAACAGGTGG - Intronic
1067417831 10:46118867-46118889 TAGGTTTCTGGGGGAACAGGTGG + Intergenic
1067445972 10:46346158-46346180 TAGGTTTCTGGGGGAACAGGTGG + Intergenic
1067503187 10:46825429-46825451 TAGGTTTCTGGGGGAACAGGTGG + Intergenic
1067591410 10:47514587-47514609 TAGGTTTCTGGGGGAACAGGTGG - Intronic
1067638528 10:48022682-48022704 TAGGTTTCTGGGGGAACAGGTGG - Intergenic
1067874961 10:49997650-49997672 TAGGTTTCTGGGGGAACAGGTGG + Intronic
1069558893 10:69415905-69415927 GAGGGTCCTTGGGGAAGCTGGGG - Intronic
1069902001 10:71711564-71711586 GAGGGTCCTGTGGGAACTGGAGG + Intronic
1070135127 10:73687099-73687121 TAGGTTTCTGGGGGAACAGGTGG - Intronic
1070962478 10:80508916-80508938 GAGGGTCCAGGTGGAACTGCTGG + Intronic
1071488335 10:86118456-86118478 TAGGTTCTTGGGGGAACAGGTGG - Intronic
1072188203 10:93061511-93061533 GAGGGTCCAGTGGGAGCCGGGGG - Intronic
1073136436 10:101223031-101223053 CAGAGTCCTGGGGGAACAGATGG + Intergenic
1073491425 10:103855559-103855581 GTGGGTCCGGCGGGAACTGGCGG + Intergenic
1076292911 10:129361440-129361462 GGGGTTCCTGGGGGGATCGGAGG + Intergenic
1076422311 10:130340145-130340167 GAGGGTCCTGGAAGGACCAGGGG + Intergenic
1076615548 10:131751971-131751993 CAGGGGCCTGGGGGAACTGCAGG + Intergenic
1076637394 10:131891397-131891419 GAGGATCCTGGGAGACGCGGTGG - Intergenic
1076697387 10:132253508-132253530 GAGGGAGCTGAGGGAGCCGGAGG + Intronic
1076892298 10:133291238-133291260 GAGGGACATGGGGGACACGGAGG - Intronic
1076892305 10:133291257-133291279 GAGGGACATGGGGGACACGGAGG - Intronic
1076892479 10:133291803-133291825 GAGGGACATGGGGGACACGGAGG - Intronic
1076892486 10:133291822-133291844 GAGGGACATGGGGGACACGGAGG - Intronic
1076892516 10:133291917-133291939 GAGGGACATGGGGGACACGGAGG - Intronic
1076892544 10:133292003-133292025 GAGGGACATGGGGGACACGGAGG - Intronic
1076892556 10:133292042-133292064 GAGGGACATGGGGGACACGGAGG - Intronic
1077017823 11:404708-404730 GAGGGTCCTGGGCCACCAGGAGG + Exonic
1077164888 11:1130564-1130586 CAGGGTGCTGGGAGAACCTGGGG + Intergenic
1077194213 11:1271150-1271172 GAGGGCCCTGGGGGAGCCTCGGG + Intergenic
1077333794 11:1994570-1994592 GGGGGTTGTGGGGGAGCCGGTGG - Intergenic
1077672152 11:4166697-4166719 GAGGATCATGGGAGAACTGGAGG - Intergenic
1078215898 11:9311568-9311590 CAGGGGCCTGGGGGAAAGGGTGG + Intronic
1081637047 11:44727811-44727833 GGGGGTCCTGGAGGAACGAGTGG - Intronic
1081929461 11:46858657-46858679 GAGGGTACTGGGGAAAGGGGAGG + Exonic
1081952900 11:47060772-47060794 TAGGGTTTTGGGGGAACCAGTGG - Intronic
1083594342 11:63911872-63911894 GAGGGTGCTGGGGGCTCCAGAGG + Exonic
1083710634 11:64546295-64546317 GTGGGTGCTGGGGGCACCTGTGG + Intergenic
1083883887 11:65561348-65561370 GAGGGGCCTGGGGGTACAGCAGG + Intergenic
1084536596 11:69761021-69761043 GTGTGTACTGGGGGAACAGGGGG - Intergenic
1084891092 11:72237533-72237555 GAGGGGCCTGGGGGCAGTGGAGG - Exonic
1088832173 11:113546853-113546875 GAAGTTCCTGGGAGGACCGGTGG - Intergenic
1088986951 11:114917642-114917664 GAGGGTCCTGGGAGCTCTGGGGG - Intergenic
1089276013 11:117336511-117336533 CAGGGGCCTGGGGGAAAGGGTGG + Intronic
1089581715 11:119485462-119485484 GAGGCCCCTGGGGGAGCCTGCGG - Intergenic
1089729296 11:120510838-120510860 GGGAGTCCTGGGGGAATAGGAGG - Intergenic
1090998871 11:131891583-131891605 CAGAGTCCTCGGGGAACCAGAGG - Intronic
1091404979 12:203551-203573 GAGGGTCCGCGGGGAGCGGGCGG + Intronic
1091893639 12:4083066-4083088 GAGGCTGCTGGGGGAACCCTGGG - Intergenic
1092838105 12:12511189-12511211 GAGGCTCCTGGAGCAACCTGGGG + Intronic
1096103043 12:48980790-48980812 GGGCGTCCTGGGAGAGCCGGAGG + Intronic
1096504925 12:52086770-52086792 GAGGGTCCGGGAGGAAGCAGAGG - Intergenic
1096709269 12:53443471-53443493 CAGGGGCCTGGGGGAAAGGGTGG - Exonic
1097222576 12:57459816-57459838 GAGGATCCTGGGGGTCCTGGGGG + Intergenic
1097269559 12:57765768-57765790 CTGGGAACTGGGGGAACCGGAGG - Intronic
1098779256 12:74664176-74664198 GAGGGTCCTGGCGGCTCCCGGGG + Intergenic
1103952485 12:124558601-124558623 CAGGGGCCTGGGGGATGCGGGGG + Intronic
1104119867 12:125788999-125789021 GAGGGTCTTGGGAGGACCCGTGG + Intergenic
1104719870 12:131039304-131039326 GAGGGTCCTGGTGGGACTGGGGG - Intronic
1105016085 12:132787542-132787564 AAGGGTCCTGGGGGCTCTGGGGG - Intronic
1105439387 13:20402848-20402870 GAGGGGGCTGGGGTAACAGGTGG - Intergenic
1112469586 13:99675521-99675543 GAGGGTTTTGGGGGAAAAGGAGG - Intronic
1113566781 13:111324098-111324120 GAAGGTCCTGGGGGTGCTGGTGG + Intronic
1113645960 13:111996239-111996261 GAGGGTCCTGTGGGAGCCGGGGG - Intergenic
1114713774 14:24804077-24804099 GAGGGTCATGGGGGAGCCAGAGG + Intergenic
1119046353 14:71321199-71321221 CCGGGTCCTGGGGGGAGCGGGGG + Intronic
1119385920 14:74258129-74258151 GGGGGTCCCCGGGGAAGCGGGGG + Intronic
1119548797 14:75493183-75493205 GAGGTCCCTGGGAGAAACGGTGG - Intergenic
1121333507 14:93062912-93062934 GAGGGTCCTGAGCGATCCGGCGG + Intronic
1121483249 14:94294342-94294364 GTGAGTCCTGGGGAACCCGGCGG + Intergenic
1122046880 14:99030130-99030152 GAGAGCCCTGGAGGAGCCGGTGG - Intergenic
1122087785 14:99319249-99319271 GAGAGTCCAGGGAGACCCGGAGG - Intergenic
1122261009 14:100523029-100523051 GGGGGTCCTGGGAGAGCCAGTGG + Intronic
1122365989 14:101195119-101195141 CAGGTTCCTGGGGGCACTGGAGG - Intergenic
1122413354 14:101537147-101537169 GAGGGTGCTGGGAGACCCTGGGG + Intergenic
1124999075 15:34753049-34753071 GGAGGTCCTGGAGGAACTGGGGG - Exonic
1125758309 15:42080972-42080994 GAGGATCCTGGGGGACTGGGTGG - Intronic
1127298973 15:57634185-57634207 GAGTGTGGTGGGGGAACCTGAGG + Intronic
1127638522 15:60893643-60893665 GAGGCTCCTAAGGGAAGCGGGGG + Intronic
1129144880 15:73637811-73637833 GAGGCTGCTGGGGGAAGTGGTGG - Intergenic
1129177098 15:73848010-73848032 GAGAGTCCTGGGGGAAAGAGGGG + Intergenic
1129695361 15:77737910-77737932 GAGGGACCTGGGGGCACAGCAGG - Intronic
1131154624 15:90067356-90067378 GAGGGCCTTGGAGGAGCCGGCGG + Exonic
1132394149 15:101459788-101459810 GAGGGTGTTGGAGGACCCGGTGG - Intronic
1132570525 16:642104-642126 GTGGGACCTGCGGGCACCGGGGG - Exonic
1132693192 16:1190759-1190781 GTGGGTGCTGGGGGAAGGGGAGG + Intronic
1135479998 16:22814399-22814421 GCGGCTCCTCGGGGAACAGGCGG - Exonic
1136513431 16:30753378-30753400 GATGGACCTGGGGGAAGGGGAGG - Exonic
1136518895 16:30784045-30784067 GGGGGTCCAGGGGGATCTGGTGG + Exonic
1136886297 16:33932251-33932273 GAGGGTCCTGGGGAAAGGTGGGG - Intergenic
1137620443 16:49873179-49873201 GATAGTCCTGGGGGAATCTGGGG - Intergenic
1138206461 16:55128940-55128962 GAGGGTCCTGGTGGAGCCATAGG + Intergenic
1138323355 16:56138545-56138567 GAGGTACCTGGGGGTACTGGTGG - Intergenic
1139121000 16:64017034-64017056 GAGGGTGATGGGGGAACTTGAGG + Intergenic
1140015361 16:71177008-71177030 GAGGGTCCTGGAGTCACCAGAGG + Intronic
1140824502 16:78693297-78693319 GAGGGTCCTGTGGGTAGTGGTGG - Intronic
1203086141 16_KI270728v1_random:1185582-1185604 GAGGGTCCTGGGGAAAGGTGGGG + Intergenic
1143030328 17:3964027-3964049 GATGCTCCTGGGGCACCCGGCGG - Intronic
1143091239 17:4450130-4450152 GTGGGTCCTGGGGGCTCCTGGGG + Intronic
1143134501 17:4704044-4704066 GGGGTTCCTGGCGGGACCGGGGG - Exonic
1143482868 17:7237746-7237768 GAGGGACCTGGGAGAGCAGGGGG - Intronic
1143619067 17:8070831-8070853 GAGGGCCCTTTGGGAACCAGTGG + Intergenic
1145274070 17:21419674-21419696 GAGGGTCCTGGGGGGCGGGGAGG + Exonic
1145311935 17:21705573-21705595 GAGGGTCCTGGGGGGTGGGGAGG + Intergenic
1146176116 17:30667583-30667605 GAGGGTTCTGGGGGGAGGGGGGG + Intergenic
1146349573 17:32083693-32083715 GAGGGTTCTGGGGGGAGGGGGGG + Intergenic
1148722527 17:49764010-49764032 GAGGGGCCGGGGGGCTCCGGCGG - Exonic
1150096980 17:62385589-62385611 GAGGGGCCTGGGAGAAAAGGAGG - Intronic
1150414351 17:64975342-64975364 GAGGCTCCTGGGGGAAGAAGAGG - Intergenic
1150484806 17:65536411-65536433 CAGGGTCCTGGGTGAACAGGTGG + Exonic
1150569003 17:66369383-66369405 GAGGGACCTGGGGGAGGAGGAGG + Intronic
1151656789 17:75499888-75499910 GAGGCTCCAGGGCGAAGCGGGGG - Exonic
1151674388 17:75590085-75590107 GAGGGAGCTGTGGGAACCCGAGG + Intergenic
1152031551 17:77846369-77846391 GAGGGTCCTGGCTGAAGCTGAGG - Intergenic
1152088219 17:78232722-78232744 GAGGGAGCTGGGGGGAACGGAGG - Intronic
1152245349 17:79182432-79182454 GAGGGGCCTGGGGGAGACGAGGG + Intronic
1152266070 17:79295698-79295720 CAGGGTGCTGGGGGAGCAGGGGG - Intronic
1152353200 17:79794763-79794785 CAGAATCCTGGGGGACCCGGAGG - Exonic
1152568769 17:81112158-81112180 GAGGGACCTGGGGGAGTGGGGGG - Intronic
1152579988 17:81161623-81161645 GAGGTTCCTGAGAGAACCCGGGG - Intronic
1153944853 18:10009507-10009529 GAGGGTCCTGGGGTAGCCCGTGG + Intergenic
1155102265 18:22623286-22623308 GAGCCTACTGGGGGCACCGGGGG - Intergenic
1156337373 18:36183635-36183657 GAGGGTCCTGGAGGAGGAGGTGG - Intergenic
1156350597 18:36298173-36298195 GAGGGTCCTGCGCCAACCAGCGG - Intronic
1157335200 18:46732847-46732869 GAGAGTCCTGGGGGAGGTGGGGG + Intronic
1160276616 18:77443261-77443283 GAGGTTCCTGGGGGCACGGTGGG - Intergenic
1160968564 19:1757427-1757449 GGGGTGCGTGGGGGAACCGGAGG + Intronic
1160995614 19:1880813-1880835 TGGGGGCCTGGGGGAACTGGAGG - Intronic
1161358203 19:3831466-3831488 GGGGGTCCCGGGGGAGGCGGGGG + Exonic
1161392704 19:4029424-4029446 GAGGGTGCTGCGGGACCTGGCGG + Intronic
1161509538 19:4662889-4662911 CAGAGTCCTGGTGGAACTGGCGG - Intronic
1161533951 19:4807338-4807360 GAGGATCCTGGGGGAACTTCTGG + Intergenic
1161733594 19:5977484-5977506 AAGGATCCGGGGGGAACTGGCGG + Intronic
1161959543 19:7516184-7516206 GCGGGCCCGGGGGGAGCCGGCGG + Exonic
1162454060 19:10771967-10771989 AAGGGTCTTGGGGGAGGCGGGGG - Intronic
1162982707 19:14249324-14249346 GAGGGTTCTGGGGGGAGGGGGGG - Intergenic
1164509812 19:28888322-28888344 CAGGGTCCTGAGGGAGCCAGGGG - Intergenic
1164509839 19:28888418-28888440 CAGGGTCCTGAGGGAGCAGGCGG - Intergenic
1164672519 19:30080798-30080820 TGGGGTCCTGGGGGAAGCTGGGG + Intergenic
1165213892 19:34255185-34255207 GAGGGTCCGCGGGGACCGGGAGG + Intronic
1165261725 19:34624704-34624726 GAAGGTCCTGGGGCAACTGAAGG - Intronic
1165363901 19:35352312-35352334 GAGGCTCCTGGCGGAAGCTGGGG + Exonic
1165444490 19:35849348-35849370 GGGGGTCCTGGAGGGACTGGGGG + Exonic
1165866978 19:38945418-38945440 GAGGGTCCTGGGTGGTCCTGGGG + Intronic
1165958950 19:39518804-39518826 GGGGGTCCTGGGGGAGAGGGGGG + Intronic
1166011141 19:39943560-39943582 CAGGGGCCTGGGGGAAAGGGTGG + Intergenic
1166111687 19:40626854-40626876 GAGGGTCCTGGGTGGCCCCGGGG - Intronic
1166689659 19:44814763-44814785 GAGAGCCCTGGGTGAACGGGCGG + Intronic
1166694880 19:44846703-44846725 GAGGGGGCTCGGGGAGCCGGGGG - Intronic
1166777813 19:45323260-45323282 GAGGGCCCAGGGGGCACAGGGGG - Intergenic
1167851250 19:52204067-52204089 GAGGGTCCTGAGTGGAACGGAGG + Intronic
925146115 2:1584487-1584509 CATGGTCCTGGGGGATCCGGCGG - Intergenic
925610418 2:5696908-5696930 GAGCCTCCTGGGGGCTCCGGCGG + Exonic
926682190 2:15672533-15672555 GAGGGGCCTGGGGGAGCCTCAGG - Intergenic
927209892 2:20632646-20632668 ACGGGTCCTGGGGGAGCCTGAGG + Intronic
931054166 2:58450009-58450031 GAGGGGCTTGAGGGAACCTGGGG - Intergenic
932598825 2:73110789-73110811 GGGGGTGCTGGGGGAACAGGAGG - Intronic
934084952 2:88502256-88502278 CAGGGTGCTAGGGGAACCAGAGG - Intergenic
936251752 2:110873228-110873250 GAGGATCCTCGGGCAACAGGGGG + Intronic
937859448 2:126696479-126696501 GGGGGTGCTGGGGTACCCGGGGG + Exonic
938018274 2:127885648-127885670 GAGGGTCCGGGGGCAGCGGGGGG - Intronic
938392297 2:130915762-130915784 CAGGGGCCTGGGGGTGCCGGGGG + Intronic
941188334 2:162344497-162344519 GAGCGTCCTGGTGGAGCCGAGGG + Intronic
943247348 2:185473076-185473098 GAGGGGCCTGAGGCAACAGGGGG - Intergenic
944807130 2:203293707-203293729 TAGGGACTTGGGGGAAACGGTGG - Intronic
945100747 2:206260283-206260305 GGGGGTCCTGGGCGACCAGGTGG + Intergenic
946047756 2:216835309-216835331 GAGGTTCATGGGGGAACCTCAGG - Intergenic
946176041 2:217922506-217922528 GAGGGGACTGGTGGAACCTGGGG - Intronic
946376007 2:219309289-219309311 GGGGGTCTCGGGGGATCCGGGGG - Exonic
946690714 2:222306556-222306578 GGGCGTCCTGGGGCAACAGGAGG - Intergenic
946828792 2:223706261-223706283 GAGAGTCCTGGGGGAAGCCTTGG + Intergenic
947848290 2:233263277-233263299 GAGAGTCCTGTGGGGAGCGGGGG + Intronic
948900809 2:240956091-240956113 GAGGCACCTGGGGGAAACTGAGG - Intronic
1171389093 20:24789792-24789814 GAGGCTCCTGGGGGCAGCAGGGG - Intergenic
1172533793 20:35654631-35654653 GAAGGAACTGGGGGAATCGGGGG + Exonic
1172979031 20:38927097-38927119 GAGCGGCCCGGGGGATCCGGGGG - Intronic
1173613950 20:44390654-44390676 GTGGGTCCTGGGGGAAGCCCTGG - Intronic
1175999164 20:62824460-62824482 GGGGGCCCTGGGGGACCTGGCGG - Exonic
1176002161 20:62837160-62837182 GGGGGTCCTGGGGGCCCAGGGGG - Exonic
1178351152 21:31873695-31873717 CGGGCTCCTGGGGGAGCCGGCGG + Exonic
1178407310 21:32335252-32335274 GAGGGGCCTGGGGCAGCAGGAGG - Intronic
1178902030 21:36605944-36605966 GAGGGTCCTGGGGAAACCCCGGG + Intergenic
1179588246 21:42387740-42387762 GAGGCTGCTAGGGGAACCCGTGG + Intronic
1179949272 21:44700511-44700533 GAGGGGCCTGGAGGCCCCGGGGG + Intronic
1180079443 21:45480115-45480137 GAGGGTCCTGGGGGCCCTGGAGG - Exonic
1181164626 22:20976727-20976749 GAGGTTCCTGGGGGAGCGCGTGG + Exonic
1181768821 22:25111424-25111446 GAGGGGCCTCGGGGAGGCGGAGG - Intronic
1182766937 22:32764471-32764493 GCGGGTGCTGGAGGAACCAGTGG + Intronic
1183329510 22:37211900-37211922 GAGTGCCCTGGGGGCACCTGGGG - Exonic
1183467025 22:37984927-37984949 GAGGGTCCTGGGGGCCCGTGAGG + Intronic
1183776455 22:39969340-39969362 CAAGGCACTGGGGGAACCGGTGG + Intronic
1183933424 22:41248775-41248797 GAGGGTCCTGGGGTGTCCCGGGG - Intronic
1184640313 22:45866950-45866972 GAGGGCCCTGAGGAAGCCGGCGG + Intergenic
1184723861 22:46331845-46331867 GAGGGTCCTCAGGGAACCTCTGG + Intronic
1184995027 22:48199232-48199254 GAGGGTCCTGGGGAAGGGGGTGG + Intergenic
1185241697 22:49750473-49750495 CGGGGTCCTGGGGGAACGGTGGG + Intergenic
1185315118 22:50175645-50175667 GAGGGTCCTGGGGACTCTGGAGG - Intronic
1185409605 22:50674823-50674845 GAGGGTCCCGGCGGAGGCGGCGG - Intergenic
950142717 3:10626392-10626414 CAGGGTCCTGGGGGATCTGCAGG + Intronic
950864696 3:16179772-16179794 GAGGGTCCTCGGGGCAGAGGTGG + Intronic
951930919 3:27966286-27966308 GAGGGTCCTGGGGGCACAGTGGG + Intergenic
952954888 3:38550773-38550795 AAGGGTCCTGGGGGAGTCTGGGG - Exonic
954622890 3:52005810-52005832 GAGGGGCCTGGGGGCTGCGGGGG + Intergenic
954793879 3:53151692-53151714 GAGTGTCCTGGGGCTACTGGGGG - Intergenic
954794420 3:53154306-53154328 GAGGGTGCTTGAGGAACAGGAGG + Intergenic
955687696 3:61562594-61562616 GAGGGGGCTGGGGGACGCGGGGG + Intronic
960896700 3:122514215-122514237 GAGGGAGGTGGGGGAAGCGGGGG - Intronic
963049882 3:141132134-141132156 TAGGGACCTGGGGGAAAGGGTGG - Intronic
965412392 3:168348323-168348345 GAGAGTTCTGGGGGAAGCAGGGG + Intergenic
968636903 4:1685282-1685304 GAGGGGCCTGAGGGACCCTGCGG + Intergenic
968658041 4:1787054-1787076 GCGGGTCCTGGTGGGCCCGGAGG - Intergenic
968926258 4:3549990-3550012 CAGGGTCCTGGGGGAGCTGTGGG - Intergenic
969027169 4:4182827-4182849 GTGGGTCCTGGTGGGTCCGGTGG + Intergenic
969075635 4:4575567-4575589 GAGGCTCTTGGGGGCTCCGGAGG - Intergenic
969523235 4:7691125-7691147 GATGGTGCTGGGGGAAATGGAGG - Intronic
971852556 4:32001765-32001787 GTGGGTTCTTGGGGAACAGGTGG - Intergenic
984836003 4:184021928-184021950 GATGGTCCTGGGGGAGATGGGGG - Exonic
985505652 5:278813-278835 GAGGGTGCTGGGGACACAGGAGG + Intronic
985505668 5:278853-278875 GAGGGTGCTGGGGACACGGGAGG + Intronic
985844501 5:2334358-2334380 GAGGGTGCAGGGGGCACTGGAGG + Intergenic
987444737 5:18003809-18003831 GAGGGTGCAGGGGCAACCTGTGG - Intergenic
992931935 5:81656485-81656507 GAGGTTTCTGGGGGAACAGGTGG + Intronic
996404430 5:123091109-123091131 CGGGGTTGTGGGGGAACCGGCGG + Intronic
998007500 5:138666614-138666636 GAGGGGCCTGGGGAAGCCGGGGG + Intronic
1001981009 5:176037029-176037051 GAGGGTGGTGGGGGGAACGGGGG + Intergenic
1002236452 5:177807037-177807059 GAGGGTGGTGGGGGGAACGGGGG - Intergenic
1002695383 5:181085038-181085060 GAGGGTCCTGGGAGGACGAGAGG + Intergenic
1003301725 6:4889964-4889986 GCTGGCCCTGGGGGAACCAGTGG + Intronic
1004227115 6:13795859-13795881 GTGGGTTTTGGGGGAACAGGTGG - Intronic
1005821579 6:29603625-29603647 GAGGGTTCTGGGGGTGTCGGTGG + Exonic
1005873431 6:29994400-29994422 GAGGGTGCTGTGGGCACTGGTGG + Intergenic
1006075549 6:31529940-31529962 GAGGGTGCTGTGGGCACTGGGGG - Exonic
1006100429 6:31683014-31683036 GTGGGCCTTGAGGGAACCGGGGG + Intronic
1006194220 6:32228154-32228176 GAGGGGCCTGGGGCAACGAGGGG - Intergenic
1006301616 6:33196447-33196469 GAGGGTCCTGGGGGAACCGGGGG - Exonic
1006302080 6:33199191-33199213 GAGAATCCTGGGGGAGCTGGAGG + Exonic
1006466071 6:34195756-34195778 GAGGGTGCTGGGGCATCCTGGGG + Intergenic
1013196355 6:107848274-107848296 GAGGGGTCTGTGGGAGCCGGGGG + Intergenic
1013980394 6:116121475-116121497 GATGGTCCTGTGGGACCCTGAGG + Exonic
1015870228 6:137768842-137768864 GAGTGTGCTGGGGGAAACAGAGG + Intergenic
1016933067 6:149428204-149428226 GAGGGCCCTGGGGCACACGGAGG - Intergenic
1017787390 6:157767936-157767958 GAGGCTCCTGGGGGGACAGCTGG + Intronic
1017995060 6:159525175-159525197 AGGGGTCCTGGGGGAGCTGGTGG - Intergenic
1018710689 6:166496480-166496502 GAGGTTTCTGGGGGGACAGGGGG - Intronic
1018840684 6:167514303-167514325 GGGGGTGCTGGGGGAGCTGGGGG + Intergenic
1018934103 6:168262155-168262177 GAGGGTCCAGAGGAAACGGGAGG - Intergenic
1019061859 6:169262863-169262885 GAGGGGCCTGGTGGAACCCTGGG - Intergenic
1019061876 6:169262919-169262941 GAGGGGCCTGGTGGAACCCTGGG - Intergenic
1019145909 6:169975521-169975543 GAGGGCCCTGTGGGCACCAGAGG - Intergenic
1019307986 7:345123-345145 GGGGGTCCTTTGGGAACCTGTGG + Intergenic
1019552100 7:1608261-1608283 GGGGATCCTGGGGGCCCCGGGGG + Intergenic
1019605890 7:1910083-1910105 GAGAGTCCTGGGGTGACAGGCGG + Intronic
1019669739 7:2270942-2270964 GAGGGTCCTGCAGGCACAGGTGG + Intronic
1022953373 7:35359892-35359914 TAGGTTTCTGGGGGAACAGGTGG + Intergenic
1024530262 7:50385468-50385490 GAGGGTGCTGGGGGAGCTGGAGG + Intronic
1027233088 7:76283107-76283129 GAGGGTCTTGGGGGGGCCGGTGG + Intronic
1029105391 7:98171000-98171022 CAGGGTCCTGGGGAAGCTGGGGG + Intronic
1029422418 7:100478176-100478198 GAGGGCCTGGCGGGAACCGGGGG + Exonic
1029598304 7:101549182-101549204 GGGGGTCCTGGGGGACCTCGAGG - Exonic
1031047759 7:116912482-116912504 GAGGGTTCTGGGGGAAGGGCTGG - Intronic
1031815290 7:126426167-126426189 GAGAGAAATGGGGGAACCGGAGG + Intergenic
1033763181 7:144459389-144459411 GAGGGTCTTGGGGGAAAGGGTGG - Intronic
1034468855 7:151245400-151245422 GCGGGCCCTGGGGGACCCGCAGG - Intronic
1035039481 7:155917088-155917110 GAGGGGCCCGTTGGAACCGGAGG - Intergenic
1035464080 7:159063883-159063905 GGGGGTCCTGGGGGGATCTGGGG + Intronic
1035476894 7:159150027-159150049 GAGGGTCCTGGGAGTGACGGGGG + Intergenic
1035538065 8:407260-407282 GAGGGTCAGGTGGGGACCGGGGG + Intronic
1035637117 8:1155670-1155692 GAGGGGCCTGGGGGCCTCGGAGG - Intergenic
1038456300 8:27673878-27673900 GAGGGACCTGGGGGAGTCTGAGG + Intronic
1041045541 8:53882751-53882773 GAGGGTCCTGCTGGCACCGAGGG - Intronic
1043173912 8:77000379-77000401 GAGGGGCCTAGGGGAAGCCGGGG + Intronic
1046950254 8:120013539-120013561 GAGGGTCCTGGGGTGCCCTGTGG + Intronic
1049172019 8:141167359-141167381 GAGGGTCATGGGGGCTCCAGGGG - Intronic
1049582922 8:143420945-143420967 GAGGATCGTGGGGGCACAGGCGG - Intronic
1049707768 8:144050779-144050801 GCGGTCCCTGGGGGATCCGGGGG - Intergenic
1053801185 9:41765396-41765418 CAGGGTCCTGGGGGAGCTGTGGG - Intergenic
1054143598 9:61547459-61547481 GAGGGTCCTGGAGGCATGGGAGG - Intergenic
1054144016 9:61549441-61549463 CAGGGTCCTGGGGGAGCTGTGGG + Intergenic
1054189614 9:61977546-61977568 CAGGGTCCTGGGGGAGCTGTGGG - Intergenic
1054463793 9:65480797-65480819 CAGGGTCCTGGGGGAGCTGGGGG + Intergenic
1054732454 9:68714941-68714963 CAGGGTCCTGGGGGAACTCAGGG - Intronic
1056014627 9:82370720-82370742 GAGGGTCAAGGGGGTGCCGGAGG + Intergenic
1056900236 9:90592383-90592405 GAGGGTGCTGGGGGAGGTGGTGG - Intergenic
1057023023 9:91715218-91715240 GAGGGTCTTGGCAGAACCGTGGG + Intronic
1060799347 9:126533910-126533932 AAGGATCCTGGGGGAGCCTGGGG - Intergenic
1061042906 9:128150033-128150055 GGGAGTCCTGGGGGAAGAGGCGG - Intronic
1062051313 9:134448512-134448534 GAAGGGCCTGGGAGAACCGGAGG + Intergenic
1062116578 9:134812617-134812639 GAGGGTCCTCGGGGGCCAGGGGG - Exonic
1062460330 9:136660197-136660219 GAGGGTACTGGGGGTCCAGGGGG - Intronic
1062524279 9:136972020-136972042 GAGGGTCCTGGCAGGACCCGGGG + Intergenic
1062716391 9:138012371-138012393 GATGCTCCTGGGGGGACAGGTGG + Intronic
1185622701 X:1463347-1463369 GAGCCTCCAGGGGGAACTGGAGG - Exonic
1189463028 X:41257875-41257897 GAAGGTACTGGGGGAACCAATGG - Intergenic
1190107850 X:47572236-47572258 GGGGTCCCTGGGGGAACCGAGGG + Exonic
1190712952 X:53082636-53082658 GAGGCTCCAGGAGGAAACGGAGG + Exonic
1195792732 X:108606841-108606863 GTGCGTCCTGGAGGACCCGGAGG - Exonic
1195799142 X:108687529-108687551 GAGGTTCCAGGGGGACCTGGGGG - Exonic