ID: 1006301617

View in Genome Browser
Species Human (GRCh38)
Location 6:33196448-33196470
Sequence TGAGGGTCCTGGGGGAACCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 237}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006301617_1006301630 22 Left 1006301617 6:33196448-33196470 CCCCGGTTCCCCCAGGACCCTCA 0: 1
1: 0
2: 3
3: 23
4: 237
Right 1006301630 6:33196493-33196515 CCACAGCAAGCTCTGCCTCCAGG 0: 2
1: 161
2: 13899
3: 98792
4: 125071

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006301617 Original CRISPR TGAGGGTCCTGGGGGAACCG GGG (reversed) Exonic
900131298 1:1088338-1088360 TGGGGGTCTTGGGGGAGGCGTGG - Intronic
900389789 1:2428930-2428952 TGGGAGTCCTGGGGGCCCCGGGG + Intronic
900557721 1:3288599-3288621 TAGGGGTCCTGGTGGGACCGAGG + Intronic
900579179 1:3400080-3400102 TGAGGGTTTTGGGGAAAGCGAGG - Intronic
900969411 1:5981135-5981157 TGGCGGTGCTGGGGGAACCCAGG - Intronic
901319968 1:8333881-8333903 TGAGGTTCCTGGTGGCACCAAGG + Intronic
902677587 1:18019539-18019561 TGTGGGTCCTGGGGCAGCCTGGG + Intergenic
903759147 1:25685555-25685577 TGAAGGTCCTGGGGCAGCTGGGG + Intronic
903869946 1:26426664-26426686 TGAGGGTTCTGGGGGCAACCAGG + Exonic
904808931 1:33150914-33150936 TCAGAGTGCTGGGGGAACCTAGG + Intronic
904935630 1:34127813-34127835 TGAGGGTCCTAGTGGGACAGTGG + Intronic
906264589 1:44418339-44418361 TCAGAGTCCTGGGGGCACCAAGG - Intronic
906460263 1:46031107-46031129 TCAGGGCCCTCCGGGAACCGAGG - Exonic
912354256 1:109042154-109042176 TGAGGCGCCTCGGGGAAGCGCGG - Intergenic
914338157 1:146735947-146735969 TGAGGTTCCTGGGGAGATCGAGG - Intergenic
914381875 1:147123622-147123644 TGAGGACCCTGGTGGAAACGTGG - Intergenic
914754649 1:150556082-150556104 TGAGGCTCCCGAGGGGACCGGGG + Intronic
915287502 1:154862304-154862326 TGAGGGTCATGAGGGACCCAGGG + Intronic
915320273 1:155052374-155052396 GGAGGGTCCTGTGAGAACCTGGG + Intronic
920002216 1:202807889-202807911 TGAGGAGCGTGGGAGAACCGGGG - Intronic
920228196 1:204453094-204453116 GGAGGGTCCTGGGGAGGCCGAGG - Intronic
922077826 1:222265576-222265598 TGATGGTGTTGGGGGAAACGAGG - Intergenic
922414017 1:225403864-225403886 TGGGGGAGCTGGGGGAACTGGGG - Intronic
1064253597 10:13725680-13725702 CCAGGGCCCTGTGGGAACCGAGG + Intronic
1067419371 10:46133486-46133508 TGAGGGCCCTGGGGGGACACAGG - Intergenic
1067504722 10:46840083-46840105 TGAGGGCCCTGGGGGGACACAGG - Intergenic
1069558894 10:69415906-69415928 AGAGGGTCCTTGGGGAAGCTGGG - Intronic
1069642183 10:69963204-69963226 GGAGGGCCCTGGGGGTACAGGGG - Intronic
1070238689 10:74656254-74656276 TGTGGGCCCTGGGGGAAACTGGG - Intronic
1070813628 10:79310615-79310637 GGAGGGGCCTGGGGGAGCCCAGG + Intronic
1072048428 10:91680257-91680279 TTAGGCACCTGGGGGAACAGTGG - Intergenic
1072188204 10:93061512-93061534 GGAGGGTCCAGTGGGAGCCGGGG - Intronic
1073455536 10:103634729-103634751 TGAGGGTCCTCTGGGAACAGAGG + Intronic
1073626292 10:105101300-105101322 TCAGGGTCGTGGAGGAACTGTGG - Intronic
1074455041 10:113589137-113589159 AGCGTGTCCTGTGGGAACCGGGG - Exonic
1074884995 10:117686292-117686314 TGATGGTCCTTGGGGAACACTGG + Intergenic
1076519849 10:131074720-131074742 AGAGGCTGCTGGGGGAAACGTGG + Intergenic
1076674800 10:132142292-132142314 TAAGGGTCCTGGGGGAGGCGGGG + Intronic
1076837782 10:133029881-133029903 TGGGTGTCCTGGAGGAACGGGGG - Intergenic
1076837797 10:133029935-133029957 TGGGTGTCCTGGAGGAACGGGGG - Intergenic
1076837813 10:133029989-133030011 TGGGTGTCCTGGAGGAACGGGGG - Intergenic
1076837829 10:133030043-133030065 TGGGTGTCCTGGAGGAACGGGGG - Intergenic
1076837845 10:133030097-133030119 TGGGTGTCCTGGAGGAACGGGGG - Intergenic
1076837861 10:133030151-133030173 TGGGTGTCCTGGAGGAACGGGGG - Intergenic
1076874272 10:133208225-133208247 AGAGGGTCCTTGGGGTAACGGGG - Intronic
1076874290 10:133208271-133208293 AGAGGGTCCTTGGGGTAACGGGG - Intronic
1076874307 10:133208316-133208338 AGAGGGTCCTTGGGGTAACGGGG - Intronic
1076874325 10:133208362-133208384 AGAGGGTCCTTGGGGTAACGGGG - Intronic
1076874342 10:133208407-133208429 AGAGGGTCCTTGGGGTAACGGGG - Intronic
1076874360 10:133208453-133208475 AGAGGGTCCTTGGGGTAACGGGG - Intronic
1076874377 10:133208498-133208520 AGAGGGTCCTTGGGGTAACGGGG - Intronic
1076874395 10:133208544-133208566 AGAGGGTCCTTGGGGTAACGGGG - Intronic
1077194212 11:1271149-1271171 GGAGGGCCCTGGGGGAGCCTCGG + Intergenic
1077246542 11:1542040-1542062 TGAGGCTCCTGGAGGACCAGAGG + Intergenic
1077297289 11:1832163-1832185 TGGGGGTCCTGGGGTGACCAGGG + Intronic
1077305893 11:1868562-1868584 TGAGGGGGCTGGGGGAAGCCAGG + Intronic
1077351318 11:2094493-2094515 TGAGGGTCCCGGGGGAAAGCTGG + Intergenic
1077439817 11:2562586-2562608 TGAGGGTGCTGTGGGGACCCGGG - Intronic
1080138829 11:28890744-28890766 AGAGGCGCCTGCGGGAACCGGGG + Intergenic
1083750068 11:64755926-64755948 TGAGAGGGCTGGGGGAACCCAGG + Intronic
1084499214 11:69525029-69525051 TGAGGGGCTGGGGGGAACTGGGG + Intergenic
1084536597 11:69761022-69761044 TGTGTGTACTGGGGGAACAGGGG - Intergenic
1084881501 11:72174721-72174743 TGAGAGTGGTGGGGGAACAGAGG - Intergenic
1084978566 11:72816424-72816446 TGAGGGTCCTGAGGGAAGGAAGG - Intronic
1085342590 11:75743097-75743119 TGCTGGTCCTGGGGGAAGCAAGG - Intergenic
1085526522 11:77167243-77167265 CCAGGGTCCTCTGGGAACCGGGG + Intronic
1085717876 11:78889261-78889283 TGAGGGTATTGTGGGAACCAAGG - Intronic
1088986952 11:114917643-114917665 TGAGGGTCCTGGGAGCTCTGGGG - Intergenic
1089119043 11:116118976-116118998 TGAGGGTCAGGGGGGACCCTAGG - Intergenic
1089262619 11:117232846-117232868 GGAGGGTGCTGTGAGAACCGAGG + Intronic
1091683126 12:2540963-2540985 TGAGGGTCATGAGGGAAAAGGGG + Intronic
1091893640 12:4083067-4083089 TGAGGCTGCTGGGGGAACCCTGG - Intergenic
1095954982 12:47800702-47800724 AGAGGGGCTTGGGGGAACCAAGG + Intronic
1101417667 12:104522552-104522574 TGAGTGGTCTGGGGGAACCCTGG - Intronic
1101507474 12:105360578-105360600 TGATGGGCATGGGGGAACTGAGG - Intronic
1101819904 12:108175636-108175658 TGAGGGGCGTGTGGGAACCCAGG + Intronic
1101905908 12:108826366-108826388 TGATTGTCGTGGGGGAACAGAGG - Intronic
1102247768 12:111366062-111366084 GGAGGGTCCTGTGAGAACCGGGG - Intronic
1103210088 12:119159233-119159255 TGAGGTTCCTGGGGGACAGGAGG - Exonic
1103938982 12:124491805-124491827 TGAGGGTCCTGGGGAAGCGAGGG - Intronic
1104719871 12:131039305-131039327 TGAGGGTCCTGGTGGGACTGGGG - Intronic
1104842192 12:131830514-131830536 TGCTGGCCCTCGGGGAACCGCGG + Intronic
1105794281 13:23834716-23834738 CGAGGGCCCTGGGGGAACTGGGG - Intronic
1109145373 13:58773319-58773341 AGAGGCTCCCGCGGGAACCGGGG + Intergenic
1113645961 13:111996240-111996262 GGAGGGTCCTGTGGGAGCCGGGG - Intergenic
1114663911 14:24367702-24367724 GGAGGGTCCTGGGGGCAGAGTGG - Intronic
1119385919 14:74258128-74258150 TGGGGGTCCCCGGGGAAGCGGGG + Intronic
1119765020 14:77182489-77182511 TGAAGGCCCTGGGGAAACTGAGG + Intronic
1119856541 14:77905215-77905237 TCAGGGTCCTGGGTGTACTGCGG - Intronic
1122693779 14:103543248-103543270 TGAGGGCCCTGGGGACACAGAGG + Intergenic
1122800495 14:104227000-104227022 TGTGGGGCCTGGGGGCACAGAGG + Intergenic
1122843056 14:104476082-104476104 TGGGAGTCCAGGGGGACCCGAGG - Intronic
1123671711 15:22665085-22665107 TGAGGGTACTGGGGAGCCCGTGG - Intergenic
1123784324 15:23654156-23654178 TGTGTGTGCTGGGGGAACCAAGG - Intergenic
1124323751 15:28738310-28738332 TGAGGGTACTGGGGAGCCCGTGG - Intronic
1124527643 15:30471551-30471573 TGAGGGTACTGGGGAGCCCGTGG - Intergenic
1124771016 15:32536151-32536173 TGAGGGTACTGGGGAGCCCGTGG + Intergenic
1127961065 15:63891330-63891352 TGTCGGTCCTGAGGGAAACGAGG + Intergenic
1128382214 15:67121348-67121370 TGTGGGTCCTGAGGGCATCGTGG + Intronic
1129177097 15:73848009-73848031 TGAGAGTCCTGGGGGAAAGAGGG + Intergenic
1130964943 15:88690147-88690169 TGAGGGTGCTGGGAGCACCCAGG - Intergenic
1135625105 16:23988053-23988075 TGAGGGTCATGTGGAAACAGAGG - Intronic
1136063166 16:27740682-27740704 TGAGGGTCCTGGAGAGACCGAGG + Exonic
1136501331 16:30670863-30670885 TGTGGGTCCTGGGGTAAGGGAGG + Intergenic
1137620444 16:49873180-49873202 TGATAGTCCTGGGGGAATCTGGG - Intergenic
1139996122 16:70981394-70981416 TGAGGTTCCTGGGGAGATCGAGG + Exonic
1141828910 16:86498672-86498694 TGGGGGGCCTCGGGGCACCGGGG - Intergenic
1142413222 16:89926469-89926491 TTGGGGTCCTGGGGAAAGCGGGG - Intronic
1143134502 17:4704045-4704067 TGGGGTTCCTGGCGGGACCGGGG - Exonic
1143137566 17:4720301-4720323 TGAGTGTCATGGGGGAGCCTGGG + Intronic
1143532382 17:7512879-7512901 TGAGGGACCTGGGGACCCCGGGG - Exonic
1144068359 17:11644373-11644395 TGAGGGTGCTGGTGGAGCTGCGG + Intronic
1144855550 17:18265432-18265454 TGAGGGTCCTGGGGGAGCTGAGG + Exonic
1146176115 17:30667582-30667604 TGAGGGTTCTGGGGGGAGGGGGG + Intergenic
1146349572 17:32083692-32083714 TGAGGGTTCTGGGGGGAGGGGGG + Intergenic
1147318474 17:39632277-39632299 TGAGGGAGGTGGGGGAAGCGAGG + Intronic
1147381050 17:40056520-40056542 TGAGGGGCCTGGGAGAACAGGGG - Intronic
1148358275 17:46991053-46991075 TTATGTTCCTGGTGGAACCGTGG + Intronic
1149659446 17:58326722-58326744 TGAGGGCCCTGGGGGAGCTGCGG - Exonic
1150462671 17:65365591-65365613 TGAAGGTGTTGGGGGAACAGGGG + Intergenic
1152245348 17:79182431-79182453 CGAGGGGCCTGGGGGAGACGAGG + Intronic
1152778823 17:82217536-82217558 TGAGGGAGCTGGGGGGACCCTGG + Intergenic
1158248865 18:55464095-55464117 TCAGGGTCCTGGGGGAATGGAGG - Exonic
1158582063 18:58692216-58692238 TGAGGCTCCAGGGGGACCCCAGG - Intronic
1159880346 18:73852992-73853014 TGAGGGTCATGGTGGAGCCTGGG - Intergenic
1160225571 18:77008635-77008657 GAAGGGCCCTGGGGGAGCCGGGG - Intronic
1160276617 18:77443262-77443284 AGAGGTTCCTGGGGGCACGGTGG - Intergenic
1160873534 19:1287259-1287281 TGGGGGTCCCGTGGGAGCCGGGG + Intronic
1162478646 19:10915539-10915561 TGGGGGACCTGGGGGCACCATGG - Intronic
1164265376 19:23610900-23610922 TGCAGGTCCTGGGTGAACTGTGG + Intronic
1164509803 19:28888292-28888314 TGAGGGTCCTAAGGGAGCCAGGG - Intergenic
1164705143 19:30314180-30314202 TGAAGGGCCTGGGGGCCCCGGGG + Intronic
1165108485 19:33487932-33487954 TGAGGGCCCTGGGGAAGCCCAGG + Intronic
1165767661 19:38361207-38361229 TGAGGGTCTTGGGAGAGCCATGG + Intronic
1165958949 19:39518803-39518825 TGGGGGTCCTGGGGGAGAGGGGG + Intronic
1166777814 19:45323261-45323283 TGAGGGCCCAGGGGGCACAGGGG - Intergenic
1166984001 19:46649114-46649136 TGCGGGCCCTGGGCGAGCCGCGG + Exonic
1167103954 19:47419696-47419718 GGAGGGGCCTGGGGGCACCAGGG - Intergenic
1167385573 19:49161071-49161093 TGAGCGGCCTAGGGGGACCGAGG + Intronic
1168094471 19:54106846-54106868 TGAGGGTCCTGGGGGTGGCTGGG - Exonic
925906311 2:8541586-8541608 TGAGGTTCCTGGAGGCACTGAGG - Intergenic
928023280 2:27720615-27720637 TGAGGGGACTGGGGAAACTGTGG - Intergenic
933633305 2:84680651-84680673 TGAGGATGCTGGGGGAAGGGTGG + Intronic
933911253 2:86942832-86942854 GAAGAGTCCTGGGGGGACCGCGG + Intronic
934563721 2:95326904-95326926 TGCGGGTGCTGGGGGCAGCGAGG - Intronic
934945422 2:98537754-98537776 TCAGGGTCCTGGGGGCAGCAGGG - Intronic
935122291 2:100193506-100193528 TGAGGGGCCTGGAGGAAATGAGG - Intergenic
935732443 2:106075194-106075216 TGAGGTTCCTGGGGCAAGGGTGG + Intronic
935904963 2:107829673-107829695 GAAGAGTCCTGGGGGGACCGCGG + Intronic
936126740 2:109794745-109794767 GAAGAGTCCTGGGGGGACCGCGG + Intronic
936217957 2:110576741-110576763 GAAGAGTCCTGGGGGGACCGCGG - Intronic
936427294 2:112432815-112432837 GAAGAGTCCTGGGGGGACCGCGG - Intronic
938073555 2:128320361-128320383 CGAGGGTCCTGGGGGCAGCTTGG + Intergenic
941188333 2:162344496-162344518 GGAGCGTCCTGGTGGAGCCGAGG + Intronic
943081298 2:183261470-183261492 TGAGGGTTCTGGGGGCAACCAGG + Intergenic
943471341 2:188297568-188297590 TGAAGTTCCTGGGGGAACCATGG + Intronic
944836675 2:203587179-203587201 TGAGGGGGCTGGGAGAACCAGGG + Intergenic
946225391 2:218261624-218261646 TCAGGGTGCTGGGGGAACCTGGG + Intronic
946376008 2:219309290-219309312 TGGGGGTCTCGGGGGATCCGGGG - Exonic
947594064 2:231399883-231399905 TGAGGGGCCTGGGGGTGCTGAGG - Exonic
947848289 2:233263276-233263298 TGAGAGTCCTGTGGGGAGCGGGG + Intronic
948523463 2:238556767-238556789 AGAGGGTCTTGGGAGACCCGAGG + Intergenic
948615603 2:239196785-239196807 TGAGTGACCTCGGGGAATCGAGG + Intronic
948865475 2:240772759-240772781 TGTGGGTGCTGGGGTCACCGAGG - Intronic
948867400 2:240782855-240782877 TGAGGGTCCCGGGAGAAACCAGG + Intronic
1169838598 20:9908635-9908657 TGGGGGTCCTGGGGGAAGTGGGG - Intergenic
1170528545 20:17266257-17266279 TGAGGGTCACCAGGGAACCGAGG - Intronic
1171389094 20:24789793-24789815 TGAGGCTCCTGGGGGCAGCAGGG - Intergenic
1172669801 20:36627162-36627184 AGAGGGTCCAGAGGGAACAGTGG + Intronic
1175306208 20:57977293-57977315 TGCAGGTCCTGGAGGAACCCGGG - Intergenic
1176002162 20:62837161-62837183 TGGGGGTCCTGGGGGCCCAGGGG - Exonic
1176033711 20:63026171-63026193 TGAGGGGCCTGAGGAAGCCGCGG + Intergenic
1176096253 20:63345810-63345832 TCAGGGTCCTGGGGGAACCAGGG + Exonic
1176232736 20:64040364-64040386 TGAGGGCCCTGAGGGAGCTGGGG + Intronic
1178902029 21:36605943-36605965 TGAGGGTCCTGGGGAAACCCCGG + Intergenic
1179850173 21:44133708-44133730 TGAGGGTCCTGGTGGCCTCGAGG + Exonic
1181018894 22:20087977-20087999 TGAGGGTCCTGGTGGAGATGTGG + Intronic
1182841707 22:33395956-33395978 TTAGAGTCCTGGGGGAAAAGGGG - Intronic
1183062418 22:35344394-35344416 TGAGGGTCTTGCGGGACCCCAGG + Intronic
1183271666 22:36866131-36866153 TGGGGGCCCTGGGGGCACGGAGG - Intronic
1183539814 22:38423484-38423506 TGAAGGGCCTGGGGGGACCTTGG + Intergenic
1183832548 22:40426083-40426105 TGAGGGGCCTGGAGGAAGGGTGG + Intronic
1183947948 22:41337560-41337582 TGGGGGGCCTGGGGCTACCGTGG + Intronic
1184652168 22:45924440-45924462 TGAAGGTGCTGCGGGAACCCAGG + Intronic
1185241696 22:49750472-49750494 ACGGGGTCCTGGGGGAACGGTGG + Intergenic
950842821 3:15983716-15983738 TGAGGGTGGTGGGGGAAGGGAGG + Intergenic
951930918 3:27966285-27966307 GGAGGGTCCTGGGGGCACAGTGG + Intergenic
953701335 3:45198293-45198315 TTAGGGTCCTGGGAGCACCATGG + Intergenic
954135419 3:48580040-48580062 CGGGGGTCCTGGGGGACCCTGGG + Exonic
955864969 3:63372534-63372556 TGAGGGTTGTGGGGGAAAGGGGG - Intronic
958436517 3:94103318-94103340 TTAGGGTGCTGGGGGAATAGAGG + Intronic
960141856 3:114158933-114158955 TGAGAGCCCTGGGGGAAAGGAGG - Intronic
960280279 3:115773748-115773770 TGAGGGTTCTAGGGGAAGTGGGG + Intergenic
961748482 3:129081405-129081427 TGGGGATCCTGGGGGCACAGTGG - Intergenic
961793218 3:129391520-129391542 TGAGGGTCCTGGTGGACTGGAGG + Intergenic
967129820 3:186460130-186460152 TGAGTGTCCTGGGGGCTCTGAGG - Intergenic
968457720 4:707438-707460 TCAGGGTCCCGGGGGAGACGGGG - Intronic
968926259 4:3549991-3550013 TCAGGGTCCTGGGGGAGCTGTGG - Intergenic
968929118 4:3566822-3566844 TGGGGGGCCTGGGGGGACTGGGG + Intergenic
969443622 4:7232163-7232185 TGCGGGCCCTGGGGGAAGCATGG + Intronic
972668955 4:41195571-41195593 TGAGGGTCCTGTGGCAGCTGTGG - Intronic
982217742 4:153096697-153096719 TGAGAATCCTGGGGAAACAGAGG + Intergenic
984805379 4:183746797-183746819 AGAGGTGCCTGCGGGAACCGGGG - Intergenic
984806690 4:183757982-183758004 TGAGGGTCCCGGGGGAGCTGGGG + Intergenic
985548511 5:521762-521784 TGAGGGTCCTCTGGGAACACAGG + Intronic
990937024 5:61162301-61162323 GGAGGGTCCTGGGAGATCCTGGG + Exonic
998007499 5:138666613-138666635 TGAGGGGCCTGGGGAAGCCGGGG + Intronic
999152287 5:149434137-149434159 TGAGATTCCTGGGGGTATCGGGG + Intergenic
999238774 5:150115504-150115526 TGAGTTCCCTGGGGGAACCCTGG + Exonic
1002187552 5:177461496-177461518 TGAGGGCCCTGAGGGAAGAGAGG - Intronic
1002825955 6:774537-774559 AAAGGGTCCTGGGGAAACTGAGG + Intergenic
1003399139 6:5777155-5777177 TGAGGGTGCTGCAGGAACCACGG - Intergenic
1004358410 6:14949792-14949814 TGAGGGCCCTGGCGGAATTGTGG - Intergenic
1005738945 6:28773399-28773421 TGAGGGTCCAGGCGGAAGTGCGG + Intergenic
1005754177 6:28910853-28910875 TGAGGTTCCTGAGGGATCCTAGG - Intronic
1006301617 6:33196448-33196470 TGAGGGTCCTGGGGGAACCGGGG - Exonic
1006466070 6:34195755-34195777 TGAGGGTGCTGGGGCATCCTGGG + Intergenic
1006900694 6:37499117-37499139 TGAGGTTCCAGGTGGAACCCAGG - Intronic
1008517311 6:52330331-52330353 TGAGGGTGCTGAGGGAGCCTTGG + Intergenic
1015822567 6:137280046-137280068 TGCTGGGCCTGGGGGAAACGTGG + Intergenic
1016091245 6:139982026-139982048 TTAGAGTCCTGGGGGAAGGGCGG - Intergenic
1018710690 6:166496481-166496503 TGAGGTTTCTGGGGGGACAGGGG - Intronic
1018867347 6:167756524-167756546 TGCTGGTCCTGGGGGAGCTGTGG - Intergenic
1018968671 6:168509195-168509217 TGAAGGGCCTGGGGCCACCGTGG + Intronic
1019061860 6:169262864-169262886 GGAGGGGCCTGGTGGAACCCTGG - Intergenic
1019061877 6:169262920-169262942 GGAGGGGCCTGGTGGAACCCTGG - Intergenic
1019282115 7:205820-205842 TGGGGGGCCTGGGGGTGCCGTGG - Intronic
1019738217 7:2660691-2660713 GGAGGGCCCTCGGGGACCCGGGG + Intronic
1024886729 7:54150557-54150579 CCTGGGGCCTGGGGGAACCGGGG + Intergenic
1029200399 7:98835590-98835612 TGAGTGTCCTGGGGTAGCCAGGG - Intergenic
1029215904 7:98949524-98949546 TGCTGGTGCTGGGCGAACCGGGG - Exonic
1029372060 7:100156606-100156628 TGTGGATCCTGGAGGAATCGTGG - Intronic
1029464504 7:100716760-100716782 TCAGGGTCCTGGGAGAGCAGAGG + Intergenic
1030862837 7:114658163-114658185 TGAGGGTCCCTGGGTAATCGGGG - Exonic
1031893926 7:127326040-127326062 TGAGGGTCTTGTGGGAAACATGG - Intergenic
1035464079 7:159063882-159063904 TGGGGGTCCTGGGGGGATCTGGG + Intronic
1035692193 8:1567582-1567604 TAATGATCCTGGGGGACCCGTGG - Intronic
1035736287 8:1889671-1889693 TGAGGGTCGTGAGGAAACAGTGG + Intronic
1038425879 8:27463362-27463384 TGTGGGTGCTGGGGGAGCGGTGG + Exonic
1041045542 8:53882752-53882774 CGAGGGTCCTGCTGGCACCGAGG - Intronic
1048432733 8:134385314-134385336 AGAGGGACCTGGGAGAACCTGGG - Intergenic
1048450311 8:134527704-134527726 TGAGGATCCTGTGGGAAGAGGGG - Intronic
1049476430 8:142799176-142799198 TGAGGGTCTGGGGGCAAACGGGG - Intergenic
1049535767 8:143181035-143181057 TGAGGATCCGTGGGGATCCGTGG - Intergenic
1049702322 8:144020881-144020903 AGAGGGTCCTGAGGGAAGAGGGG - Intronic
1050536137 9:6632676-6632698 TGAGGGCCCGGGCTGAACCGGGG - Intronic
1052203906 9:25814731-25814753 GAAGGGTCCTGAGGGAACCATGG + Intergenic
1053801186 9:41765397-41765419 TCAGGGTCCTGGGGGAGCTGTGG - Intergenic
1054144015 9:61549440-61549462 TCAGGGTCCTGGGGGAGCTGTGG + Intergenic
1054189615 9:61977547-61977569 TCAGGGTCCTGGGGGAGCTGTGG - Intergenic
1054463792 9:65480796-65480818 TCAGGGTCCTGGGGGAGCTGGGG + Intergenic
1054648899 9:67611062-67611084 TCAGGATCCTGGGGGAGCTGTGG + Intergenic
1054732455 9:68714942-68714964 GCAGGGTCCTGGGGGAACTCAGG - Intronic
1055078198 9:72238731-72238753 TGATGGTCCTGGGGGAGTAGTGG + Intronic
1056659886 9:88535742-88535764 TGGGGGTCCTGGGGGGGCGGGGG + Intronic
1057023022 9:91715217-91715239 TGAGGGTCTTGGCAGAACCGTGG + Intronic
1058669344 9:107347473-107347495 GGAGGGCCCTGGGGGAACACAGG + Intergenic
1061295940 9:129676758-129676780 TGTGGGTGCTGGGAGACCCGGGG + Intronic
1186084390 X:5971013-5971035 TGAGGTTCCTCAGGGAACAGCGG - Intronic
1187460846 X:19485568-19485590 TCAGGGTCCTGGGGAAGCCTGGG + Intronic
1190107849 X:47572235-47572257 GGGGGTCCCTGGGGGAACCGAGG + Exonic
1191249254 X:58252314-58252336 AGAGATTCCTGGGGGAACCCAGG + Intergenic
1192323106 X:70108120-70108142 TGAGGGCACTTGGGGAACAGTGG - Intergenic
1193574836 X:83184709-83184731 AGAAGGTCCTGGGGTAACTGAGG - Intergenic