ID: 1006301618

View in Genome Browser
Species Human (GRCh38)
Location 6:33196449-33196471
Sequence TTGAGGGTCCTGGGGGAACC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 240}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006301618_1006301630 21 Left 1006301618 6:33196449-33196471 CCCGGTTCCCCCAGGACCCTCAA 0: 1
1: 0
2: 1
3: 8
4: 240
Right 1006301630 6:33196493-33196515 CCACAGCAAGCTCTGCCTCCAGG 0: 2
1: 161
2: 13899
3: 98792
4: 125071

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006301618 Original CRISPR TTGAGGGTCCTGGGGGAACC GGG (reversed) Exonic
900738693 1:4317091-4317113 TTCAGAGTGTTGGGGGAACCTGG + Intergenic
902677586 1:18019538-18019560 CTGTGGGTCCTGGGGCAGCCTGG + Intergenic
904947858 1:34212552-34212574 GTGTGGGTCCTGGAGGGACCTGG + Intronic
908401348 1:63774793-63774815 TTGAGGGTCCTGGGGGTGATCGG + Intronic
908412965 1:63885267-63885289 TTGGGGCTCCTAGGGAAACCAGG + Intronic
909999846 1:82329265-82329287 TTGGGTATCCTGGAGGAACCTGG + Intergenic
911580204 1:99625329-99625351 TTTTGAGTCCTGGGGGAACTGGG - Intergenic
914259108 1:145983957-145983979 TTGGGAGTCCTGGGGGAAAATGG + Intergenic
915287501 1:154862303-154862325 GTGAGGGTCATGAGGGACCCAGG + Intronic
915320272 1:155052373-155052395 GGGAGGGTCCTGTGAGAACCTGG + Intronic
920656486 1:207879388-207879410 TGGAAGGTACTGGGGGACCCTGG - Intergenic
921398522 1:214694477-214694499 TTGTGGGTCTTGTGGGAGCCAGG - Intergenic
922870597 1:228899070-228899092 TTGTGGGGCATGAGGGAACCTGG + Intergenic
922961457 1:229649970-229649992 GAGAGGGTCCTTGGGGAACTGGG + Intronic
1063378568 10:5569960-5569982 GAGAGTGTCCTGGGGGATCCTGG - Intergenic
1063592936 10:7409937-7409959 TGGAGGGAGCTGGGGGATCCTGG - Intronic
1063896235 10:10685142-10685164 TTGATGATCCTCTGGGAACCAGG + Intergenic
1066669352 10:37820561-37820583 TTGAGTTTGCTGGGGGAAGCGGG - Intronic
1067070463 10:43127154-43127176 AGGAGGGGTCTGGGGGAACCTGG - Intronic
1067083520 10:43226542-43226564 TGGGGGCTCCTGAGGGAACCCGG - Intronic
1067260827 10:44689625-44689647 AGGAGGGTCCTGGGCGTACCTGG + Intergenic
1069558895 10:69415907-69415929 AAGAGGGTCCTTGGGGAAGCTGG - Intronic
1070238690 10:74656255-74656277 CTGTGGGCCCTGGGGGAAACTGG - Intronic
1070841533 10:79491052-79491074 TTTAGGGACCTGGGGGAAGGAGG - Intergenic
1072540474 10:96394481-96394503 TGTAGGGTCCTGATGGAACCAGG - Intronic
1072609989 10:97011504-97011526 TAGTGGGTCCTGGGAGAACAGGG - Intronic
1073071368 10:100795754-100795776 TTTAGGGTCCTGTGTGGACCTGG + Intronic
1074455042 10:113589138-113589160 TAGCGTGTCCTGTGGGAACCGGG - Exonic
1075437703 10:122457801-122457823 TTGAGGGGCATGGGGGACGCTGG + Intergenic
1075662165 10:124205475-124205497 ATCAGGGTCCTGGGTGACCCAGG + Intergenic
1075746586 10:124732299-124732321 TAGTGGAACCTGGGGGAACCAGG - Intronic
1076130608 10:128011400-128011422 TTGAGGTGACTGGGGGACCCCGG + Intronic
1076674799 10:132142291-132142313 GTAAGGGTCCTGGGGGAGGCGGG + Intronic
1076837783 10:133029882-133029904 TTGGGTGTCCTGGAGGAACGGGG - Intergenic
1076837798 10:133029936-133029958 TTGGGTGTCCTGGAGGAACGGGG - Intergenic
1076837814 10:133029990-133030012 TTGGGTGTCCTGGAGGAACGGGG - Intergenic
1076837830 10:133030044-133030066 TTGGGTGTCCTGGAGGAACGGGG - Intergenic
1076837846 10:133030098-133030120 TTGGGTGTCCTGGAGGAACGGGG - Intergenic
1076837862 10:133030152-133030174 TTGGGTGTCCTGGAGGAACGGGG - Intergenic
1076874273 10:133208226-133208248 TAGAGGGTCCTTGGGGTAACGGG - Intronic
1076874291 10:133208272-133208294 TAGAGGGTCCTTGGGGTAACGGG - Intronic
1076874308 10:133208317-133208339 TAGAGGGTCCTTGGGGTAACGGG - Intronic
1076874326 10:133208363-133208385 TAGAGGGTCCTTGGGGTAACGGG - Intronic
1076874343 10:133208408-133208430 TAGAGGGTCCTTGGGGTAACGGG - Intronic
1076874361 10:133208454-133208476 TAGAGGGTCCTTGGGGTAACGGG - Intronic
1076874378 10:133208499-133208521 TAGAGGGTCCTTGGGGTAACGGG - Intronic
1076874396 10:133208545-133208567 TAGAGGGTCCTTGGGGTAACGGG - Intronic
1076875873 10:133215249-133215271 CTGAAGGCTCTGGGGGAACCAGG + Intronic
1077297288 11:1832162-1832184 CTGGGGGTCCTGGGGTGACCAGG + Intronic
1077439818 11:2562587-2562609 CTGAGGGTGCTGTGGGGACCCGG - Intronic
1078612055 11:12829389-12829411 TTCAGGGTCCTGGGTGAGCATGG - Intronic
1083173289 11:60935165-60935187 GTGAGGGTGCTGGGAGCACCCGG + Intronic
1083626850 11:64076256-64076278 TGGAGGGTCATGGGGGCACCTGG - Intronic
1083922840 11:65789777-65789799 TTGAGGGTCTCAGAGGAACCTGG - Intronic
1085344704 11:75761061-75761083 AAGAGGGTTCTGGGGGAATCAGG - Intronic
1087140485 11:94760827-94760849 TTGATGGTTTTGGGGGAACAGGG + Intronic
1087275668 11:96158319-96158341 TTGTTGGTCCTGGGGTGACCAGG + Intronic
1088887890 11:114021835-114021857 TTGAGGATCCAGGGTGCACCCGG + Intergenic
1090446464 11:126768788-126768810 TTGATGGTCCTGGGGAAAGGAGG + Intronic
1090700441 11:129290172-129290194 TTGTGGGTCCTGGGTAACCCTGG + Intergenic
1092237327 12:6818558-6818580 TTGAGGGCCTTGTGGGGACCAGG - Intronic
1094488012 12:30940203-30940225 CTTAGGTTCCTTGGGGAACCAGG + Intronic
1096499928 12:52058611-52058633 TTTAGGGGCCTGGGGGAGGCTGG + Intronic
1096560864 12:52434800-52434822 TTGATGGGGCTTGGGGAACCAGG - Intergenic
1099732041 12:86517539-86517561 ATGAGGCTCCTGGGAAAACCAGG + Intronic
1100001642 12:89843903-89843925 TTGAGGGTCCCAGGGGATCTTGG + Intergenic
1102211860 12:111133052-111133074 ATGAGGATCCTGTGGGGACCTGG - Intronic
1102247769 12:111366063-111366085 GGGAGGGTCCTGTGAGAACCGGG - Intronic
1103938983 12:124491806-124491828 CTGAGGGTCCTGGGGAAGCGAGG - Intronic
1104696838 12:130870746-130870768 CTGAGGGTTCTGGGGGAGCTCGG + Intergenic
1104719872 12:131039306-131039328 GTGAGGGTCCTGGTGGGACTGGG - Intronic
1104841792 12:131829146-131829168 TTGAGGGTGTTGGGGGCACAGGG + Intronic
1105407492 13:20144285-20144307 TTGAGGATCCTGTGAGGACCAGG + Intronic
1105794282 13:23834717-23834739 ACGAGGGCCCTGGGGGAACTGGG - Intronic
1112920694 13:104608583-104608605 TTGTGGGTGATGGGGGAAGCAGG - Intergenic
1113399707 13:109979564-109979586 CTGTGGGTCCTGGGGGAGCATGG + Intergenic
1113645962 13:111996241-111996263 GGGAGGGTCCTGTGGGAGCCGGG - Intergenic
1114000415 14:18234986-18235008 TTGAGGGTCTTGTTGGAAACGGG - Intergenic
1119190803 14:72680463-72680485 TGGAGGGTCCTGTGGGGAGCGGG - Intronic
1119385918 14:74258127-74258149 TTGGGGGTCCCCGGGGAAGCGGG + Intronic
1122209472 14:100165714-100165736 TGGAGGAGCCTTGGGGAACCTGG - Intergenic
1122366538 14:101197948-101197970 GAGAGGGTGCTGGGGAAACCGGG - Intergenic
1122413352 14:101537145-101537167 TGGAGGGTGCTGGGAGACCCTGG + Intergenic
1122664590 14:103319755-103319777 TTGGGGGTGCTGGGGGCACTTGG + Intergenic
1123995376 15:25714302-25714324 TGGAGCATCCTGTGGGAACCAGG - Intronic
1125727864 15:41877258-41877280 CTGAGGGTCCTGGGGCAGCAGGG - Exonic
1126840352 15:52711571-52711593 TTTGGGGTCCTGGAGGAAACTGG - Intergenic
1128345327 15:66849497-66849519 TTGAGGGTGTTGGGGGATCCTGG - Intergenic
1129177096 15:73848008-73848030 ATGAGAGTCCTGGGGGAAAGAGG + Intergenic
1133237659 16:4395092-4395114 TTGTGGGTCCTGGGAGGGCCTGG - Intronic
1133393715 16:5429489-5429511 TTGAGGGGCCTGTGGGGTCCTGG + Intergenic
1134445282 16:14326513-14326535 TTGAGTGTTTTGTGGGAACCAGG + Intergenic
1136584416 16:31174769-31174791 TTGGGGGTCCTGGGGGTGGCTGG - Intergenic
1136886299 16:33932253-33932275 TAGAGGGTCCTGGGGAAAGGTGG - Intergenic
1137620445 16:49873181-49873203 GTGATAGTCCTGGGGGAATCTGG - Intergenic
1140154755 16:72412447-72412469 TTGAGGGTGGTGGGAAAACCTGG - Intergenic
1203086139 16_KI270728v1_random:1185580-1185602 TAGAGGGTCCTGGGGAAAGGTGG + Intergenic
1143091237 17:4450128-4450150 TGGTGGGTCCTGGGGGCTCCTGG + Intronic
1143137565 17:4720300-4720322 GTGAGTGTCATGGGGGAGCCTGG + Intronic
1143532383 17:7512880-7512902 TTGAGGGACCTGGGGACCCCGGG - Exonic
1145791992 17:27633019-27633041 TTGGAGGGCCTGGGGGAAGCTGG + Intronic
1146570472 17:33948337-33948359 ATGAGGCTCCTGCGGGAGCCTGG - Intronic
1146581069 17:34039588-34039610 TTGAGTTTGCTGGGGGAAGCGGG - Intronic
1147381051 17:40056521-40056543 GTGAGGGGCCTGGGAGAACAGGG - Intronic
1148866543 17:50631717-50631739 GTGAGTGTCCCAGGGGAACCCGG - Intergenic
1149134939 17:53353468-53353490 TAGAAGGTCCTGGGGGCACTTGG + Intergenic
1149409468 17:56390342-56390364 TTCAGGGACATGGGTGAACCTGG - Intronic
1149657384 17:58317439-58317461 TTGAGGTTGCTGGGGTAGCCTGG + Intronic
1150296149 17:64008697-64008719 TTGAGGGTCTCCTGGGAACCAGG - Intronic
1150462670 17:65365590-65365612 TTGAAGGTGTTGGGGGAACAGGG + Intergenic
1151284474 17:73100023-73100045 TGGAGGGCACTGGGGGAATCAGG - Intergenic
1152337523 17:79706994-79707016 CTGAGGGCCCTGGAGGAGCCAGG - Intergenic
1153323590 18:3796064-3796086 TTGGGGCTGCTGGGGAAACCTGG - Intronic
1154715050 18:17939804-17939826 TTGAGGATTTTGGGGGAAACGGG + Intergenic
1154788221 18:18943237-18943259 TTGAGGATTTTGGGGGAAACGGG + Intergenic
1155933252 18:31728268-31728290 AAGAGGGTCCTGGTGGATCCTGG - Intergenic
1159880347 18:73852993-73853015 GTGAGGGTCATGGTGGAGCCTGG - Intergenic
1160534241 18:79583908-79583930 TTTAGGGTCCTGGGGCTGCCAGG + Intergenic
1160554763 18:79717957-79717979 TGGAGGGTGCTGGGGGCCCCCGG - Exonic
1161588627 19:5118639-5118661 TGGAGGTCCCTGGGGGAACCTGG + Intronic
1161696426 19:5771155-5771177 TTGAGGGATCTAGGGGAGCCTGG - Intronic
1162145108 19:8608712-8608734 CTGAGGGTCTTAGGGGGACCAGG - Intronic
1163478176 19:17539288-17539310 GGGAGGGTCCTGGGGGTCCCGGG - Intronic
1164509804 19:28888293-28888315 GTGAGGGTCCTAAGGGAGCCAGG - Intergenic
1164572843 19:29386556-29386578 TTGTGGGACCTGGGGGACCAGGG + Intergenic
1164672517 19:30080796-30080818 TCTGGGGTCCTGGGGGAAGCTGG + Intergenic
1164941283 19:32253621-32253643 TGCAGGGACCTGGGGGCACCTGG - Intergenic
1165182034 19:33979663-33979685 TGAAGGGTCCTGGTGGATCCTGG + Intergenic
1165307915 19:35013527-35013549 TTGGGGGTCCTGTGGGAAAGGGG - Exonic
1166968531 19:46546426-46546448 TAGTAGGTCTTGGGGGAACCTGG - Intronic
1167103955 19:47419697-47419719 AGGAGGGGCCTGGGGGCACCAGG - Intergenic
1167666914 19:50827624-50827646 CTCAGGGTCCTGAGGGAGCCTGG - Intronic
1168094472 19:54106847-54106869 CTGAGGGTCCTGGGGGTGGCTGG - Exonic
1168340561 19:55620962-55620984 TTGAGGCTTGTGGGGGACCCTGG + Exonic
925135080 2:1521460-1521482 AGGAGGGTCCTGGGGGAAGAGGG - Intronic
926121281 2:10242525-10242547 ATGCGGGACCTGGAGGAACCGGG - Intergenic
926210070 2:10862894-10862916 ATGAGGGTCCTGAGGGATGCAGG + Intergenic
927244470 2:20945916-20945938 CTGAGGGGCCTGGGGGAAGAGGG - Intergenic
927507560 2:23624287-23624309 TTCAGGGTCCTGGAAGGACCAGG + Intronic
928907264 2:36381194-36381216 TTGAGTGTCCTGGATGGACCTGG + Intronic
928990852 2:37231830-37231852 TTGAGGGTACCGGGGGATCAAGG + Intronic
930090043 2:47525438-47525460 GTGAGGGTTCTGGGAGAACCCGG + Intronic
930097061 2:47572825-47572847 GTGGGGGTACTGGGGGAACAGGG - Intergenic
932576402 2:72964682-72964704 TTCATCTTCCTGGGGGAACCCGG + Intronic
933752078 2:85609341-85609363 TTGGGGGTCCTGAGGAAAACAGG + Intronic
934470444 2:94525073-94525095 TTGAGGGTCTTGTTGGAAACGGG - Intergenic
934945423 2:98537755-98537777 ATCAGGGTCCTGGGGGCAGCAGG - Intronic
936475739 2:112838088-112838110 TTCAGTTTCCTGGAGGAACCAGG - Intergenic
937291647 2:120785549-120785571 TCGAGGCTCCAGGGAGAACCGGG - Intronic
944836674 2:203587178-203587200 GTGAGGGGGCTGGGAGAACCAGG + Intergenic
946225390 2:218261623-218261645 CTCAGGGTGCTGGGGGAACCTGG + Intronic
946420161 2:219560500-219560522 TTGAAGATTCTGGGGGGACCTGG - Intronic
948367356 2:237465890-237465912 TTGGGGGTCCAGGTGGAGCCAGG - Intergenic
948562314 2:238862559-238862581 TTGAGGAAGGTGGGGGAACCAGG + Intronic
1169074475 20:2752494-2752516 TTGAGGAAGCTGGGGGACCCAGG - Exonic
1169838599 20:9908636-9908658 ATGGGGGTCCTGGGGGAAGTGGG - Intergenic
1171215546 20:23350045-23350067 TTGAGGGGCCCCGGGAAACCCGG - Intergenic
1171389095 20:24789794-24789816 CTGAGGCTCCTGGGGGCAGCAGG - Intergenic
1172152940 20:32803386-32803408 GTGAGGGTCCTGGGGTAGCTTGG + Intronic
1172767756 20:37359747-37359769 ACGAGGGTCCTGGGTGCACCTGG + Intronic
1175000670 20:55626282-55626304 TTGAGGTCTCTGGGAGAACCGGG + Intergenic
1175271445 20:57736829-57736851 TTGAAAGTCCTGTGGGCACCTGG + Intergenic
1175306209 20:57977294-57977316 TTGCAGGTCCTGGAGGAACCCGG - Intergenic
1175731079 20:61354292-61354314 TCCAGGGTCTTGGGGGATCCAGG - Intronic
1176096252 20:63345809-63345831 CTCAGGGTCCTGGGGGAACCAGG + Exonic
1176124191 20:63468164-63468186 TTGTGGTTTCTGGGGAAACCTGG - Intronic
1176232735 20:64040363-64040385 TTGAGGGCCCTGAGGGAGCTGGG + Intronic
1176413254 21:6460107-6460129 TGGGGGGTCCTGGGGGGTCCTGG - Intergenic
1178158890 21:29888043-29888065 TTGAGGTTGTTGGGGGAAGCAGG - Intronic
1179585931 21:42374093-42374115 TTCAGGGTGCTGTGGGAGCCTGG - Intronic
1179610535 21:42547432-42547454 CTGAGGCCCCTGGGGAAACCAGG - Intronic
1179688751 21:43068429-43068451 TGGGGGGTCCTGGGGGGTCCTGG - Intronic
1179708035 21:43193828-43193850 CTGAGGACCCTGTGGGAACCAGG - Intergenic
1180424879 22:15164759-15164781 TTGAGGGTCTTGTTGGAAACGGG - Intergenic
1182070482 22:27459994-27460016 CTGAGGGTCCTGCAGGAACTGGG + Intergenic
1182791985 22:32960652-32960674 CTGAGGGGCATGGGGGAAGCTGG - Intronic
1183933426 22:41248777-41248799 TGGAGGGTCCTGGGGTGTCCCGG - Intronic
1184018184 22:41801247-41801269 TGGAGGGTCCTGGGTGAACTTGG + Intronic
1184468808 22:44684066-44684088 TTGAGGGTCCAGGAGGGCCCGGG + Intronic
1184775344 22:46620329-46620351 TGGGGGATCCTGGGAGAACCTGG + Intronic
1185132406 22:49046671-49046693 TTGAGGCTCCTGGGTGTCCCTGG - Intergenic
950221248 3:11198034-11198056 ATGAGGGCCCAGGGAGAACCAGG - Intronic
952879351 3:37973645-37973667 TTGAGGTTCCTGCGGGCTCCTGG - Intronic
954135418 3:48580039-48580061 CCGGGGGTCCTGGGGGACCCTGG + Exonic
954235852 3:49256649-49256671 GTGAGGCTCCTTGGGAAACCAGG - Exonic
956908889 3:73796157-73796179 TGGAGGGTTCTGGGGGATTCTGG + Intergenic
969524945 4:7699611-7699633 TTTAGGCTCCTGGTGGAGCCAGG + Intronic
969626464 4:8308066-8308088 CTGTAGGTTCTGGGGGAACCGGG + Intergenic
973713321 4:53650707-53650729 TTGAGGTTCTTGGGGGGACACGG - Intronic
977067815 4:92341504-92341526 TTGAGTGGCCTTGGGGAAGCTGG - Intronic
977313040 4:95410903-95410925 TAGAAGGTCCAGAGGGAACCAGG - Intronic
984806689 4:183757981-183758003 GTGAGGGTCCCGGGGGAGCTGGG + Intergenic
986783829 5:11092034-11092056 TTGAGGGACCAGGGGGATCTCGG - Intronic
990937023 5:61162300-61162322 CGGAGGGTCCTGGGAGATCCTGG + Exonic
991002004 5:61792240-61792262 TTAAGGCTCTTGAGGGAACCTGG + Intergenic
995183586 5:109250482-109250504 TAGAGGGTCCTTGGGAAACATGG + Intergenic
998007498 5:138666612-138666634 GTGAGGGGCCTGGGGAAGCCGGG + Intronic
999152286 5:149434136-149434158 TTGAGATTCCTGGGGGTATCGGG + Intergenic
1000115792 5:158152065-158152087 GTCAGGGTCTTGGGGGCACCAGG + Intergenic
1000661951 5:163948789-163948811 TTGAGCATTCTGGGGGCACCAGG + Intergenic
1002471472 5:179438477-179438499 CTGGGGGTCCTGGGGGTCCCAGG - Intergenic
1002701420 5:181127806-181127828 CTGGGGGATCTGGGGGAACCTGG - Intergenic
1002833680 6:847217-847239 TTGTGGGTTCTGGGGAAAGCAGG - Intergenic
1005921557 6:30406365-30406387 TGGATTGTACTGGGGGAACCAGG - Intergenic
1006301618 6:33196449-33196471 TTGAGGGTCCTGGGGGAACCGGG - Exonic
1006369350 6:33634371-33634393 TTGCTGGTCCTGGCGGACCCGGG + Intronic
1006466069 6:34195754-34195776 GTGAGGGTGCTGGGGCATCCTGG + Intergenic
1006940900 6:37751715-37751737 TTGAGGGTACTGGGGGAGTGTGG + Intergenic
1007364692 6:41383208-41383230 TCTAGGCTCCTGGGAGAACCTGG - Intergenic
1012563555 6:100617622-100617644 TTGAAGGTCCTGGATGAACTTGG - Intronic
1013692968 6:112667520-112667542 TTGAGGGGCCTGGAGGAGGCAGG + Intergenic
1018496070 6:164347066-164347088 TTCTGGGTCATGGGGAAACCTGG - Intergenic
1019048886 6:169168229-169168251 TTTAGGGCCCTGGGGGGACAGGG - Intergenic
1019170119 6:170129132-170129154 ATGAGGGTCCTGGAGAAGCCTGG - Intergenic
1019758104 7:2788233-2788255 TTGAGCAGCCTGGGGGAGCCTGG - Intronic
1021777442 7:24067565-24067587 TGGAGGGCCCTGTGGGAAGCAGG - Intergenic
1026102719 7:67396196-67396218 TTCAGGGGCCTGGGGGAAGGAGG - Intergenic
1026901174 7:74038319-74038341 TTGGGGGTCCTGTGGGACCAGGG - Intronic
1027863106 7:83610993-83611015 TTGATGGTGGTGGGGGAACTCGG - Intronic
1029200400 7:98835591-98835613 CTGAGTGTCCTGGGGTAGCCAGG - Intergenic
1029630199 7:101745455-101745477 GTGGGGGTCCAGGGGGGACCAGG + Intergenic
1034265409 7:149778211-149778233 GTGAGGGGCCGGGAGGAACCAGG + Intergenic
1035464078 7:159063881-159063903 CTGGGGGTCCTGGGGGGATCTGG + Intronic
1037896285 8:22658605-22658627 TTTAGGGTTCTGGGGTGACCAGG - Intronic
1039962144 8:42256795-42256817 TTGAGGTTCCTGGGCCTACCAGG + Intergenic
1039970857 8:42320624-42320646 TTGAGGGTCCTCAGGGAATGTGG + Intronic
1041448016 8:57974970-57974992 TTGAGGATCCTGTGGTAGCCAGG + Intergenic
1042389597 8:68218107-68218129 TTGAGGGTCCTGCTGGTTCCTGG + Intronic
1043173910 8:77000377-77000399 TCGAGGGGCCTAGGGGAAGCCGG + Intronic
1044928774 8:97232247-97232269 GAGAGGCTCCTGGGGTAACCTGG + Intergenic
1047777330 8:128083798-128083820 TTGAGGGAACTGGTGTAACCTGG + Intergenic
1048432734 8:134385315-134385337 AAGAGGGACCTGGGAGAACCTGG - Intergenic
1048450312 8:134527705-134527727 TTGAGGATCCTGTGGGAAGAGGG - Intronic
1049302956 8:141881430-141881452 TTGAGGGCTCTGGGGGAAGCTGG - Intergenic
1052532604 9:29707213-29707235 TTGAGGGTTCTGGGCAAAGCTGG - Intergenic
1054463791 9:65480795-65480817 CTCAGGGTCCTGGGGGAGCTGGG + Intergenic
1054577372 9:66874723-66874745 TTGAGGGTCTTTGGAGAACAGGG - Intronic
1054737895 9:68774163-68774185 TTAAGGGTACTGTGGGAACAGGG + Intronic
1055935372 9:81599449-81599471 CTGTGGGGGCTGGGGGAACCGGG + Intronic
1057881432 9:98795775-98795797 TTGAGGGTGCTGCGAGACCCAGG - Intronic
1060799349 9:126533912-126533934 TGAAGGATCCTGGGGGAGCCTGG - Intergenic
1061377431 9:130234762-130234784 TCAAGGGTCTGGGGGGAACCAGG - Exonic
1061915716 9:133752407-133752429 TTCTTGGTCCTGGGGGAAGCTGG - Intergenic
1062430671 9:136525634-136525656 GTGGGGGTCCTGTGGGAAGCCGG - Intronic
1186207607 X:7216674-7216696 TTCAGGGTTCTGGGGGAAAGAGG + Intergenic
1186801138 X:13093278-13093300 TAGAGCTTCCTGGGGGAACGTGG + Intergenic
1187460845 X:19485567-19485589 GTCAGGGTCCTGGGGAAGCCTGG + Intronic
1193216288 X:78868174-78868196 GTGAGGATCCTGGGGTAGCCAGG - Intergenic
1195944039 X:110190289-110190311 TTGATTGTCCTGTGGGATCCTGG + Intergenic
1202021179 Y:20466562-20466584 TGGAAGTTCCTGGGGGATCCTGG + Intergenic