ID: 1006301619

View in Genome Browser
Species Human (GRCh38)
Location 6:33196450-33196472
Sequence GTTGAGGGTCCTGGGGGAAC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 234}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006301619_1006301630 20 Left 1006301619 6:33196450-33196472 CCGGTTCCCCCAGGACCCTCAAC 0: 1
1: 0
2: 1
3: 26
4: 234
Right 1006301630 6:33196493-33196515 CCACAGCAAGCTCTGCCTCCAGG 0: 2
1: 161
2: 13899
3: 98792
4: 125071

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006301619 Original CRISPR GTTGAGGGTCCTGGGGGAAC CGG (reversed) Exonic
900690383 1:3977236-3977258 GTAGAGGGGAGTGGGGGAACGGG + Intergenic
902833688 1:19033844-19033866 GGTGTGGGTCCTGGGGATACGGG - Intergenic
903013003 1:20343769-20343791 GGGGCGGGTCCTGGGGGAAGTGG - Intronic
903808289 1:26020848-26020870 GTTGAGGGACCTCAGGGGACAGG + Intronic
903853919 1:26324358-26324380 GTTGAGGGTACTGGGGGCCCAGG - Intronic
904015443 1:27416482-27416504 CTAGAGAGTCCTTGGGGAACTGG - Intronic
905179677 1:36157806-36157828 GGTGTGGGACCTGGGAGAACAGG + Intronic
905233759 1:36531135-36531157 GTTGGGGGTCCTGGGGTCAGAGG + Intergenic
907955482 1:59224210-59224232 GTTCAGTTTACTGGGGGAACAGG + Intergenic
910713287 1:90203826-90203848 GCTGGGGTTCCTGTGGGAACTGG + Intergenic
911090511 1:94013513-94013535 GTTGAGGCGCCTGGGGACACAGG + Intronic
911580205 1:99625330-99625352 TTTTTGAGTCCTGGGGGAACTGG - Intergenic
915225114 1:154406020-154406042 GTAAAGGCTCCTGGGGGCACTGG - Intronic
915594301 1:156887614-156887636 GTTGGGGGTGATGGGGGACCAGG + Intergenic
917227455 1:172800072-172800094 GTTGTGGGTTCTGGGGCACCGGG + Intergenic
922414019 1:225403866-225403888 GCTGGGGGAGCTGGGGGAACTGG - Intronic
922961456 1:229649969-229649991 AGAGAGGGTCCTTGGGGAACTGG + Intronic
923386076 1:233466195-233466217 GCTGACAGTGCTGGGGGAACTGG - Intergenic
923419896 1:233802543-233802565 GCTGAGGGTGCTGGAGGAAGGGG - Intergenic
924009057 1:239644367-239644389 GCTGAGGACCCTGGGGGAACAGG - Intronic
1063438334 10:6052552-6052574 GTTGAGGGTACAGGAGGAAGAGG - Intronic
1069642185 10:69963206-69963228 GGGGAGGGCCCTGGGGGTACAGG - Intronic
1069902000 10:71711561-71711583 TGGGAGGGTCCTGTGGGAACTGG + Intronic
1072609990 10:97011505-97011527 GTAGTGGGTCCTGGGAGAACAGG - Intronic
1075725778 10:124610358-124610380 GGTGAGGGTGCTGGTGGAGCGGG + Intronic
1075725788 10:124610391-124610413 GGTGAGGGTGCTGGTGGAGCGGG + Intronic
1075725833 10:124610556-124610578 GGTGAGGGTGCTGGTGGAGCGGG + Intronic
1075725862 10:124610661-124610683 GGTGAGGGTGCTGGTGGAGCGGG + Intronic
1075725947 10:124610970-124610992 GGTGAGGGTGCTGGTGGAGCGGG + Intronic
1076837784 10:133029883-133029905 GTTGGGTGTCCTGGAGGAACGGG - Intergenic
1076837799 10:133029937-133029959 GTTGGGTGTCCTGGAGGAACGGG - Intergenic
1076837815 10:133029991-133030013 GTTGGGTGTCCTGGAGGAACGGG - Intergenic
1076837831 10:133030045-133030067 GTTGGGTGTCCTGGAGGAACGGG - Intergenic
1076837847 10:133030099-133030121 GTTGGGTGTCCTGGAGGAACGGG - Intergenic
1076837863 10:133030153-133030175 GTTGGGTGTCCTGGAGGAACGGG - Intergenic
1076978346 11:192329-192351 GTTGAAGGCCCTGGGGGAGATGG - Intronic
1077017822 11:404705-404727 TTTGAGGGTCCTGGGCCACCAGG + Exonic
1077152436 11:1078252-1078274 GGTGGGGGTCCTGGCGGAGCTGG + Intergenic
1077443934 11:2581490-2581512 GAGGGGGGCCCTGGGGGAACCGG - Intronic
1077491792 11:2864362-2864384 GTTGAGGCTCCTGGGTGTCCAGG - Intergenic
1078114283 11:8429842-8429864 GTTGAAGGTCTTGAGGGAGCAGG - Intronic
1078447234 11:11413475-11413497 GTTAAGGGGCCTGAGGGAGCTGG - Intronic
1079405644 11:20143030-20143052 GTTGAGGGGTGTGGGGGAGCAGG + Intergenic
1079417281 11:20251049-20251071 GTTTAATGTCCTGGGGAAACTGG + Intergenic
1083749684 11:64754273-64754295 GATGAGGATCCTGGTGGACCTGG - Exonic
1084376640 11:68782666-68782688 GCAGAGGGTCCTGGAGGAGCTGG - Intronic
1084429472 11:69103156-69103178 GATGAGGGTCCTGGGGTCTCAGG - Intergenic
1084499212 11:69525027-69525049 GATGAGGGGCTGGGGGGAACTGG + Intergenic
1084536599 11:69761024-69761046 GGTGTGTGTACTGGGGGAACAGG - Intergenic
1084655067 11:70510277-70510299 CTTAAAGGTCCTGGGGGAAGGGG + Intronic
1084891093 11:72237536-72237558 GGTGAGGGGCCTGGGGGCAGTGG - Exonic
1087140484 11:94760826-94760848 TTTGATGGTTTTGGGGGAACAGG + Intronic
1088360704 11:108986020-108986042 TTTGAGGGTCCTGGGGTGCCGGG + Intergenic
1088988302 11:114929138-114929160 TCTGGGGGTCCTGGGGGAAAGGG + Intergenic
1090523216 11:127501061-127501083 GTGGAGGGTCAAGGGGGAGCAGG - Intergenic
1091315144 11:134609450-134609472 GCTGAAGGTCCTGCGGGAGCTGG + Intergenic
1091326127 11:134689538-134689560 GCTGAGGGTGCTGAGGGAAGGGG + Intergenic
1091779972 12:3207654-3207676 TTTGAGGCTCCCGGGAGAACTGG + Intronic
1092567377 12:9682513-9682535 GTTGAGGGTTGGGGGGCAACGGG - Intronic
1095837191 12:46651929-46651951 TTTCTGGGTCCTGGGGGAAGGGG - Intergenic
1096280244 12:50246450-50246472 GTTGGGGGTCAAGGGGGAACAGG - Intronic
1101410571 12:104464453-104464475 GTTGGGGGTCAAGGGGGAGCAGG - Intronic
1102523927 12:113497520-113497542 GATGAAAGTCCTGGGGAAACAGG + Intergenic
1103730296 12:123022895-123022917 GTGGAGGGCCCTGGGGGAAGAGG - Intronic
1104064755 12:125297402-125297424 GTGGAGCGTCCTGGGGAAAATGG + Intronic
1104719873 12:131039307-131039329 CGTGAGGGTCCTGGTGGGACTGG - Intronic
1104841791 12:131829145-131829167 GTTGAGGGTGTTGGGGGCACAGG + Intronic
1105794283 13:23834718-23834740 CACGAGGGCCCTGGGGGAACTGG - Intronic
1111919505 13:94395882-94395904 GTAGAGGGTCCTGGAGGGCCAGG - Intronic
1113566780 13:111324095-111324117 GCTGAAGGTCCTGGGGGTGCTGG + Intronic
1113645963 13:111996242-111996264 GGGGAGGGTCCTGTGGGAGCCGG - Intergenic
1117910822 14:60637358-60637380 GGTGAGGGTCATGGGAGAAGGGG - Intergenic
1118370819 14:65135849-65135871 GCTGAGTGTCCTGGAGGAAATGG - Intergenic
1119385917 14:74258126-74258148 GTTGGGGGTCCCCGGGGAAGCGG + Intronic
1122366539 14:101197949-101197971 GGAGAGGGTGCTGGGGAAACCGG - Intergenic
1122629122 14:103099335-103099357 GCCGAGGGCCCTGGGGGAGCAGG + Intergenic
1123205117 14:106704832-106704854 GTTGACGATCCTGGGGAATCAGG - Intergenic
1123585138 15:21753242-21753264 ATTGAAGATCCTGGGGGATCAGG - Intergenic
1123621785 15:22195849-22195871 ATTGAAGATCCTGGGGGATCAGG - Intergenic
1125727865 15:41877259-41877281 TCTGAGGGTCCTGGGGCAGCAGG - Exonic
1125758310 15:42080975-42080997 GGTGAGGATCCTGGGGGACTGGG - Exonic
1126095950 15:45090617-45090639 GTTGAGGGTGTTGGGAGAAGTGG + Intergenic
1129117666 15:73374345-73374367 GTTGAGGGTACTGGGAGGAGGGG - Intergenic
1129144881 15:73637814-73637836 GGTGAGGCTGCTGGGGGAAGTGG - Intergenic
1131198143 15:90373441-90373463 GTTGAGGGTGCTGGGGATACAGG + Intergenic
1132850866 16:2024327-2024349 GTCCAGGGGCCTGGAGGAACAGG - Intergenic
1134572608 16:15304094-15304116 GAGGAGGGGCCTGGGGGAAGGGG + Intergenic
1134729774 16:16451929-16451951 GAGGAGGGGCCTGGGGGAAGGGG - Intergenic
1134937657 16:18259967-18259989 GAGGAGGGGCCTGGGGGAAGGGG + Intergenic
1136693873 16:32058549-32058571 ATTGAAGATCCTGGGGGATCAGG + Intergenic
1136794363 16:33001785-33001807 ATTGAAGATCCTGGGGGATCAGG + Intergenic
1136875545 16:33852595-33852617 ATTGAAGATCCTGGGGGATCAGG - Intergenic
1139433889 16:66925387-66925409 GGTGAGTGTCCTGGCGGAGCGGG - Exonic
1141132592 16:81445648-81445670 GTGGGGGGTGCCGGGGGAACGGG + Intronic
1203096628 16_KI270728v1_random:1263465-1263487 ATTGAAGATCCTGGGGGATCAGG + Intergenic
1142465788 17:136854-136876 GTTGAAGGCCCTGGGGGAGATGG - Intergenic
1143106608 17:4533448-4533470 GTCAAGGGTGCTGGGGGAGCTGG + Intronic
1144409315 17:14985132-14985154 TTAGAAGGTCCTGGTGGAACTGG - Intergenic
1144572564 17:16408589-16408611 CTTGAGGGTGCTGGGGGTAGGGG - Intergenic
1144864501 17:18326414-18326436 AGTGAGGTTCCTGGGGAAACAGG - Intergenic
1145813669 17:27780736-27780758 GCTGAGGGTGCTGGGGGCAAGGG - Intronic
1145874476 17:28306882-28306904 TTGGAGGGCCCTGGGGGAACGGG - Intergenic
1146125373 17:30227243-30227265 GTGCAGGGTCATGGGGGCACAGG + Intronic
1147381052 17:40056522-40056544 AGTGAGGGGCCTGGGAGAACAGG - Intronic
1148119300 17:45198161-45198183 GGTTAGTGTCCTGGGTGAACAGG - Intergenic
1150462669 17:65365589-65365611 ATTGAAGGTGTTGGGGGAACAGG + Intergenic
1151469545 17:74309570-74309592 GTTAAGGGGCCTGGGGGATTTGG + Intronic
1151684689 17:75639661-75639683 GTTGGGGGGCCTGGGGGACAGGG + Exonic
1151928393 17:77215107-77215129 GGTGGGGGTGCTGGGGGGACGGG + Intronic
1152558875 17:81068001-81068023 GCCGAGGGGCCTGGGGGCACAGG + Intronic
1152798419 17:82320055-82320077 GCCGAGGGTCCTGGGGGAGCCGG + Intergenic
1152901540 17:82943877-82943899 GGTGAGGGTCCTGGGTGACCAGG + Exonic
1154197382 18:12276593-12276615 GTTGTGGGTGCTGGGGGCAGTGG + Intronic
1154291011 18:13106621-13106643 GTTGAGGGTTGTGTGGGAAATGG - Intronic
1155053636 18:22168009-22168031 CTTGTGGCTCCTGGGGGAGCGGG - Intergenic
1156446071 18:37237647-37237669 GTTAAGTGTACTGGGGGAAATGG + Intergenic
1158429382 18:57370772-57370794 GTTGAGGGTCCAGGGGTGGCTGG + Intronic
1161281686 19:3449066-3449088 GGGGAGAGTCCTGGGGGGACGGG - Exonic
1162495535 19:11021330-11021352 GTGGAGGGTCTCAGGGGAACTGG - Intronic
1162497821 19:11033277-11033299 CTTGCAGGTCCTGGGGGAAGAGG - Exonic
1164520559 19:28975940-28975962 GTTGAGGGCCCAGGTGGAGCAGG - Intergenic
1164572842 19:29386555-29386577 GTTGTGGGACCTGGGGGACCAGG + Intergenic
1165132439 19:33641295-33641317 GATCAGAGTCCTCGGGGAACAGG + Intronic
1165307916 19:35013528-35013550 CTTGGGGGTCCTGTGGGAAAGGG - Exonic
1166376680 19:42331316-42331338 ACTGAGGGTCATGGGGGAAAGGG + Intronic
1166777816 19:45323263-45323285 GGTGAGGGCCCAGGGGGCACAGG - Intergenic
1166891895 19:45999187-45999209 GTTGATGCCCCAGGGGGAACTGG + Intronic
1167112872 19:47472072-47472094 GGGGAGGGGCCTGGGGGAGCAGG + Exonic
1167146119 19:47681440-47681462 GGTGAGGGCCCTGGCTGAACTGG + Intronic
1168280340 19:55302293-55302315 CTTATGGGTCCTGGGGGAAGAGG + Intronic
924980947 2:221166-221188 GTTGAGGGTCTTGGATGACCTGG - Intronic
925135081 2:1521461-1521483 GAGGAGGGTCCTGGGGGAAGAGG - Intronic
925146116 2:1584490-1584512 GCTCATGGTCCTGGGGGATCCGG - Intergenic
925764175 2:7214904-7214926 GTGGAGGGACCTGGGGGTTCAGG - Intergenic
926121282 2:10242526-10242548 GATGCGGGACCTGGAGGAACCGG - Intergenic
926341830 2:11910211-11910233 GGGGATGGTCCTGGGGGAAGAGG + Intergenic
927244471 2:20945917-20945939 ACTGAGGGGCCTGGGGGAAGAGG - Intergenic
929592129 2:43154221-43154243 AATGAGGTGCCTGGGGGAACAGG + Intergenic
930097062 2:47572826-47572848 AGTGGGGGTACTGGGGGAACAGG - Intergenic
935391326 2:102556184-102556206 GAGCAGGGTCCTGGTGGAACAGG + Intergenic
936080461 2:109429371-109429393 GTGTAGGTTGCTGGGGGAACTGG - Intronic
938228832 2:129640375-129640397 GTGGAAGGCCCTGGGGCAACAGG - Intergenic
939752128 2:146061140-146061162 GTTGAGAGGCATGGGGGAAGTGG + Intergenic
941056351 2:160793669-160793691 GTTGAATTTCCTGGAGGAACAGG - Intergenic
944659921 2:201912994-201913016 GTGGAAGCTCCTGGGGGAAAAGG + Intergenic
946514439 2:220396207-220396229 GTTGAGGGTCCCAGGGGAACAGG - Intergenic
947603448 2:231468533-231468555 GGTGAGGGGCCTGAGGGAAGAGG - Intronic
947925142 2:233914762-233914784 GTTGAGGGTCCAGGGGCCACTGG - Intergenic
948122258 2:235539753-235539775 GCTGTGGGTCCTGGGGTCACGGG + Intronic
948672343 2:239576527-239576549 GCTGAGTGACCTGGGGAAACAGG - Intergenic
1169187282 20:3629280-3629302 ATTCAGCGTCCTGGGTGAACTGG + Intronic
1169838600 20:9908637-9908659 GATGGGGGTCCTGGGGGAAGTGG - Intergenic
1170812674 20:19686805-19686827 GGTAAGGGACCTGGGGGAATAGG - Intronic
1171836390 20:30155073-30155095 GTTGAGGGTTATGGTGGAAAAGG - Intergenic
1172009099 20:31836176-31836198 CTTGGGGGTCCTGGGGAACCTGG + Intergenic
1172512087 20:35507856-35507878 GCTGGGGGCTCTGGGGGAACAGG + Intronic
1172890338 20:38260028-38260050 GTTAAGGGTCCAGGGTGAAAAGG - Intronic
1176203679 20:63876699-63876721 CTTGAAGGTCCTGGGGGACCAGG + Intronic
1176232734 20:64040362-64040384 TTTGAGGGCCCTGAGGGAGCTGG + Intronic
1176324773 21:5382788-5382810 CTTGAGGCTCCTGGGGAAAAAGG + Intergenic
1176482326 21:7313203-7313225 CTTGAGGCTCCTGGGGAAAAAGG + Intergenic
1179440170 21:41388022-41388044 GGTGAGGGTGCTGGTGGAAGTGG - Intronic
1180159266 21:45991860-45991882 GCTGAGGGTGCTGGGGGGTCTGG + Intronic
1180858742 22:19064647-19064669 GTGGAGGGTCCTGGGAGCAGGGG - Intronic
1181446438 22:22978842-22978864 GATGAGGCTCCTGTGGGAAATGG + Intergenic
1181890679 22:26060488-26060510 TTTGAGGCTCCTGGGTCAACTGG + Intergenic
1182070481 22:27459993-27460015 ACTGAGGGTCCTGCAGGAACTGG + Intergenic
1184091408 22:42294871-42294893 GTGGAGGGCCCTGGGGGACAGGG + Intronic
1185274612 22:49944939-49944961 GTAGAGTTTCCTGGGGGTACTGG - Intergenic
1185274622 22:49944986-49945008 GTAGAGTTTCCTGGGGGACCTGG - Intergenic
1185274632 22:49945033-49945055 GTAGAGTTTCCTGGGGGACCTGG - Intergenic
1185274642 22:49945081-49945103 GTAGAGTTTCCTGGGGGACCTGG - Intergenic
1185274652 22:49945128-49945150 GTAGAGTTTCCTGGGGGACCTGG - Intergenic
1185274662 22:49945175-49945197 GTAGAGTTTCCTGGGGGACCTGG - Intergenic
951537700 3:23754691-23754713 GTTGAGGGGAGTGGGGGACCAGG - Intergenic
953939754 3:47082969-47082991 CTTGAGGACCCTGTGGGAACAGG - Intronic
954596768 3:51831493-51831515 GTTCAGGGCCCTGGGGAAGCAGG - Intergenic
954844831 3:53546268-53546290 GGTGTGGGCCCTGGGGGAACCGG + Intronic
954865847 3:53728793-53728815 GTTGTGGGTGCTGAGGGCACAGG - Intronic
955047942 3:55377387-55377409 TTTGAGGGTCTTTGGGGGACAGG - Intergenic
958201730 3:90327649-90327671 ATTGAGGGCTCTGGGGAAACAGG - Intergenic
959031896 3:101309045-101309067 GATGAGGATCTTGTGGGAACTGG - Intronic
959833655 3:110893226-110893248 GTTGAAGGTGTTGGAGGAACAGG + Exonic
961050009 3:123737971-123737993 AGTGAGGATCCTAGGGGAACAGG - Intronic
963049883 3:141132137-141132159 CTTTAGGGACCTGGGGGAAAGGG - Intronic
968452957 4:683704-683726 GTTTGGGATCCTGGGGGCACTGG - Exonic
968516318 4:1017118-1017140 GCTGAGTGGCCTGGGGGAAGGGG - Intronic
968914108 4:3489679-3489701 GTCGAGGGTCCCGGGGGACTTGG - Exonic
969160637 4:5255225-5255247 GTTCAGGGTTTTGGGGGATCAGG + Intronic
969884164 4:10200435-10200457 TTTGAGGGTCATGGGGGAATTGG + Intergenic
976049940 4:80999492-80999514 ATTGAGGGTGCTGGGCAAACTGG - Intergenic
978755845 4:112302200-112302222 ACTGAGGGGCCTGTGGGAACAGG - Intronic
984480220 4:180291387-180291409 GTTGAGTGGCCTGGGCTAACAGG - Intergenic
984806688 4:183757980-183758002 AGTGAGGGTCCCGGGGGAGCTGG + Intergenic
989863961 5:46423100-46423122 TTTGAGGGTTGTGGGGGAAAAGG - Intergenic
993352246 5:86864971-86864993 GTGCAGGGTCCTGTGGTAACAGG + Intergenic
995368139 5:111386869-111386891 GCTGAGGGACCTGTAGGAACTGG + Intronic
999172332 5:149606163-149606185 GTTGAGGAGACTGTGGGAACCGG + Intronic
1001130161 5:169057296-169057318 GCTCAGGGTTGTGGGGGAACTGG - Intronic
1002456943 5:179350653-179350675 AGTGGGGGTCCTGGAGGAACTGG + Intergenic
1003528635 6:6919583-6919605 TTTGAGGGTCTTGGTGTAACTGG - Intergenic
1005394509 6:25367507-25367529 GCTGAGTGTTCTGGGGGCACTGG - Intronic
1005993783 6:30919878-30919900 GTTGGGGGTCCTGGAGGAGAGGG + Intronic
1006301619 6:33196450-33196472 GTTGAGGGTCCTGGGGGAACCGG - Exonic
1006370807 6:33642674-33642696 GATGAGGGGCCTGGGGGAGGAGG - Intronic
1006396426 6:33790324-33790346 GAGGAGGGGCCTGGGGGAAGGGG - Intergenic
1006920555 6:37624799-37624821 GTAGAGGGTCCTGGCTGGACAGG + Intergenic
1007533795 6:42566199-42566221 GTAGAGGCTCCTGAGGAAACTGG + Intronic
1007902360 6:45423273-45423295 TTTGGGGATCCTGGGGGAAAGGG - Intronic
1009254673 6:61369957-61369979 TTTGAGGGTTCTTGGGAAACGGG + Intergenic
1018855373 6:167670634-167670656 GATGAGGATCCTGGGGGGCCTGG - Intergenic
1018934104 6:168262158-168262180 GCTGAGGGTCCAGAGGAAACGGG - Intergenic
1019048887 6:169168230-169168252 GTTTAGGGCCCTGGGGGGACAGG - Intergenic
1022904173 7:34839948-34839970 GTTGTGTGCCCTGGGGAAACAGG + Intronic
1023939293 7:44759681-44759703 GTAGAGGGTCCTTTCGGAACTGG - Intronic
1026901175 7:74038320-74038342 ATTGGGGGTCCTGTGGGACCAGG - Intronic
1028877818 7:95843330-95843352 GTTGAGAGTCCAGGGAGACCAGG - Intronic
1029458912 7:100684463-100684485 GGTGAGGGCCCTGGGGCAAAGGG + Exonic
1030928861 7:115497062-115497084 GTTGAGAGTCCTGAGAGAACTGG + Intergenic
1031375387 7:121018425-121018447 GTTGAGCAGCCTGGGGGAAGAGG + Intronic
1031923190 7:127615894-127615916 GGTGAGGAGCCTGGGGGAAGTGG - Intronic
1032082741 7:128868273-128868295 CTTTAGGGGCCTGGGGGAAAGGG - Intronic
1033712163 7:143959059-143959081 TTTGAGGATCCTGGGGCCACCGG - Intergenic
1033763182 7:144459392-144459414 CTTGAGGGTCTTGGGGGAAAGGG - Intronic
1037569815 8:20148716-20148738 GGTGAGTGTCCTGGGGTAGCAGG - Intronic
1037693581 8:21204693-21204715 GATGAGGGTCTTGGGGTAAGGGG - Intergenic
1043716930 8:83498666-83498688 GTTGAAGCTCATGGGGGAAAAGG - Intergenic
1044697181 8:94935255-94935277 GTTGAGGGTCCAGGTGGATTTGG - Intronic
1044722061 8:95160285-95160307 GTAGAGGGTGGTGGGGGCACTGG - Intergenic
1046904131 8:119554170-119554192 CCTGAGGCTCCTGGGGAAACCGG - Intergenic
1047689728 8:127339500-127339522 GTTGAGAGTACTGGGGAAAAGGG + Intergenic
1048450313 8:134527706-134527728 CTTGAGGATCCTGTGGGAAGAGG - Intronic
1049158115 8:141079453-141079475 GTTGAGGATGATGGGGGAATTGG - Intergenic
1049404931 8:142448099-142448121 GTTGAGGGCCATGGGAGGACAGG + Intergenic
1049702229 8:144020529-144020551 GAAGAGGGTCCTGAGGGAAGAGG - Intronic
1049702324 8:144020883-144020905 GAAGAGGGTCCTGAGGGAAGAGG - Intronic
1049702851 8:144022967-144022989 GAAGAGGGTCCTGAGGGAATAGG - Intronic
1049702896 8:144023127-144023149 GAAGAGGGTCCTGGGGGGAGAGG - Intronic
1049703057 8:144023716-144023738 GGAGAGGGTCCTGAGGGAAGGGG - Intronic
1049703119 8:144023951-144023973 GTAGAAGGTCCTGAGGGAAGAGG - Intronic
1049703127 8:144023983-144024005 GTAGAGGGTCCTGAGGGGAGAGG - Intronic
1049703266 8:144024454-144024476 GGAGAGGGTCCTGAGGGAAGAGG - Intronic
1049703291 8:144024526-144024548 GGAGAGGGTCCTGAGGGAAGGGG - Intronic
1049703401 8:144024944-144024966 CTGGAGGGTCCTGAGGGAAGAGG - Intronic
1054143599 9:61547462-61547484 GCTGAGGGTCCTGGAGGCATGGG - Intergenic
1054463790 9:65480794-65480816 CCTCAGGGTCCTGGGGGAGCTGG + Intergenic
1054577373 9:66874724-66874746 TTTGAGGGTCTTTGGAGAACAGG - Intronic
1054737894 9:68774162-68774184 TTTAAGGGTACTGTGGGAACAGG + Intronic
1055452620 9:76444401-76444423 GTTAAGAGGCCTGGGGGAAGAGG + Intronic
1056385268 9:86091477-86091499 GTAGAGGGCCCTGGCAGAACTGG - Intronic
1057744736 9:97741821-97741843 CTTGAAGGCCTTGGGGGAACGGG + Intergenic
1058348961 9:103999321-103999343 CTGGAGGGCCCTGGGGGAGCGGG - Intergenic
1059367417 9:113797289-113797311 GTTGAGAGTTTTGGGGAAACTGG + Intergenic
1060930339 9:127485860-127485882 GGTGAGGGAGCTGGGGGAGCTGG + Intronic
1061260007 9:129475002-129475024 GTGGAGGGTGCTCAGGGAACAGG - Intergenic
1062363541 9:136198484-136198506 GGGGAGGGTGCTGGGGGAGCAGG + Intronic
1062495932 9:136831708-136831730 ATTGAAGGTCCTCGGAGAACAGG - Exonic
1062523462 9:136969099-136969121 GCTGAGGGCCCTGGGGGAGTGGG + Intergenic
1189159975 X:38801495-38801517 GTTGCGGGGTCTGGGGGAGCTGG + Intronic
1189852988 X:45195376-45195398 GTTGAGGGACTTGGGGGGATTGG - Intronic
1190057075 X:47187239-47187261 GTTGAGGGCTCTGGGCCAACTGG - Intergenic
1198019205 X:132641944-132641966 GCTGAGGGGCCTGGGGGCAGGGG + Intronic