ID: 1006301620

View in Genome Browser
Species Human (GRCh38)
Location 6:33196456-33196478
Sequence CAGGGCGTTGAGGGTCCTGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 214}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006301620_1006301630 14 Left 1006301620 6:33196456-33196478 CCCCCAGGACCCTCAACGCCCTG 0: 1
1: 0
2: 1
3: 27
4: 214
Right 1006301630 6:33196493-33196515 CCACAGCAAGCTCTGCCTCCAGG 0: 2
1: 161
2: 13899
3: 98792
4: 125071
1006301620_1006301631 28 Left 1006301620 6:33196456-33196478 CCCCCAGGACCCTCAACGCCCTG 0: 1
1: 0
2: 1
3: 27
4: 214
Right 1006301631 6:33196507-33196529 GCCTCCAGGATCCTGTCCACAGG 0: 1
1: 2
2: 2
3: 46
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006301620 Original CRISPR CAGGGCGTTGAGGGTCCTGG GGG (reversed) Exonic
900118445 1:1038534-1038556 GAGGGAGCTGCGGGTCCTGGTGG + Intronic
900312659 1:2041687-2041709 CAGGGCGTGGACTGGCCTGGGGG - Intergenic
900482939 1:2908145-2908167 CAGGGCGGGGAGGGAGCTGGGGG - Intergenic
900993851 1:6109889-6109911 GCGGGCGTTGAGGGCCATGGCGG + Exonic
901195712 1:7438741-7438763 AAGGGCCTCGAGGGTCCTGGTGG + Intronic
901635073 1:10666700-10666722 TAGGGCACCGAGGGTCCTGGGGG + Intronic
901759319 1:11460435-11460457 CCGGGCATTTAGGGGCCTGGAGG - Intergenic
902630694 1:17702762-17702784 CAGGTCTGTGAGTGTCCTGGGGG - Intergenic
903297249 1:22351520-22351542 CAGGGTGTTGGGGGGCCGGGAGG + Intergenic
904567391 1:31435834-31435856 CAGGCCCTTGAGAGTCATGGTGG + Intergenic
904872024 1:33625013-33625035 CCGGGCGTTGAGGGTGCGGGGGG - Intronic
905476387 1:38231487-38231509 CAGGGAGTTCAGTCTCCTGGGGG - Intergenic
908401347 1:63774786-63774808 GAGGGGTTTGAGGGTCCTGGGGG + Intronic
910873323 1:91854447-91854469 CTGGGCACTGGGGGTCCTGGAGG - Intronic
912630036 1:111238944-111238966 CAGGGAGCTGAGGGTACAGGGGG - Intronic
913189350 1:116400400-116400422 CAGGGGGAGGAGGGTCCTGAAGG + Intronic
915326138 1:155082135-155082157 CCGGGCTTTGAGGGTGGTGGCGG - Intronic
915492547 1:156259222-156259244 GTGGGAGTGGAGGGTCCTGGAGG - Intronic
919012452 1:191983126-191983148 CATGCAGTTCAGGGTCCTGGGGG - Intergenic
921871998 1:220151382-220151404 CAGTGTTTTGAAGGTCCTGGGGG + Exonic
922559605 1:226559587-226559609 CAGTGAGGAGAGGGTCCTGGTGG - Intronic
1063069775 10:2649501-2649523 GTGGGTGTTGTGGGTCCTGGTGG - Intergenic
1065636529 10:27741551-27741573 CGGGGCGTGGAGCGTCCGGGCGG - Intronic
1069474685 10:68721786-68721808 CTGGCCCTTGAGGGTCGTGGCGG + Intronic
1073022322 10:100455341-100455363 CAGGTCGTTGAGTTTGCTGGAGG - Intergenic
1073175392 10:101553257-101553279 CAGGGCTTTGAGACTCCTGTTGG + Exonic
1073578740 10:104644963-104644985 CAGGTGGTTGAGGGTGCAGGAGG + Intronic
1074483809 10:113854128-113854150 GGGGGCGGTGAGGGTCCTTGAGG - Intronic
1076188935 10:128469472-128469494 CAGAGCCTTGAGGGACCAGGAGG - Intergenic
1076649653 10:131979066-131979088 TAGGCCCTGGAGGGTCCTGGAGG - Intronic
1077065751 11:640275-640297 CAAGGCCATGAGGGTCCTGCCGG + Exonic
1077238803 11:1499782-1499804 CAGGGCCCTGAGGCTGCTGGTGG + Intronic
1077385033 11:2264992-2265014 CAGGAGGTGGAGGGTGCTGGTGG + Intergenic
1077579494 11:3407720-3407742 CAGGGTGGGGAGGGTTCTGGAGG + Intergenic
1080109843 11:28554315-28554337 CAGGGCTTTGCTGGTTCTGGAGG + Intergenic
1081578621 11:44335512-44335534 CAGGGCGTTGAGGGAGTCGGAGG + Intergenic
1082015016 11:47478899-47478921 CAGGGTGTTGAGGTTCCCAGAGG + Exonic
1083285589 11:61656617-61656639 CAGGGTGGTGAGGGTACAGGGGG + Intergenic
1083308157 11:61771544-61771566 CTGGGCATTGAGGGTGCTGGGGG - Exonic
1083803662 11:65060904-65060926 CAGTGCATTGCTGGTCCTGGAGG - Intergenic
1084676795 11:70640002-70640024 CAGGCCGTCCAGGGGCCTGGAGG + Intronic
1088903375 11:114135601-114135623 CAGGGCTTTGTGGCTTCTGGAGG - Intronic
1089260870 11:117223178-117223200 CAGGCCGTGGAGGGCCCGGGAGG + Intronic
1089896566 11:121935861-121935883 CAGGGAGAGCAGGGTCCTGGTGG + Intergenic
1090442690 11:126737294-126737316 CAGGGCAGAGAGGGTGCTGGTGG + Intronic
1094338903 12:29389329-29389351 GAGGGCCTGGAGGGCCCTGGAGG - Intergenic
1096969512 12:55654564-55654586 TAGGGCCTTCAGTGTCCTGGTGG + Intergenic
1098809221 12:75063573-75063595 CAGTGTGTTGAGGGTGATGGTGG + Intronic
1101086649 12:101243016-101243038 CAGGGGGTGGAGGGGACTGGGGG + Intergenic
1102349616 12:112182754-112182776 CAGGGCGCTGAAGGCCGTGGGGG - Intronic
1102710240 12:114919611-114919633 CAGCGAGTTGAGCTTCCTGGCGG - Intergenic
1103887582 12:124214432-124214454 CAGGGCTGTGAGTGTCCTAGTGG + Intronic
1103915175 12:124372382-124372404 GAGGGCGATGGGGGTGCTGGTGG + Exonic
1103974492 12:124693523-124693545 CAGGCCGGTGAGGGGCTTGGGGG + Intergenic
1104850709 12:131872188-131872210 CAGGGCATTGAGGATGTTGGAGG + Intergenic
1104894966 12:132159550-132159572 CTGGGCGTGGAGGGGCATGGAGG + Intergenic
1105794285 13:23834724-23834746 CAGGGCCACGAGGGCCCTGGGGG - Intronic
1112200124 13:97266551-97266573 CTGGGCGGAGAGGGCCCTGGAGG - Intronic
1117369381 14:55062840-55062862 AAGGGTGCTGGGGGTCCTGGAGG - Exonic
1120925802 14:89796133-89796155 CAGGGTGATGAGGGTACTGGGGG - Exonic
1121005635 14:90489110-90489132 CAGGGTGGCGAGGGTTCTGGAGG + Intergenic
1121047575 14:90799286-90799308 CTGGGCCATCAGGGTCCTGGTGG + Intronic
1121259202 14:92553880-92553902 CAGGGCTGTAGGGGTCCTGGGGG - Intronic
1121625810 14:95384732-95384754 CAAGGCATGGAGGGCCCTGGTGG - Intergenic
1122764272 14:104054724-104054746 CAGAGTGTGGAGGGTACTGGTGG + Intergenic
1122947747 14:105020920-105020942 CAGGGCGCGGAGGAGCCTGGGGG - Intronic
1124139729 15:27066954-27066976 CAGGACTTTGAGGGGCATGGTGG + Intronic
1125577724 15:40766759-40766781 CAGGGCAGTGAGGGGCCTGGAGG + Exonic
1125675921 15:41502594-41502616 CAGCGCGGTGAGGGCCATGGTGG - Intronic
1126919432 15:53504479-53504501 CACGGGGCTGAGGTTCCTGGGGG + Intergenic
1128318508 15:66676576-66676598 GTAGGCATTGAGGGTCCTGGGGG - Intronic
1128342435 15:66831843-66831865 CACGGCGCTGAGGATTCTGGGGG - Intergenic
1129684490 15:77677386-77677408 CAGGGAGTTGATGCTCCTGAGGG - Intronic
1129858833 15:78844398-78844420 CAGGATGTTCAGGGCCCTGGTGG + Intronic
1131957829 15:97756733-97756755 CTGGGAGCTGAGGGTCCTGCTGG - Intergenic
1132609396 16:807683-807705 CAGGGCGTGGCGGGCCCTCGGGG + Intronic
1132615882 16:840881-840903 CTGGGCGTGGAGGGTCGCGGGGG + Intergenic
1133014037 16:2930691-2930713 CAGGGTCCTGAGGGCCCTGGAGG + Exonic
1133921178 16:10154518-10154540 CAGGGCACTGAGGATGCTGGGGG - Intronic
1135138079 16:19899332-19899354 CAGGGAGTGTAGGGACCTGGCGG - Intergenic
1136584419 16:31174776-31174798 TGGGGCCTTGGGGGTCCTGGGGG - Intergenic
1137540578 16:49358934-49358956 CAGGGAGTGGAGGGGCTTGGGGG + Intergenic
1138246561 16:55470994-55471016 CAGGGTGTGGAGGGTTCTGCAGG + Intronic
1138507505 16:57485719-57485741 TAGGGCCTTGCGGGCCCTGGGGG + Intronic
1139587700 16:67914832-67914854 CAGGCTGTTGAGGGTCCAGCTGG + Intronic
1140258641 16:73358181-73358203 CAGGGAGTGGACGGTGCTGGGGG - Intergenic
1140778374 16:78271744-78271766 GAGGGCGTTGGGAGGCCTGGCGG + Intronic
1140852317 16:78946714-78946736 CAGAGCGTTGAGAGTCATGCGGG + Intronic
1141911655 16:87063835-87063857 CAAAGCGTTCAGGGTCCAGGAGG - Intergenic
1142561471 17:811804-811826 CAGTGCGTTGAGGTGTCTGGGGG - Intronic
1142877773 17:2862513-2862535 CAGGGAGTTGGGGGGCGTGGGGG - Intronic
1144855549 17:18265424-18265446 CAGGCAGCTGAGGGTCCTGGGGG + Exonic
1146749096 17:35361434-35361456 CAGGGTGATGAGGGTCACGGGGG - Intronic
1146969616 17:37062147-37062169 CAGGGCGTGGAGGAGCCAGGAGG + Intergenic
1148535319 17:48433755-48433777 CAGTGCGTGAAGGGTCCCGGTGG - Intergenic
1149996903 17:61410394-61410416 CAGGGCGTTCAGGGTCCCCAAGG - Intergenic
1150287636 17:63962934-63962956 CAGGGAGTTGGGGGCCCTGCAGG - Intronic
1150654656 17:67031861-67031883 CTGAGCGTTGGGGGTCCCGGGGG + Exonic
1151819471 17:76489898-76489920 CAGGGCCTGGAGGCTCCTAGGGG + Intronic
1151937310 17:77270513-77270535 CAGAGGGCTGAGGGTGCTGGCGG - Intergenic
1152315659 17:79578996-79579018 CAGGACGTTGAGGGGGCAGGAGG - Intergenic
1152740404 17:82016132-82016154 CCAGGCGTGGCGGGTCCTGGCGG - Intronic
1157286225 18:46379133-46379155 CAGAGGGTTGGGGGGCCTGGGGG - Intronic
1160231728 18:77054091-77054113 CAGGGCGGGGAGGGACCGGGAGG - Intronic
1160799188 19:959960-959982 CAGCGGCTTGAGGGTCCTAGGGG + Intronic
1161766505 19:6211665-6211687 CAGGGGGTTGAGAGGACTGGAGG + Intergenic
1162184948 19:8897599-8897621 CAGGGCTTTGAGGGTTAAGGTGG + Exonic
1162706072 19:12555643-12555665 CAGGGTGCAGAGGGCCCTGGAGG + Intronic
1163529986 19:17843332-17843354 CAGGGGGTTGGGGGTCCAAGGGG - Intronic
1163578067 19:18122144-18122166 CAGGGGGTGGGGGGTCATGGGGG + Intronic
1163685146 19:18708351-18708373 AAGGGAGTTGTGGGTTCTGGAGG + Intronic
1163699055 19:18778039-18778061 CAGGGCGAGGAGGGTCGTGGGGG - Exonic
1163862429 19:19749294-19749316 CATGGAGTGGACGGTCCTGGAGG + Intergenic
1166046906 19:40235221-40235243 CAGGTCCCTGAGGGTCCTGCTGG + Intronic
1166567941 19:43776487-43776509 CAGGGCGCTGAGGGGGTTGGAGG + Intronic
1167356960 19:49010291-49010313 CAGAGCGCTGAGGGTCACGGGGG - Intronic
1167423192 19:49415630-49415652 CTGGGAGCTGAGTGTCCTGGAGG - Intronic
1168094476 19:54106854-54106876 TGGGGCCCTGAGGGTCCTGGGGG - Exonic
1168277948 19:55287373-55287395 CAGGGCCTAGGGGGACCTGGGGG + Intronic
925979537 2:9165682-9165704 CCAGGGGTTGAGTGTCCTGGAGG + Intergenic
926130897 2:10302737-10302759 CCGGGCGCTGAGGGTCCGGCAGG + Intergenic
937304684 2:120864085-120864107 CTGGGTGTGGAGAGTCCTGGTGG + Intronic
938278764 2:130050370-130050392 CAGGGGGTGGAGGATTCTGGAGG + Intergenic
938329738 2:130441229-130441251 CAGGGGGTGGAGGATTCTGGAGG + Intergenic
938360208 2:130680274-130680296 CAGGGGGTGGAGGATTCTGGAGG - Intergenic
939628756 2:144510357-144510379 CAGAGAGGTGAGGGCCCTGGGGG - Intronic
944303794 2:198156546-198156568 CATGTTGTGGAGGGTCCTGGTGG + Intronic
944650167 2:201821821-201821843 CCGGGCGTGGTGGGGCCTGGTGG - Intronic
945101126 2:206263120-206263142 CAGGGAGTTGAGGGGCATTGAGG + Intergenic
945570179 2:211457619-211457641 CAGGGAGATGAGGGTCGTGGAGG + Intronic
947594065 2:231399891-231399913 CTGGGCTGTGAGGGGCCTGGGGG - Exonic
948270302 2:236668923-236668945 CAGGGAAAAGAGGGTCCTGGAGG - Intergenic
948291531 2:236828625-236828647 CAAGGTCTTGAGGGTCCAGGTGG - Intergenic
948459867 2:238123877-238123899 CAGTGGGGTGAGGGTCCTGGAGG + Intronic
948614460 2:239189776-239189798 CCGGGAGTTGAGGGTGCCGGAGG + Intronic
1171410415 20:24943383-24943405 CTGGGCCTTGAAGGTCATGGCGG - Intergenic
1172581334 20:36050890-36050912 GAGGGCCTGGAGGGCCCTGGAGG + Intergenic
1173805943 20:45925449-45925471 CAGGGAGATGAGGGCTCTGGAGG - Intergenic
1174425236 20:50427552-50427574 AAGGGGGATGAGGGTCCTTGGGG - Intergenic
1176376578 21:6089675-6089697 CACAGGGTTGAGGGGCCTGGTGG - Intergenic
1179125626 21:38588323-38588345 CAGGGCTTGGAGGGTGGTGGTGG - Intronic
1179746897 21:43448569-43448591 CACAGGGTTGAGGGGCCTGGTGG + Intergenic
1181505481 22:23353442-23353464 CAGGGCTTTGCTGCTCCTGGAGG - Intergenic
1181669331 22:24418871-24418893 CAGGCCCTTGAGGGTGCTGGAGG - Intronic
1182422213 22:30254094-30254116 CCGGGCTGGGAGGGTCCTGGAGG - Intergenic
1182798138 22:33006403-33006425 ATGGGCGTGGAGGGACCTGGAGG + Exonic
1183305366 22:37080187-37080209 CAGGCCCTTGAGTGGCCTGGGGG - Intronic
1183467024 22:37984918-37984940 GAAGGCGGTGAGGGTCCTGGGGG + Intronic
1184822216 22:46917887-46917909 CTGGGCGTTGAGAGTCCAGGTGG + Intronic
1185296867 22:50058752-50058774 CTGCGCGCTGCGGGTCCTGGCGG + Intergenic
950117114 3:10458306-10458328 CATGGGGTTGAGGTTACTGGGGG - Intronic
950660080 3:14461782-14461804 CAGGGCGCTGAGGATCCTTAGGG + Intronic
950698141 3:14720395-14720417 CAGTGCTTTCAGGGTGCTGGAGG + Intronic
955112162 3:55959968-55959990 CAGGGCTTTGAGGCACCAGGTGG - Intronic
956089570 3:65651470-65651492 CAGTGCCTTGATGGTCATGGTGG + Intronic
956389166 3:68753238-68753260 CCAGGGGTTGAGGATCCTGGAGG - Intronic
958264607 3:91423338-91423360 CAAGGAGTTTATGGTCCTGGAGG + Intergenic
961050010 3:123737977-123737999 CAGGGCAGTGAGGATCCTAGGGG - Intronic
961793214 3:129391512-129391534 CAGCTCCCTGAGGGTCCTGGTGG + Intergenic
961819190 3:129566575-129566597 CTGGGAGTTGAGGGTCTGGGAGG + Exonic
962747866 3:138410885-138410907 CAGGGTGTTGAGGGCCCGAGAGG - Intergenic
962751000 3:138434821-138434843 CAGGGCGCTGGGGGCCCCGGGGG - Exonic
964753594 3:160074771-160074793 CAGGGTGTTGAGTGTCTGGGAGG + Intergenic
968420440 4:479532-479554 CAGGACGTTCAGGGACCAGGGGG + Intronic
968610289 4:1554004-1554026 CAGGGGGCTGTGGGTCATGGGGG - Intergenic
968641514 4:1717260-1717282 CAGGGCGCAGGGGGTCCTGGCGG + Exonic
968830883 4:2932564-2932586 CTGGGCCTTTGGGGTCCTGGTGG - Intronic
968958332 4:3730382-3730404 CAGGGCATTTAGGGTGCCGGTGG + Intergenic
969276030 4:6136426-6136448 CACGACGTTGAGGGACCTGCTGG + Intronic
969642108 4:8405181-8405203 AAGGGCCTTGAGGGTCTTTGAGG - Intronic
974965823 4:68759831-68759853 CATGGGGTTGAGGGTTCTGGTGG + Intergenic
986718528 5:10541261-10541283 CAGGGCCTTCAGGGTCCTCCTGG - Intergenic
989923826 5:49845109-49845131 GAGCGCTTTGAGGGTCATGGTGG + Intergenic
991403755 5:66281492-66281514 CAGGACGTTGAGAGCCCTGGTGG - Intergenic
991503819 5:67303873-67303895 CAGGGCTTATAGGGTCCTGCAGG + Intergenic
992087069 5:73287450-73287472 CATGTCGTTGGGGGTACTGGTGG + Intergenic
996309509 5:122088681-122088703 TAGGGAGATGAGGGTGCTGGTGG - Intergenic
998135342 5:139671474-139671496 CAGGGTTTTGAGTTTCCTGGGGG - Intronic
998142905 5:139709896-139709918 CGGGGCGCTGGGGGTCCGGGAGG + Intergenic
1001045556 5:168368833-168368855 CAGGGCATGGAGGGTGGTGGCGG + Intronic
1002169632 5:177367774-177367796 CCACCCGTTGAGGGTCCTGGGGG + Exonic
1003187902 6:3849182-3849204 CAGCGCGGGGAGGATCCTGGAGG - Intergenic
1003245419 6:4378368-4378390 CAGGGCCCTGAAGGGCCTGGGGG + Intergenic
1003756611 6:9128213-9128235 GAGGGCCTTGTGGGTCCTGTAGG + Intergenic
1006301620 6:33196456-33196478 CAGGGCGTTGAGGGTCCTGGGGG - Exonic
1006377899 6:33681842-33681864 CAGGGCAATGAGGGTGATGGGGG + Intronic
1006390438 6:33755113-33755135 CAGGGCCTTAAGGGTCCTCAGGG - Intergenic
1009179357 6:60497870-60497892 CAAGGAGTTTATGGTCCTGGAGG - Intergenic
1011693037 6:89887496-89887518 CTGGGCGTACAGGGTCCTGACGG - Intergenic
1012582828 6:100889843-100889865 AAGGGTGCTGGGGGTCCTGGAGG - Intergenic
1012843092 6:104355288-104355310 CTAGTCATTGAGGGTCCTGGAGG + Intergenic
1017700588 6:157065959-157065981 GAGGGCTTTTGGGGTCCTGGTGG - Intronic
1018812424 6:167307712-167307734 CATGGCCTGGAGGGGCCTGGAGG - Intronic
1023965424 7:44961311-44961333 GAGGGGGTTGAGGGGGCTGGGGG + Intergenic
1023965476 7:44961452-44961474 GAGGGGGTTGAGGGGGCTGGGGG + Intergenic
1023965511 7:44961549-44961571 GAGGGGGTTGAGGGGGCTGGGGG + Intergenic
1026959039 7:74397067-74397089 CAGTTCGTTCAGGCTCCTGGGGG - Exonic
1029473175 7:100767276-100767298 CTGGGTGTTCAGGGTCCAGGAGG - Intronic
1029601398 7:101565603-101565625 CAGGTATCTGAGGGTCCTGGAGG - Intergenic
1031923191 7:127615900-127615922 CAGGACGGTGAGGAGCCTGGGGG - Intronic
1033304186 7:140212373-140212395 CTGGGCTCTGAGGCTCCTGGTGG - Intergenic
1033767964 7:144515325-144515347 CAGGGCTCTTAGAGTCCTGGGGG + Intronic
1034391795 7:150793015-150793037 CAGGGAGCTGGGGGCCCTGGAGG - Intronic
1034445424 7:151111572-151111594 CAGGGGGGTGAGGGGCCGGGGGG - Intronic
1035028670 7:155843685-155843707 CAGGGCTGTGGGGTTCCTGGGGG + Intergenic
1036224174 8:6944164-6944186 CAGGGCCTTAATGGTCCTGGAGG + Intergenic
1038394535 8:27237107-27237129 CAGGGAGCTCAGGGTCCTGTGGG + Intronic
1038948839 8:32391507-32391529 CTGGGCGTGGAGGGTCAGGGTGG - Intronic
1041378252 8:57224075-57224097 CAGCACTTTGAGGGCCCTGGGGG + Intergenic
1042227407 8:66524878-66524900 CAGGGCGGTGAGTGTCTAGGAGG - Intergenic
1042294338 8:67203450-67203472 CAGGGAGTTGGGAGTCCAGGAGG - Intronic
1042653561 8:71069715-71069737 GAGGGCTTTGAGGGTTCTGATGG - Intergenic
1043674749 8:82937125-82937147 CAGTGGGTTGAGGATCCTGGTGG - Intergenic
1045673867 8:104588246-104588268 CCGGGCGTGCAGGGTCCTGTTGG - Intronic
1048166585 8:132067055-132067077 CAGGGAGTTGCTGGGCCTGGAGG + Intronic
1049292708 8:141812978-141813000 CAGGGAGATGAGGGTGCTGGGGG - Intergenic
1049292716 8:141813002-141813024 CAGGGAGATGAGGGTGCTGGGGG - Intergenic
1049292773 8:141813163-141813185 CAGGGAGATGAGGGTGCTGGGGG - Intergenic
1049292797 8:141813233-141813255 CAGGGAGATGAGGGTGCTGGGGG - Intergenic
1049292855 8:141813391-141813413 CAGGGAGATGAGGGTGCTGGAGG - Intergenic
1049292861 8:141813415-141813437 CAGGGAGATGAGGGTGCTGGGGG - Intergenic
1049292947 8:141813642-141813664 CAGGGAGATGAGGGTGCTGGGGG - Intergenic
1049482746 8:142834720-142834742 CGGGGCTTTGAGGGTCCGGAAGG + Intronic
1049620777 8:143597519-143597541 CGGCGCGTCGAGGGTCCTGGCGG - Exonic
1049746283 8:144264670-144264692 CTGGGCGGCGGGGGTCCTGGAGG - Intronic
1053453191 9:38210643-38210665 CAGGGCCCTGAGGGTCCTGGAGG - Intergenic
1056789357 9:89615738-89615760 TAGGGGCTTGAGTGTCCTGGGGG + Intergenic
1056925560 9:90831236-90831258 CAGGAAGTTGAGGGGGCTGGAGG + Intronic
1057600218 9:96450726-96450748 GGGAGAGTTGAGGGTCCTGGTGG + Intronic
1058348964 9:103999327-103999349 AAGGGCCTGGAGGGCCCTGGGGG - Intergenic
1059170980 9:112124319-112124341 GAGGGCTTTGAGAGCCCTGGAGG - Exonic
1061242667 9:129383483-129383505 CAGGGCGTGAAGGATCGTGGGGG + Intergenic
1061590730 9:131596045-131596067 CAGGGCCTCCAGGGTCCTTGAGG - Intronic
1061865603 9:133490539-133490561 CTGGGGATTGAGGGACCTGGAGG + Intergenic
1062363540 9:136198478-136198500 CAGGGCGGGGAGGGTGCTGGGGG + Intronic
1185906415 X:3937886-3937908 CTGGGCTTTGAGGTTCCTTGGGG - Intergenic
1187016849 X:15337414-15337436 GAGGGCGTTGAGGAGCCTGCAGG + Intergenic
1188303064 X:28529203-28529225 CTGGGCTTTGAGGGGCATGGTGG - Intergenic
1189269231 X:39739199-39739221 CAGGTATTTGAGGCTCCTGGGGG - Intergenic
1191740663 X:64433109-64433131 CATGACGTTGAGGCTGCTGGTGG - Intergenic
1197775797 X:130117992-130118014 CAGGCCCTTGAGTGTGCTGGGGG + Intergenic
1198154496 X:133945522-133945544 CAGAGGGTAGAGGTTCCTGGAGG - Intronic
1200215081 X:154364730-154364752 CAGGGCACTGAGGGGACTGGTGG - Intronic