ID: 1006301621

View in Genome Browser
Species Human (GRCh38)
Location 6:33196457-33196479
Sequence CCAGGGCGTTGAGGGTCCTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 205}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006301621_1006301631 27 Left 1006301621 6:33196457-33196479 CCCCAGGACCCTCAACGCCCTGG 0: 1
1: 0
2: 0
3: 13
4: 205
Right 1006301631 6:33196507-33196529 GCCTCCAGGATCCTGTCCACAGG 0: 1
1: 2
2: 2
3: 46
4: 205
1006301621_1006301630 13 Left 1006301621 6:33196457-33196479 CCCCAGGACCCTCAACGCCCTGG 0: 1
1: 0
2: 0
3: 13
4: 205
Right 1006301630 6:33196493-33196515 CCACAGCAAGCTCTGCCTCCAGG 0: 2
1: 161
2: 13899
3: 98792
4: 125071

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006301621 Original CRISPR CCAGGGCGTTGAGGGTCCTG GGG (reversed) Exonic
900312660 1:2041688-2041710 CCAGGGCGTGGACTGGCCTGGGG - Intergenic
902468051 1:16630335-16630357 CCAGGGAGATGAGGGTTCAGAGG - Intergenic
902532533 1:17099461-17099483 CCAGGGTCTTGAAGGTCCTTAGG + Intronic
903156916 1:21451668-21451690 ACAGGGCATAGTGGGTCCTGGGG + Intronic
903692365 1:25183631-25183653 GCAGGGCGGTGAGGGTGGTGAGG - Intergenic
904872026 1:33625014-33625036 CCCGGGCGTTGAGGGTGCGGGGG - Intronic
905479082 1:38248860-38248882 CCAGGGAGCCTAGGGTCCTGCGG + Intergenic
905811034 1:40913390-40913412 CCAGGGGGTTGAGGCTGCAGTGG - Intergenic
905829134 1:41050207-41050229 CCAGGTTGCTGTGGGTCCTGAGG - Intronic
907930746 1:58997601-58997623 CTAGGGGGTTAAGTGTCCTGAGG + Intergenic
908401346 1:63774785-63774807 GGAGGGGTTTGAGGGTCCTGGGG + Intronic
916563612 1:165954415-165954437 CCATGGCCTTTGGGGTCCTGGGG + Intergenic
919828096 1:201518342-201518364 CAAGGGGGTAGAGGGTACTGAGG - Intergenic
920251428 1:204624764-204624786 CCCGGGAGCTGAGGGTCCAGAGG + Intronic
924251806 1:242140560-242140582 CCAGGGGGTTGAGGTTGCAGTGG + Intronic
1067057419 10:43060423-43060445 CCAGGGTGAGGAGGATCCTGTGG + Intergenic
1067551024 10:47236646-47236668 CCAGTGCCCTGAGGGTTCTGGGG - Intergenic
1070692739 10:78539581-78539603 CCAAGAAGCTGAGGGTCCTGAGG + Intergenic
1070874668 10:79792045-79792067 CCAGGGGGTTGAGGCTGCAGTGG - Intergenic
1074908605 10:117886946-117886968 TCAGGGAGTTTAGGGTCCAGTGG - Intergenic
1083308158 11:61771545-61771567 TCTGGGCATTGAGGGTGCTGGGG - Exonic
1083879942 11:65543362-65543384 CCTGGGGGGTGGGGGTCCTGGGG + Intronic
1084155538 11:67310810-67310832 CCAGGGCCTGCAGGGGCCTGTGG - Intronic
1084424745 11:69078559-69078581 CCAGGGCGATGAGGTTCCCCAGG - Exonic
1084468803 11:69343159-69343181 CCAGGGAGCTGAGGGGCCTCCGG - Intronic
1084599055 11:70134048-70134070 CCAGGGTGAGGAGGGTCTTGAGG - Intronic
1085393406 11:76194133-76194155 CCAGGGCGTGGAGAGGGCTGTGG - Intronic
1090450085 11:126798371-126798393 CCAGGGCATTGAGTATCCAGTGG + Intronic
1090766297 11:129879155-129879177 CCTGGCCGATGATGGTCCTGTGG - Intronic
1092065556 12:5587510-5587532 ACAGGGCTGTGAGGGGCCTGCGG + Intronic
1098819182 12:75207896-75207918 GCAGGGTCTTGAGGGTGCTGCGG + Exonic
1102020798 12:109681014-109681036 CCAGGAGGTTGAGGGTGCAGTGG - Intergenic
1105820441 13:24076584-24076606 CCAGGCCACTGAGGGTCTTGTGG + Intronic
1107086484 13:36432113-36432135 CCTGGGCGTTCAGGCCCCTGAGG - Intronic
1107826645 13:44334412-44334434 CCAGGGCGGTGAGGGTGTTGAGG + Intergenic
1113473176 13:110561313-110561335 CCAGGGCGGTGTGGCTCATGCGG + Intronic
1115755074 14:36521062-36521084 CCCGCGCCTTGAGGGTCCTTGGG + Intronic
1117324122 14:54653245-54653267 GCAGGGCCTTGAGGCCCCTGAGG + Intronic
1120925803 14:89796134-89796156 ACAGGGTGATGAGGGTACTGGGG - Exonic
1122108666 14:99480515-99480537 CCAGGGCGAGGAGGGCCCGGCGG - Intronic
1122637237 14:103135897-103135919 CAGGGGCTTTTAGGGTCCTGTGG + Exonic
1122750378 14:103928496-103928518 CCTGGGCCTTGAGGATGCTGCGG + Exonic
1122937846 14:104968136-104968158 CCAGGGCGCTGGGGGGCCCGGGG - Intronic
1123499246 15:20865753-20865775 CCAGGGTGGTGTGGGGCCTGCGG + Intronic
1123556481 15:21439372-21439394 CCAGGGTGGTGTGGGGCCTGCGG + Intronic
1123592722 15:21876718-21876740 CCAGGGTGGTGTGGGGCCTGCGG + Intergenic
1124061016 15:26293816-26293838 CCAGGACAGTGAGGGTCCAGTGG + Intergenic
1127383152 15:58446750-58446772 CCAGGCCTGTGTGGGTCCTGGGG - Intronic
1128341267 15:66824047-66824069 TCAGGGCCTTGAGGGCCATGGGG + Intergenic
1128342436 15:66831844-66831866 CCACGGCGCTGAGGATTCTGGGG - Intergenic
1129206950 15:74043045-74043067 CCAGGACCCTGAGGGTGCTGGGG - Exonic
1129224708 15:74162203-74162225 CCAGGGCTCTGAGAGTCCTCAGG + Intergenic
1129684491 15:77677387-77677409 CCAGGGAGTTGATGCTCCTGAGG - Intronic
1130060950 15:80569599-80569621 CCAGAGCAGTTAGGGTCCTGGGG + Intronic
1130273509 15:82464630-82464652 CCAGGGTGTTGCGGGAGCTGAGG - Intergenic
1130486839 15:84402824-84402846 CCAGGGTGTTGCGGGAGCTGAGG + Intergenic
1130588149 15:85196597-85196619 CCAGGGTGTTGCGGGAGCTGAGG - Intergenic
1132073638 15:98801156-98801178 CAAGGGCTTTGAGGGCTCTGAGG - Intronic
1132118919 15:99159670-99159692 CCAGGTCGTGGACGGTACTGTGG + Intronic
1132299416 15:100766988-100767010 CCAGGCTGGGGAGGGTCCTGCGG + Intergenic
1202964823 15_KI270727v1_random:166561-166583 CCAGGGTGGTGTGGGGCCTGCGG + Intergenic
1132609395 16:807682-807704 CCAGGGCGTGGCGGGCCCTCGGG + Intronic
1132651968 16:1025351-1025373 CCCCGGCGTGGAGGGTGCTGAGG + Intergenic
1133080572 16:3315837-3315859 CCAGACCATGGAGGGTCCTGAGG - Intronic
1134336869 16:13308415-13308437 CCATGGCACTGAGGGTCCTGAGG + Intergenic
1135599252 16:23767801-23767823 CCAGGGGGTTGAGGCTGCAGTGG + Intergenic
1136584420 16:31174777-31174799 CTGGGGCCTTGGGGGTCCTGGGG - Intergenic
1137270608 16:46900264-46900286 CTAGGGCGTTGAGGGAGCTCAGG + Intronic
1138507504 16:57485718-57485740 CTAGGGCCTTGCGGGCCCTGGGG + Intronic
1140258642 16:73358182-73358204 CCAGGGAGTGGACGGTGCTGGGG - Intergenic
1140625957 16:76794520-76794542 CCAGCTATTTGAGGGTCCTGAGG - Intergenic
1140790704 16:78388411-78388433 CCAAGGCGGGGAGGGTCATGAGG + Intronic
1140852316 16:78946713-78946735 TCAGAGCGTTGAGAGTCATGCGG + Intronic
1142172454 16:88630005-88630027 CCAGGGCCTCTGGGGTCCTGCGG + Intronic
1142207454 16:88790943-88790965 GGAGGGGGTTGAGGCTCCTGGGG - Intergenic
1142561472 17:811805-811827 CCAGTGCGTTGAGGTGTCTGGGG - Intronic
1143045794 17:4078286-4078308 CCAGGGGGGTAAGGTTCCTGAGG - Intronic
1144855548 17:18265423-18265445 TCAGGCAGCTGAGGGTCCTGGGG + Exonic
1145815504 17:27792655-27792677 GCAGGTCCTTGAGGGTCCTCAGG - Intronic
1147179233 17:38674257-38674279 CCAGGGCGCAGGGGGGCCTGAGG + Exonic
1147955976 17:44134862-44134884 CCAGGGTGTTCTGGGTCCTCAGG - Intergenic
1150225832 17:63523953-63523975 CTAGGGCAGTGAGGGTCTTGAGG - Intronic
1150654655 17:67031860-67031882 CCTGAGCGTTGGGGGTCCCGGGG + Exonic
1151819470 17:76489897-76489919 CCAGGGCCTGGAGGCTCCTAGGG + Intronic
1154457289 18:14542507-14542529 CCAGGGTGGTGTGGGGCCTGCGG + Intronic
1160587876 18:79922791-79922813 CGAGGGGGTTGGGGGTGCTGAGG + Intronic
1160873544 19:1287276-1287298 CCGGGGCTTTGGGGGTCCTGGGG + Intronic
1162948558 19:14057589-14057611 CCAGGGCGGGGAGGGGGCTGCGG + Intronic
1163529987 19:17843333-17843355 CCAGGGGGTTGGGGGTCCAAGGG - Intronic
1163578066 19:18122143-18122165 CCAGGGGGTGGGGGGTCATGGGG + Intronic
1163602485 19:18257446-18257468 CCAGGGCACTGAGGGCCCCGGGG - Exonic
1163628338 19:18403647-18403669 CCTGGGGCCTGAGGGTCCTGGGG + Intergenic
1163699056 19:18778040-18778062 ACAGGGCGAGGAGGGTCGTGGGG - Exonic
1163714967 19:18868250-18868272 GCAGGGGGTGGAGGGTGCTGGGG + Intergenic
1165104239 19:33459605-33459627 CCTGGGAGTTGAGGGTTCAGAGG - Intronic
1165419867 19:35717529-35717551 CCAGGGCCTCGGGGGTCCCGGGG + Intergenic
1167356961 19:49010292-49010314 CCAGAGCGCTGAGGGTCACGGGG - Intronic
1168094477 19:54106855-54106877 CTGGGGCCCTGAGGGTCCTGGGG - Exonic
1168224195 19:54982711-54982733 CCAGGGCCCTGAGGGACCTCCGG + Exonic
925027941 2:624311-624333 CCAGGGCGATTGAGGTCCTGAGG + Intergenic
926814008 2:16782419-16782441 CAAGGGCCTAGAGGCTCCTGGGG - Intergenic
927516485 2:23674780-23674802 CCAGGGAGTGGGGTGTCCTGAGG - Intronic
929666978 2:43840797-43840819 CCAGGGTGTTGAGGGCCCCATGG - Intronic
929779730 2:44949836-44949858 CCAGGGGGTCGAGCGTCCCGCGG - Intergenic
929802328 2:45114702-45114724 CCAGGGCGTTGCAGGCCCTCAGG - Intergenic
931646327 2:64425037-64425059 ACAGGGCTTTAAGGGTCATGGGG - Intergenic
932313617 2:70764894-70764916 CCAGGGGGCTGAGAGACCTGTGG + Intronic
935598250 2:104896677-104896699 CCAGGACGTGGAGTGTCATGAGG - Intergenic
937912698 2:127083328-127083350 CCAGCACCTTGAGGGTGCTGAGG - Intronic
938762529 2:134438765-134438787 CCAGGGCTGTATGGGTCCTGGGG + Intronic
939628757 2:144510358-144510380 CCAGAGAGGTGAGGGCCCTGGGG - Intronic
945307193 2:208269628-208269650 CCAAGGTGATGAAGGTCCTGGGG - Intronic
947588508 2:231371251-231371273 CATGGGCGTTGTGTGTCCTGTGG + Intronic
1168836046 20:878125-878147 CCAGGCCGTTGTGGGGGCTGGGG - Intronic
1172252939 20:33492587-33492609 CCAGGAGGTTGAGGCTGCTGTGG - Intronic
1172873493 20:38150067-38150089 CCAGGAGGTTGAGGGGCCAGGGG + Intronic
1174135411 20:48375689-48375711 CCAGGGCGTTGGGGAGACTGTGG - Intergenic
1174377027 20:50133084-50133106 CCAGGGTCTTGGGGGTACTGTGG + Intronic
1175176350 20:57114770-57114792 CCAGGGGGAGGAGGGGCCTGAGG + Intergenic
1175299287 20:57931554-57931576 CCAGGTACTTCAGGGTCCTGTGG + Intergenic
1175733639 20:61370951-61370973 CCAGAGCGCTGAGGCTCCTCGGG - Intronic
1175895208 20:62333019-62333041 CCTGGGGGCTGGGGGTCCTGTGG - Intronic
1175997712 20:62818873-62818895 TCCAGGGGTTGAGGGTCCTGGGG + Intronic
1176816870 21:13610846-13610868 CCAGGGTGGTGTGGGGCCTGCGG - Intronic
1178793502 21:35722117-35722139 ACAGGGAGTTGTGGTTCCTGAGG - Intronic
1179913520 21:44462271-44462293 CCATGGAGCTGAGGGACCTGTGG + Intergenic
1180064357 21:45405203-45405225 CCGCGGCGCTGACGGTCCTGGGG + Intronic
1181006125 22:20014569-20014591 GCTGGGCCTTGGGGGTCCTGGGG - Intronic
1181873450 22:25921551-25921573 TCAGGGCTGTGAGGGTCATGTGG + Intronic
1181896938 22:26118310-26118332 CCAGGAAGTTGAGGGTCCTATGG - Intergenic
1183455777 22:37922340-37922362 CCGGGGCGTGGGGGGTGCTGGGG - Exonic
1183467023 22:37984917-37984939 TGAAGGCGGTGAGGGTCCTGGGG + Intronic
1183925527 22:41203207-41203229 CCAGGTCATTCAGGGTCTTGTGG - Intergenic
1183932982 22:41246656-41246678 CCAGGGCGCTGTTGGGCCTGCGG + Exonic
1184094281 22:42308239-42308261 CCAAGGGGTTGAGGGTCAGGTGG - Intronic
1184688842 22:46108424-46108446 CCAGGCTATTGAGGGGCCTGTGG - Intronic
1185048511 22:48541252-48541274 CCAGGGGGTATAGGGTCCTGGGG - Intronic
1185297982 22:50063686-50063708 CCAGGGAGGTGAGAGGCCTGTGG - Intronic
950032053 3:9859905-9859927 CCAGCGCTTTGAGGCCCCTGGGG + Intergenic
950117115 3:10458307-10458329 CCATGGGGTTGAGGTTACTGGGG - Intronic
950415875 3:12868920-12868942 CCAGCGCTTTGAGGCCCCTGTGG + Intronic
950417321 3:12876035-12876057 CCAGCGCTTTGAGGACCCTGTGG + Intergenic
950660079 3:14461781-14461803 CCAGGGCGCTGAGGATCCTTAGG + Intronic
951449033 3:22815650-22815672 CCAGGGAGATGGGGGTGCTGAGG - Intergenic
952047247 3:29337569-29337591 CCAGGAGGTTGAGGGAACTGTGG + Intronic
954451063 3:50571983-50572005 CCAGGGCCTTGGGACTCCTGAGG - Intronic
954502266 3:51029686-51029708 CCAGGGAGTTGTGGGTCCCCTGG - Intronic
954699402 3:52443504-52443526 CCCAGGAGTTGAGGATCCTGAGG + Intronic
956114464 3:65904467-65904489 CCACGGCCTTCAGGGCCCTGCGG + Intronic
962278018 3:134030204-134030226 CAAGGGGGTGGAGGTTCCTGGGG + Intronic
962751001 3:138434822-138434844 CCAGGGCGCTGGGGGCCCCGGGG - Exonic
967919244 3:194602252-194602274 CCAGGCCGCTGTGGCTCCTGGGG + Intronic
968610290 4:1554005-1554027 CCAGGGGGCTGTGGGTCATGGGG - Intergenic
974139305 4:57864341-57864363 CCAGGACGTTGAGGATGCAGGGG - Intergenic
977053699 4:92162843-92162865 CCAGGGAGTTGTGGGCCCTCTGG + Intergenic
979929940 4:126617552-126617574 CCATGGAGTTGCAGGTCCTGTGG + Intergenic
981545626 4:145890369-145890391 CAAGGGCTTTGTGGGTCGTGGGG - Intronic
983482864 4:168296945-168296967 CCAGGAGGTGGAGGTTCCTGTGG - Intronic
985494803 5:198469-198491 CCAGGGTGCTGGGTGTCCTGAGG + Exonic
985652667 5:1114130-1114152 CCCAGGAGTTTAGGGTCCTGTGG + Intergenic
985724229 5:1507273-1507295 TCAGGGTGATCAGGGTCCTGTGG - Intronic
985821989 5:2166708-2166730 CCAGGGCTGTCAGGGTCCGGAGG - Intergenic
987403232 5:17499089-17499111 CCTGGGCCTTGAGCATCCTGTGG + Intergenic
987410711 5:17611845-17611867 CCTGGGCCTTGAGCATCCTGTGG + Intergenic
989056546 5:37371226-37371248 CGAGGGGGTTGAGGGTTTTGGGG + Intergenic
989732596 5:44665486-44665508 CCAGAGCGGTGAGGGTTGTGTGG - Intergenic
997643667 5:135466306-135466328 CCAGGGCGTGGAGGGGGCCGGGG - Intergenic
998101200 5:139436335-139436357 CCAGAGCTTTGGGGGTGCTGAGG - Intronic
998135343 5:139671475-139671497 CCAGGGTTTTGAGTTTCCTGGGG - Intronic
998162720 5:139822514-139822536 CCAGGGTGGTCAGGCTCCTGGGG + Intronic
999415264 5:151389562-151389584 CCAGGGTGTTGAGGGGTCGGGGG - Intergenic
1001143515 5:169164609-169164631 CCAGGGCCTGGAGGGTCTGGCGG - Intronic
1002643086 5:180639914-180639936 CCAGGGCTTTGCGGGGCCTCAGG - Intronic
1006301621 6:33196457-33196479 CCAGGGCGTTGAGGGTCCTGGGG - Exonic
1006377898 6:33681841-33681863 CCAGGGCAATGAGGGTGATGGGG + Intronic
1006390439 6:33755114-33755136 GCAGGGCCTTAAGGGTCCTCAGG - Intergenic
1007634034 6:43287409-43287431 CCAGGGTGTTGTTGGTCCTGGGG - Exonic
1009576651 6:65471319-65471341 CCAGGAGGTTGAGGCTGCTGTGG + Intronic
1015595176 6:134859517-134859539 CCCAGGTTTTGAGGGTCCTGAGG + Intergenic
1019210665 6:170402000-170402022 CCAGGGCGCAGGGAGTCCTGAGG - Intronic
1020445239 7:8261696-8261718 CCAGGGAGCTCGGGGTCCTGGGG + Intronic
1023872060 7:44268655-44268677 CCAAGGCTTCGGGGGTCCTGTGG - Intronic
1030639080 7:111984085-111984107 CCTGGGCGTTGAGGGCCCACTGG + Intronic
1032189542 7:129756274-129756296 CAGGGGCGTTCAGGGTGCTGTGG - Exonic
1033767963 7:144515324-144515346 CCAGGGCTCTTAGAGTCCTGGGG + Intronic
1034306507 7:150048500-150048522 CCCGGGAGCTGAGGGTTCTGCGG + Intergenic
1034641552 7:152607944-152607966 CCAGGGCGTTTGGGGTTCTTAGG - Intergenic
1034970123 7:155413494-155413516 CCAGGGCGGTGAGGGTGCTCCGG + Intergenic
1035028669 7:155843684-155843706 CCAGGGCTGTGGGGTTCCTGGGG + Intergenic
1035083107 7:156233663-156233685 CCAGAGCTTGGAGGGCCCTGCGG + Intergenic
1038394534 8:27237106-27237128 CCAGGGAGCTCAGGGTCCTGTGG + Intronic
1039970854 8:42320616-42320638 CCAGTCCATTGAGGGTCCTCAGG + Intronic
1041378251 8:57224074-57224096 CCAGCACTTTGAGGGCCCTGGGG + Intergenic
1042880270 8:73480184-73480206 CCAGGGCATTGAGGATATTGGGG - Intronic
1047274531 8:123395864-123395886 CCAGGGAGTGGGGGGTCGTGCGG + Intronic
1047734334 8:127752370-127752392 CCAGGGCTATCTGGGTCCTGTGG + Intergenic
1048037622 8:130692672-130692694 CCAGGGAGTTGTGGGTCCCCCGG - Intergenic
1049292709 8:141812979-141813001 TCAGGGAGATGAGGGTGCTGGGG - Intergenic
1049292717 8:141813003-141813025 TCAGGGAGATGAGGGTGCTGGGG - Intergenic
1049292774 8:141813164-141813186 TCAGGGAGATGAGGGTGCTGGGG - Intergenic
1049292798 8:141813234-141813256 TCAGGGAGATGAGGGTGCTGGGG - Intergenic
1049292862 8:141813416-141813438 TCAGGGAGATGAGGGTGCTGGGG - Intergenic
1049292948 8:141813643-141813665 TCAGGGAGATGAGGGTGCTGGGG - Intergenic
1049702893 8:144023118-144023140 CCTGGGGGGAGAGGGTCCTGAGG - Intronic
1049703190 8:144024203-144024225 CCTGAGGGTAGAGGGTCCTGAGG - Intronic
1049795954 8:144497326-144497348 CCAGGGCAAGAAGGGTCCTGGGG + Exonic
1056558211 9:87707133-87707155 GCAGGGCGTGGAGGGGGCTGGGG - Exonic
1061242666 9:129383482-129383504 CCAGGGCGTGAAGGATCGTGGGG + Intergenic
1061482278 9:130903106-130903128 CCAGGGACTCCAGGGTCCTGAGG - Exonic
1061904915 9:133691852-133691874 CCAGGGCTCTGCGGGTCCTGGGG - Intronic
1061937579 9:133866729-133866751 CCAGGACGTGGAGGTTCCAGTGG + Intronic
1062282820 9:135759580-135759602 CCTGGGCAGTGAGGGTCCCGTGG + Intronic
1062363539 9:136198477-136198499 CCAGGGCGGGGAGGGTGCTGGGG + Intronic
1185906416 X:3937887-3937909 CCTGGGCTTTGAGGTTCCTTGGG - Intergenic
1189288711 X:39870348-39870370 CTGGGGGGTTGAGGGTGCTGTGG - Intergenic
1191251028 X:58260278-58260300 CCAGGCCCTTGGGGGTCTTGGGG + Intergenic
1199676539 X:150194533-150194555 CCTGGGAGCTGAGGTTCCTGGGG - Intergenic
1202369374 Y:24186715-24186737 CCAGGGTGTTGCGGGAGCTGAGG + Intergenic
1202501411 Y:25483402-25483424 CCAGGGTGTTGCGGGAGCTGAGG - Intergenic