ID: 1006301623

View in Genome Browser
Species Human (GRCh38)
Location 6:33196458-33196480
Sequence ACCAGGGCGTTGAGGGTCCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 121}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006301623_1006301630 12 Left 1006301623 6:33196458-33196480 CCCAGGACCCTCAACGCCCTGGT 0: 1
1: 0
2: 0
3: 11
4: 121
Right 1006301630 6:33196493-33196515 CCACAGCAAGCTCTGCCTCCAGG 0: 2
1: 161
2: 13899
3: 98792
4: 125071
1006301623_1006301631 26 Left 1006301623 6:33196458-33196480 CCCAGGACCCTCAACGCCCTGGT 0: 1
1: 0
2: 0
3: 11
4: 121
Right 1006301631 6:33196507-33196529 GCCTCCAGGATCCTGTCCACAGG 0: 1
1: 2
2: 2
3: 46
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006301623 Original CRISPR ACCAGGGCGTTGAGGGTCCT GGG (reversed) Exonic
900312662 1:2041689-2041711 ACCAGGGCGTGGACTGGCCTGGG - Intergenic
900327055 1:2113546-2113568 ACCAGGGCCTTGAGTGAGCTGGG + Intronic
902050353 1:13559450-13559472 ACCAGGGACTTGAGGATCCAAGG + Intergenic
903156915 1:21451667-21451689 AACAGGGCATAGTGGGTCCTGGG + Intronic
904872028 1:33625015-33625037 ACCCGGGCGTTGAGGGTGCGGGG - Intronic
915088446 1:153404897-153404919 ACCAGGGCGAGGTGGGTGCTCGG + Intergenic
924584549 1:245350586-245350608 ACCTGGGCTTTGATGGTCCCAGG - Intronic
1063437592 10:6047107-6047129 TGCAGGGATTTGAGGGTCCTTGG - Intronic
1064426861 10:15237077-15237099 AAGAGGGCCTTGAGGCTCCTGGG + Intronic
1069606726 10:69743557-69743579 ACCAGGCCGCTGATGGCCCTAGG + Intergenic
1069716830 10:70526527-70526549 ACCAGGCTGTTGAAGGGCCTTGG + Intronic
1071482949 10:86078774-86078796 GCCAGGGGGCTGGGGGTCCTAGG - Intronic
1073185871 10:101614720-101614742 AACAGAGCCTTGAGGGTCCTGGG - Intronic
1074650802 10:115522576-115522598 ACCAGGGATTTGAGGGGCCAGGG - Intronic
1075646845 10:124102430-124102452 ACCAGGGTATGGAGGGCCCTTGG - Intergenic
1076554423 10:131312177-131312199 TCCAGGGCGCGGAGGGTACTGGG + Intergenic
1077837510 11:5937628-5937650 ACCAGGGCGGAGAGGGTCGTAGG - Intronic
1080663394 11:34315263-34315285 ACCAGGGCACTGAGGTTCCTGGG + Intronic
1083308159 11:61771546-61771568 ATCTGGGCATTGAGGGTGCTGGG - Exonic
1084323937 11:68388360-68388382 ACCAGGGCTAGGAGGGGCCTTGG - Intronic
1084536129 11:69758315-69758337 CCCAGGCAGCTGAGGGTCCTTGG + Intergenic
1084608878 11:70188087-70188109 ACCAGGGCCCGGTGGGTCCTGGG + Exonic
1084795976 11:71504327-71504349 TCCAGGCTGCTGAGGGTCCTGGG + Intronic
1087239339 11:95757602-95757624 AACATGGTGTTGAGGTTCCTTGG - Intergenic
1090225939 11:125072411-125072433 ACAAGGTCTTTGAGGGTCATGGG + Intronic
1097269784 12:57766900-57766922 AGCTGGGCGTAGAGGGGCCTGGG + Exonic
1109062284 13:57633645-57633667 ACCAGGGCGATGACGGTGCCGGG - Exonic
1113586332 13:111468484-111468506 GCCGGGCCGGTGAGGGTCCTGGG - Intergenic
1115755072 14:36521061-36521083 CCCCGCGCCTTGAGGGTCCTTGG + Intronic
1118983238 14:70732727-70732749 ACCAGGGGGTTGTGGGTACATGG + Exonic
1120925804 14:89796135-89796157 AACAGGGTGATGAGGGTACTGGG - Exonic
1123038887 14:105482434-105482456 ACCAGGGCCTTGTGGATCCCTGG - Intergenic
1124029971 15:26001593-26001615 ACCAGGCCGCTGAGGGCCCCAGG - Intergenic
1126163499 15:45634874-45634896 ACCAGGGCGTTGAGCGCTCACGG - Exonic
1132609393 16:807681-807703 CCCAGGGCGTGGCGGGCCCTCGG + Intronic
1132616757 16:844867-844889 ACCAGGACGTGGAGGCTCCGGGG - Intergenic
1135091627 16:19522274-19522296 ACCTGGGCGTTCAGACTCCTAGG + Intergenic
1135656580 16:24255834-24255856 GCCAGGGCGCTGACTGTCCTCGG + Exonic
1136584421 16:31174778-31174800 ACTGGGGCCTTGGGGGTCCTGGG - Intergenic
1140409012 16:74730160-74730182 AGCAGGGGGGTGGGGGTCCTGGG + Intronic
1141743818 16:85912817-85912839 TCCAGGGCGTTGAGGGCAATTGG + Intronic
1142207455 16:88790944-88790966 AGGAGGGGGTTGAGGCTCCTGGG - Intergenic
1142761281 17:2043172-2043194 AGCAGTGAGTGGAGGGTCCTGGG - Exonic
1145963825 17:28902969-28902991 TCCAGGGCGGTGCGGGGCCTGGG - Exonic
1146842591 17:36166241-36166263 ACCTGGACGTAGAGGGGCCTTGG - Exonic
1146854904 17:36254200-36254222 ACCTGGACGTAGAGGGCCCTTGG - Exonic
1146865716 17:36334176-36334198 ACCTGGACGTAGAGGGCCCTTGG + Exonic
1146870804 17:36378092-36378114 ACCTGGACGTAGAGGGCCCTTGG - Exonic
1146878163 17:36429174-36429196 ACCTGGACGTAGAGGGCCCTTGG - Exonic
1146882112 17:36450320-36450342 ACCTGGACGTAGAGGGCCCTTGG - Intergenic
1147068585 17:37934788-37934810 ACCTGGACGTAGAGGGCCCTTGG + Exonic
1147073688 17:37978716-37978738 ACCTGGACGTAGAGGGCCCTTGG - Intronic
1147080108 17:38014325-38014347 ACCTGGACGTAGAGGGCCCTTGG + Intronic
1147085209 17:38058254-38058276 ACCTGGACGTAGAGGGCCCTTGG - Exonic
1147096057 17:38138285-38138307 ACCTGGACGTAGAGGGCCCTTGG + Intergenic
1147101156 17:38182220-38182242 ACCTGGACGTAGAGGGCCCTTGG - Intergenic
1151819468 17:76489896-76489918 TCCAGGGCCTGGAGGCTCCTAGG + Intronic
1158536322 18:58311435-58311457 CCCAGGGGGTTGAGGGTGCAAGG - Intronic
1159941641 18:74413017-74413039 GCCACGGAGATGAGGGTCCTGGG - Intergenic
1160720770 19:596026-596048 TCCAAGGGGCTGAGGGTCCTGGG + Intronic
1160836681 19:1127809-1127831 TCCAGTGCGTGGAGGGGCCTTGG - Intronic
1160873542 19:1287275-1287297 GCCGGGGCTTTGGGGGTCCTGGG + Intronic
1162445117 19:10718176-10718198 GCCAGGTCGTTGAGGGTCGGCGG + Exonic
1163529989 19:17843334-17843356 CCCAGGGGGTTGGGGGTCCAAGG - Intronic
1166044830 19:40223690-40223712 AGCACGGGCTTGAGGGTCCTGGG + Intronic
925429452 2:3778487-3778509 ACCAGGGAGCAGAGGGCCCTGGG + Intronic
933559671 2:83874687-83874709 ACCAGGGCGGAGAGGGTCGTAGG + Intergenic
939628759 2:144510359-144510381 ACCAGAGAGGTGAGGGCCCTGGG - Intronic
943514018 2:188862501-188862523 ACCAGGTCGCTTAGGGTCTTAGG - Intergenic
949035692 2:241814844-241814866 ACCAGGACGTCCAGGGACCTGGG - Intronic
1169041105 20:2496300-2496322 ACCAGCCCATTGAAGGTCCTAGG + Intronic
1172132335 20:32664176-32664198 ACCTGGGAGGTGAGGGCCCTGGG + Intergenic
1172873491 20:38150066-38150088 ACCAGGAGGTTGAGGGGCCAGGG + Intronic
1175733641 20:61370952-61370974 CCCAGAGCGCTGAGGCTCCTCGG - Intronic
1176242523 20:64081645-64081667 GTCAGGGCGCAGAGGGTCCTGGG - Intronic
1179013538 21:37574946-37574968 ACCAGAGCGCTAAGGGTCCTCGG + Intergenic
1179297305 21:40074901-40074923 ACCAGGCAGTGGAGGGACCTGGG + Intronic
1181006126 22:20014570-20014592 AGCTGGGCCTTGGGGGTCCTGGG - Intronic
1181802770 22:25358223-25358245 ACCAGGGCTAGGAGGGACCTTGG + Intronic
1182245354 22:28953134-28953156 ACCAGGGTGTCAAGGGCCCTAGG + Intronic
1185048513 22:48541253-48541275 CCCAGGGGGTATAGGGTCCTGGG - Intronic
950117117 3:10458308-10458330 ACCATGGGGTTGAGGTTACTGGG - Intronic
951326842 3:21313185-21313207 ACCAGGGCCTTGAGGGTAAAAGG + Intergenic
952676039 3:36031122-36031144 ACCAGATGGTTGAGGGCCCTGGG - Intergenic
953389721 3:42527216-42527238 ACCAGGGCGTTAGGGGTCAGGGG + Intronic
959152825 3:102628512-102628534 ACCAGGGACTTGAGCATCCTTGG + Intergenic
960937490 3:122912743-122912765 ACCTGGGCATTGGGGTTCCTGGG + Intronic
961050012 3:123737979-123738001 AACAGGGCAGTGAGGATCCTAGG - Intronic
969373229 4:6747223-6747245 ACCTGGACGCTGAGGGCCCTTGG - Intergenic
969929235 4:10613965-10613987 GCCTGGGCATTCAGGGTCCTTGG - Intronic
975721103 4:77249507-77249529 ACCAGGGGGTAGAGGGTATTTGG - Intronic
987127382 5:14827077-14827099 CCCAGGTCGGTGAGGTTCCTTGG - Intronic
989126100 5:38053638-38053660 ATAAGGGAGTTGAGCGTCCTCGG - Intergenic
989635741 5:43530970-43530992 ACCAGACCTTTGAGGGTCCCAGG - Intronic
991286138 5:64978307-64978329 ACAAGTGCTTTCAGGGTCCTAGG - Intronic
994458223 5:100041777-100041799 AGCAGGGAGTTGAGGGTCTTAGG + Intergenic
995674991 5:114653513-114653535 CCCATGGTGTTGAGGGTCGTTGG + Intergenic
998449956 5:142226561-142226583 ACCAGGGCTTTTAGGGCACTTGG + Intergenic
999415266 5:151389563-151389585 ACCAGGGTGTTGAGGGGTCGGGG - Intergenic
1001929472 5:175662531-175662553 ACCAGTGCTTTGAAGGCCCTTGG - Intronic
1002878615 6:1233019-1233041 TGCAGGGCGTTGATGGTTCTAGG + Intergenic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1007111087 6:39313890-39313912 ACCAGAGGGTTGGGGGACCTCGG - Intronic
1007634036 6:43287410-43287432 ACCAGGGTGTTGTTGGTCCTGGG - Exonic
1010020166 6:71150211-71150233 AACAGGGCTTTGAGCGTCATGGG - Intergenic
1019010613 6:168841326-168841348 ACCAGGGAGTCGAGGATCCAGGG + Intergenic
1019594146 7:1850635-1850657 ACCATGGCTTTGGGGGTCCCCGG - Intronic
1020445237 7:8261695-8261717 ACCAGGGAGCTCGGGGTCCTGGG + Intronic
1024567303 7:50692218-50692240 ATCAGGGCCTTGAGCATCCTTGG + Intronic
1025806019 7:64835517-64835539 ACCAGGGTGGAGAGGGTCCTAGG + Intergenic
1026880106 7:73902371-73902393 ACCAGGAAGTTGGGGGTCCCTGG + Intergenic
1030717733 7:112830071-112830093 CCTAGGGAGTTGAGAGTCCTAGG - Intronic
1037414165 8:18630946-18630968 ATCAGGGACTTGAGTGTCCTTGG + Intronic
1038392118 8:27211662-27211684 ACCAGGGACTTGAGCATCCTTGG + Intergenic
1043417931 8:80070674-80070696 ACCTGGGCGTTGGGGATCCCTGG + Intronic
1044870850 8:96618509-96618531 ACCAGGGCCTTGGGGGATCTGGG + Intergenic
1047389450 8:124438300-124438322 ACCAGGGCTGTTAAGGTCCTTGG - Intergenic
1049514367 8:143045619-143045641 ACCAGGCCTGGGAGGGTCCTGGG - Intronic
1054743074 9:68828104-68828126 ACCAGGGCCTTGACTGTCATGGG + Intronic
1056558212 9:87707134-87707156 AGCAGGGCGTGGAGGGGGCTGGG - Exonic
1057261874 9:93589078-93589100 CCCTGGACCTTGAGGGTCCTGGG - Intronic
1061904917 9:133691853-133691875 CCCAGGGCTCTGCGGGTCCTGGG - Intronic
1062270182 9:135704695-135704717 ATCAGGGCCTAGAGGGTCCCAGG - Intronic
1062363537 9:136198476-136198498 CCCAGGGCGGGGAGGGTGCTGGG + Intronic
1062459343 9:136656414-136656436 ATCAGGGCGTGGAGGGTCTTGGG - Intergenic
1062459637 9:136657507-136657529 ACCAGGGCATGGAGGGTCTTCGG - Intergenic
1185906418 X:3937888-3937910 GCCTGGGCTTTGAGGTTCCTTGG - Intergenic
1187328291 X:18312326-18312348 ATCAGGGACTTGAGTGTCCTTGG - Intronic
1189111212 X:38291800-38291822 ACCAGGACGTTGTAGGTCATTGG - Intronic
1191251026 X:58260277-58260299 ACCAGGCCCTTGGGGGTCTTGGG + Intergenic
1199676541 X:150194534-150194556 ACCTGGGAGCTGAGGTTCCTGGG - Intergenic
1201770647 Y:17614347-17614369 ACCAGGGCAGAGAGGGTCGTAGG - Intergenic
1201830908 Y:18291639-18291661 ACCAGGGCAGAGAGGGTCGTAGG + Intergenic