ID: 1006301624

View in Genome Browser
Species Human (GRCh38)
Location 6:33196459-33196481
Sequence GACCAGGGCGTTGAGGGTCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 125}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006301624_1006301630 11 Left 1006301624 6:33196459-33196481 CCAGGACCCTCAACGCCCTGGTC 0: 1
1: 0
2: 1
3: 8
4: 125
Right 1006301630 6:33196493-33196515 CCACAGCAAGCTCTGCCTCCAGG 0: 2
1: 161
2: 13899
3: 98792
4: 125071
1006301624_1006301631 25 Left 1006301624 6:33196459-33196481 CCAGGACCCTCAACGCCCTGGTC 0: 1
1: 0
2: 1
3: 8
4: 125
Right 1006301631 6:33196507-33196529 GCCTCCAGGATCCTGTCCACAGG 0: 1
1: 2
2: 2
3: 46
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006301624 Original CRISPR GACCAGGGCGTTGAGGGTCC TGG (reversed) Exonic
900312663 1:2041690-2041712 GACCAGGGCGTGGACTGGCCTGG - Intergenic
900327054 1:2113545-2113567 GACCAGGGCCTTGAGTGAGCTGG + Intronic
901045331 1:6392863-6392885 GACCACGGGGCTGAGGCTCCGGG + Intronic
902153039 1:14460401-14460423 GAGCAAGGCGGTGAGGATCCAGG + Intergenic
902730480 1:18365599-18365621 GATCTGTGGGTTGAGGGTCCAGG - Exonic
903156914 1:21451666-21451688 GAACAGGGCATAGTGGGTCCTGG + Intronic
904872029 1:33625016-33625038 GACCCGGGCGTTGAGGGTGCGGG - Intronic
912936211 1:114005609-114005631 GAACAGGGAGTTGAGGGTAGGGG - Intergenic
920377871 1:205519016-205519038 GAAGAGGGCGATGAGTGTCCAGG - Intronic
923503531 1:234586089-234586111 GACCAGGTTGCCGAGGGTCCAGG - Intergenic
1063610574 10:7558466-7558488 GACCAGGAGGTTGAGGTTGCAGG - Intergenic
1065636531 10:27741554-27741576 GGCCGGGGCGTGGAGCGTCCGGG - Intronic
1071847471 10:89535510-89535532 GGCCAGGGCGCTGGGGATCCGGG + Exonic
1073100705 10:101005078-101005100 GCCCAGGGGGTTGAGGCTACAGG - Intronic
1073185872 10:101614721-101614743 CAACAGAGCCTTGAGGGTCCTGG - Intronic
1074650803 10:115522577-115522599 CACCAGGGATTTGAGGGGCCAGG - Intronic
1075386671 10:122060204-122060226 CACCATGGCCTTCAGGGTCCAGG - Intronic
1076554422 10:131312176-131312198 GTCCAGGGCGCGGAGGGTACTGG + Intergenic
1077365219 11:2158857-2158879 GACAAGGTCGTTGTGGCTCCAGG - Intronic
1078457509 11:11486734-11486756 TACCTTGGCTTTGAGGGTCCTGG - Intronic
1080663393 11:34315262-34315284 AACCAGGGCACTGAGGTTCCTGG + Intronic
1082784567 11:57309789-57309811 GTCCTGGGCGTCAAGGGTCCTGG + Exonic
1082814837 11:57501004-57501026 GGCCAGGGCCATGAGGGTGCAGG + Exonic
1083261156 11:61523843-61523865 GTCCATGGCTTTGAGGTTCCGGG + Exonic
1085534704 11:77211062-77211084 GACCCCGGCGTTGGGGGTCTTGG + Intronic
1090274127 11:125407889-125407911 AACTCAGGCGTTGAGGGTCCCGG + Intronic
1099204392 12:79711213-79711235 GCCCAGGGCGTTGGGGGTCGGGG - Intergenic
1108431917 13:50361895-50361917 GGGCAGGGTGGTGAGGGTCCAGG - Intronic
1109062285 13:57633646-57633668 CACCAGGGCGATGACGGTGCCGG - Exonic
1113707814 13:112445642-112445664 GACCAGGGCGGGGAGAGCCCGGG - Intergenic
1120925805 14:89796136-89796158 GAACAGGGTGATGAGGGTACTGG - Exonic
1122937849 14:104968138-104968160 GGCCAGGGCGCTGGGGGGCCCGG - Intronic
1123029606 14:105445476-105445498 GGCCAGGGCGATGAGGGTGCTGG - Exonic
1132204649 15:99978009-99978031 GAGCAGGGCGTGGAGGGTTTGGG + Intronic
1132550115 16:550777-550799 GTCCCGGTCGGTGAGGGTCCCGG + Intronic
1132550139 16:550842-550864 GCCCCGGTCGGTGAGGGTCCCGG + Intronic
1132616758 16:844868-844890 TACCAGGACGTGGAGGCTCCGGG - Intergenic
1133180310 16:4049263-4049285 GACCAGAGAGAAGAGGGTCCAGG + Intronic
1134100907 16:11450690-11450712 CACCAGGTCCTTTAGGGTCCAGG + Exonic
1134418105 16:14062013-14062035 GGCCAGGGCTTTGTGGGTCTGGG + Intergenic
1139692594 16:68650706-68650728 GACCTGGGCGTGGAGGGAACTGG - Intronic
1140409011 16:74730159-74730181 GAGCAGGGGGGTGGGGGTCCTGG + Intronic
1141646869 16:85372145-85372167 AGCCAGGGAGTGGAGGGTCCGGG - Intergenic
1141755629 16:85988920-85988942 GTCCAGGGTGGGGAGGGTCCAGG + Intergenic
1141911657 16:87063838-87063860 CACCAAAGCGTTCAGGGTCCAGG - Intergenic
1142207456 16:88790945-88790967 GAGGAGGGGGTTGAGGCTCCTGG - Intergenic
1142672128 17:1492088-1492110 GACCAGGGCATGGAAGCTCCAGG - Intronic
1144806789 17:17972979-17973001 GACCTGGGAGCTGAGGCTCCCGG + Intronic
1145828796 17:27898298-27898320 AACCAGGGAGTTGAGGGTGTTGG - Intergenic
1146378555 17:32311635-32311657 CTCCAGGGCTTTCAGGGTCCAGG + Intronic
1148787813 17:50154024-50154046 GCCCAGGGCGCTGAGGGCTCGGG - Intergenic
1149626487 17:58083822-58083844 GCCCTTGGCGTTGACGGTCCGGG + Intronic
1151559075 17:74861246-74861268 GGCCAGGTTCTTGAGGGTCCGGG + Intronic
1151828802 17:76537954-76537976 GGCCGGGGCGCTGGGGGTCCCGG + Intronic
1152327042 17:79647717-79647739 GACCAGGGCCTTGTGGCTCAGGG + Intergenic
1152631325 17:81411849-81411871 GACCAGGGTGTGGAGGGGCAGGG - Intronic
1161323794 19:3653314-3653336 GACCAGGGCGCTGAAGGTGTCGG + Exonic
1161337407 19:3721889-3721911 GACCATGGCGGTGAGATTCCAGG + Exonic
1161719431 19:5894903-5894925 GGCCAGGGCGTGGAGCGTCTTGG - Intronic
1162184946 19:8897596-8897618 GTCCAGGGCTTTGAGGGTTAAGG + Exonic
1163602488 19:18257448-18257470 GGCCAGGGCACTGAGGGCCCCGG - Exonic
1166003019 19:39889526-39889548 GACCAGGGTGATCACGGTCCAGG - Exonic
1166005806 19:39905778-39905800 GACCAGGGTGATCACGGTCCAGG - Exonic
1166044829 19:40223689-40223711 GAGCACGGGCTTGAGGGTCCTGG + Intronic
1167439447 19:49499964-49499986 GACCAGGGCCTGGAGGACCCAGG - Intergenic
925237647 2:2293462-2293484 GAGCAGGGCGTGGAGGGTGATGG + Intronic
925429451 2:3778486-3778508 GACCAGGGAGCAGAGGGCCCTGG + Intronic
926172041 2:10558645-10558667 GACCAGGGGCTGGAGGGTCTCGG - Intergenic
929946439 2:46375926-46375948 GCCCAGGGCGCTGAGAGGCCTGG - Intronic
931155592 2:59625088-59625110 GGCCACGGATTTGAGGGTCCCGG + Intergenic
932496325 2:72147523-72147545 GACCAGTGCCTTCAGGCTCCCGG + Intronic
935180018 2:100680785-100680807 GACCAGGGGGCTGAGTGTCAGGG + Intergenic
939628760 2:144510360-144510382 GACCAGAGAGGTGAGGGCCCTGG - Intronic
946361651 2:219222577-219222599 GAGCTGGGAGTTGAGGGACCGGG - Intronic
948459864 2:238123874-238123896 GCCCAGTGGGGTGAGGGTCCTGG + Intronic
948486364 2:238283807-238283829 GTCCAGGGTGTTGAGGGGTCAGG - Intronic
948826878 2:240577261-240577283 GACCAGGACGCTGAAGGCCCAGG - Intronic
949035693 2:241814845-241814867 GACCAGGACGTCCAGGGACCTGG - Intronic
1172873490 20:38150065-38150087 CACCAGGAGGTTGAGGGGCCAGG + Intronic
1176048861 20:63106065-63106087 GACCTGGTCCTGGAGGGTCCTGG + Intergenic
1176513085 21:7763330-7763352 GACCTGGACCTTGAGGGTCCAGG + Intronic
1178647198 21:34393854-34393876 GACCTGGACCTTGAGGGTCCAGG + Intronic
1180796880 22:18610273-18610295 GGCCAAGGCGTTGTGGGTGCTGG - Exonic
1181224844 22:21384998-21385020 GGCCAAGGCGTTGTGGGTGCTGG + Exonic
1181253788 22:21549815-21549837 GGCCAAGGCGTTGTGGGTGCTGG - Exonic
1182520916 22:30884139-30884161 GTCCAGGGTGTTGAAGGTCTGGG - Intronic
1183465866 22:37980153-37980175 GAGCAGGGCCTTGAGAGTCAGGG + Intronic
1185281148 22:49970437-49970459 GACCTGGCCCTGGAGGGTCCTGG + Intergenic
950117118 3:10458309-10458331 GACCATGGGGTTGAGGTTACTGG - Intronic
952676040 3:36031123-36031145 GACCAGATGGTTGAGGGCCCTGG - Intergenic
953389720 3:42527215-42527237 AACCAGGGCGTTAGGGGTCAGGG + Intronic
954624337 3:52014421-52014443 GACCAGGCAGTTGGGGCTCCAGG + Intergenic
957536971 3:81518571-81518593 GACCAGGGAGGTGAGGGTACTGG + Intronic
961354857 3:126331116-126331138 GACCAGGGAGTTGAGTGTGAGGG - Intergenic
961819187 3:129566572-129566594 GCCCTGGGAGTTGAGGGTCTGGG + Exonic
963938500 3:151078080-151078102 GACCAGGTGGCTGAGGTTCCAGG + Intergenic
964753592 3:160074768-160074790 GGCCAGGGTGTTGAGTGTCTGGG + Intergenic
968420437 4:479529-479551 GAACAGGACGTTCAGGGACCAGG + Intronic
968645350 4:1737868-1737890 GCCCAGGTCGCTGAGGGTCCAGG + Intronic
969054070 4:4390757-4390779 GGCCAGGGCTGTGAGTGTCCAGG + Intronic
969660605 4:8525357-8525379 GACCAGGGTGATGGGGCTCCAGG - Intergenic
974139309 4:57864343-57864365 GCCCAGGACGTTGAGGATGCAGG - Intergenic
974965821 4:68759828-68759850 GGCCATGGGGTTGAGGGTTCTGG + Intergenic
976468989 4:85405055-85405077 GAGCAGGGAGATGAGGTTCCAGG - Intergenic
982985756 4:162203702-162203724 GCCCTGGGCATTGAGGGTCTTGG + Intergenic
991403758 5:66281495-66281517 GCCCAGGACGTTGAGAGCCCTGG - Intergenic
999415267 5:151389564-151389586 CACCAGGGTGTTGAGGGGTCGGG - Intergenic
1002275744 5:178103491-178103513 GCCGAGGGCCTTGTGGGTCCTGG + Intergenic
1002586717 5:180253202-180253224 GACCAGGCCTCTGAGGGGCCAGG + Intronic
1006301624 6:33196459-33196481 GACCAGGGCGTTGAGGGTCCTGG - Exonic
1007460263 6:42012985-42013007 GACCAGTGGGTAGAGGCTCCAGG - Intronic
1007634037 6:43287411-43287433 AACCAGGGTGTTGTTGGTCCTGG - Exonic
1013155504 6:107489156-107489178 GGCGAGGGCGTTCGGGGTCCGGG + Intergenic
1019010612 6:168841325-168841347 AACCAGGGAGTCGAGGATCCAGG + Intergenic
1020341505 7:7116104-7116126 GAGCAGGGCGTTGAGGCCTCAGG - Intergenic
1032304179 7:130716972-130716994 GCCCAGGAGGTTGAGGGTGCAGG + Intergenic
1032751529 7:134846384-134846406 GACCAGAGAGTGGAGGGGCCAGG + Intronic
1034299228 7:150000799-150000821 GACCAGGGAGTCGAGGGGACTGG - Intergenic
1034806787 7:154095974-154095996 GACCAGGGAGTCGAGGGGACTGG + Intronic
1035234481 7:157487530-157487552 GACCAGGGCGGGCAGGGGCCTGG + Intergenic
1036492445 8:9240630-9240652 GCCCAGGATGTTGAGGGTGCAGG - Intergenic
1042294340 8:67203453-67203475 GGCCAGGGAGTTGGGAGTCCAGG - Intronic
1049212940 8:141395049-141395071 GAGCAGAGGGTGGAGGGTCCTGG + Intronic
1049514368 8:143045620-143045642 GACCAGGCCTGGGAGGGTCCTGG - Intronic
1053453192 9:38210646-38210668 CAGCAGGGCCCTGAGGGTCCTGG - Intergenic
1057035585 9:91809776-91809798 GACCAGGCTGGTGAGGCTCCCGG + Intronic
1060498118 9:124132817-124132839 GACAAGGGTGTTGAGGGGCCTGG + Intergenic
1060732916 9:126049419-126049441 GACCAGGGCCTACAGGGTCTTGG + Intergenic
1061510977 9:131060881-131060903 GGCCTGGGGATTGAGGGTCCAGG - Intronic
1062016242 9:134292696-134292718 GCCCAGAGGGTTGAGGGGCCTGG + Intergenic
1062109781 9:134775812-134775834 GACCAGGGAGGTGAGGGGCAGGG - Intronic
1062459344 9:136656415-136656437 GATCAGGGCGTGGAGGGTCTTGG - Intergenic
1185937644 X:4276738-4276760 GACCAGGGTGTTGAGGGGTTGGG - Intergenic
1195939864 X:110159215-110159237 CACCAGGGAGTTGAGAGTGCTGG + Intronic
1199676542 X:150194535-150194557 GACCTGGGAGCTGAGGTTCCTGG - Intergenic