ID: 1006301625

View in Genome Browser
Species Human (GRCh38)
Location 6:33196465-33196487
Sequence AAGAGTGACCAGGGCGTTGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 119}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006301625_1006301630 5 Left 1006301625 6:33196465-33196487 CCCTCAACGCCCTGGTCACTCTT 0: 1
1: 0
2: 2
3: 12
4: 119
Right 1006301630 6:33196493-33196515 CCACAGCAAGCTCTGCCTCCAGG 0: 2
1: 161
2: 13899
3: 98792
4: 125071
1006301625_1006301631 19 Left 1006301625 6:33196465-33196487 CCCTCAACGCCCTGGTCACTCTT 0: 1
1: 0
2: 2
3: 12
4: 119
Right 1006301631 6:33196507-33196529 GCCTCCAGGATCCTGTCCACAGG 0: 1
1: 2
2: 2
3: 46
4: 205
1006301625_1006301635 30 Left 1006301625 6:33196465-33196487 CCCTCAACGCCCTGGTCACTCTT 0: 1
1: 0
2: 2
3: 12
4: 119
Right 1006301635 6:33196518-33196540 CCTGTCCACAGGCATCTCCTCGG 0: 1
1: 0
2: 3
3: 28
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006301625 Original CRISPR AAGAGTGACCAGGGCGTTGA GGG (reversed) Exonic
901653834 1:10757938-10757960 CAGAGTGGCCAGGACGTGGATGG - Intronic
902976868 1:20094916-20094938 AAGGGTGACCAAGTAGTTGATGG + Intergenic
906481761 1:46203813-46203835 AAGAGTGAGTGGGGTGTTGATGG + Intronic
906552663 1:46678594-46678616 AAGACTGGCCAGGACGTGGATGG - Exonic
907268049 1:53274763-53274785 AAGAGTGGCAAGCGCGTGGACGG - Intronic
907301232 1:53487521-53487543 AAGAGTGACCTGGCAGTGGAGGG + Intergenic
907372847 1:54014261-54014283 AATGGTGACCAAGGCGATGAGGG + Exonic
907944303 1:59119961-59119983 GACAGTGACCAGGGAGTTTATGG - Intergenic
909674278 1:78221812-78221834 AAGAGTGGCCAATGCTTTGAAGG + Intergenic
911267068 1:95754588-95754610 AAGGGCAAGCAGGGCGTTGAGGG - Intergenic
912725781 1:112057846-112057868 ATGAGTATCCAGGGCTTTGAAGG - Intergenic
919118635 1:193312634-193312656 AAGAGTTACGAGGGCTTTGTGGG + Intergenic
919833900 1:201560659-201560681 AACAGTGACTTGGGCATTGAAGG - Intergenic
920569018 1:207002243-207002265 AAGAGTTCTCAGGGCTTTGATGG + Intergenic
921173125 1:212566564-212566586 AACTGTGACCAGGGCATAGAGGG + Intronic
1069722779 10:70560280-70560302 AAGAGTGAGCAGGGAGTGGTGGG + Intronic
1071986516 10:91056674-91056696 AAGTGTGACCAGGGTGATAATGG - Intergenic
1074383335 10:112997616-112997638 AAGAGTGACCAGGGACCTGAGGG + Intronic
1077444645 11:2585316-2585338 GACAGTGACCAGGGCCTTGCAGG - Intronic
1083652672 11:64212194-64212216 AAGAGTGAACAGGGCACAGAGGG - Intronic
1085799405 11:79575050-79575072 AAGAGTGACCAGGATGATGAGGG + Intergenic
1086063195 11:82721102-82721124 AAGAGGGACCAGGAAGTTCAAGG + Intergenic
1086862128 11:91936990-91937012 AAGAATGACTAGGATGTTGAAGG - Intergenic
1088378683 11:109169684-109169706 GAAAGTGACCAGGGCTTTGGGGG - Intergenic
1090117919 11:123994499-123994521 AAAGGTGACCAGCTCGTTGATGG + Exonic
1090435498 11:126683622-126683644 ATGATTGGCCAGGGCATTGACGG + Intronic
1095117498 12:38372436-38372458 AAGAGTGACCAAGGCTATAAGGG - Intergenic
1098455415 12:70667463-70667485 ATGGGTAACCAGGGGGTTGATGG - Intronic
1100396328 12:94189215-94189237 GAGAGTGGCCAGGGAGCTGAGGG + Intronic
1102574142 12:113845215-113845237 CAGAGTCACCAGGGCAGTGAAGG - Intronic
1103323558 12:120105402-120105424 AAGAATGACCAGGGGGTAGGAGG + Intronic
1104366969 12:128186883-128186905 GAGACTGACCAGGGCCCTGAGGG + Intergenic
1111253556 13:85638396-85638418 AAGGGTGAGCAGGGTGGTGAGGG + Intergenic
1113355479 13:109576071-109576093 AGGAGGGACCAGGGCAGTGATGG - Intergenic
1113941974 13:114023154-114023176 GAGGGTGACCAGGGATTTGATGG + Intronic
1119722333 14:76899651-76899673 AAGAGTGAGGAGGGCGGTGAAGG + Intergenic
1132645962 16:999410-999432 GACAGTGACCATGGCCTTGAAGG - Intergenic
1134418103 16:14062007-14062029 GAGAGTGGCCAGGGCTTTGTGGG + Intergenic
1135637431 16:24090519-24090541 AAGAGGGGCAAGGGAGTTGAGGG + Intronic
1137569619 16:49557143-49557165 GAGAGTGACCAGGGCGTGCAGGG + Intronic
1141743817 16:85912810-85912832 CTGCGTGTCCAGGGCGTTGAGGG + Intronic
1144670476 17:17129986-17130008 AAGTGTGACCAGGGAGGAGAGGG + Intronic
1145828797 17:27898304-27898326 AAGAGGAACCAGGGAGTTGAGGG - Intergenic
1145924118 17:28633185-28633207 GTGAGTGACCAGGGCACTGAGGG - Intronic
1146955225 17:36933355-36933377 AAGAGTGACAAGGCCGTGAAAGG - Intergenic
1148071291 17:44910393-44910415 AAGAGGGACCAGGGCCTAGCAGG + Exonic
1152631328 17:81411855-81411877 AAGAGTGACCAGGGTGTGGAGGG - Intronic
1155438166 18:25834254-25834276 CAGAGTTCCCAGGGCGTTCAGGG - Intergenic
1156887437 18:42151767-42151789 AAGTGTGCCCAGGGTGTTGCTGG - Intergenic
1157220269 18:45824593-45824615 GAGAGTGACCAAGAAGTTGAAGG + Intergenic
1161021389 19:2013289-2013311 AAGAGGGACCGGGGAGTGGAGGG + Intronic
1162385320 19:10357501-10357523 CAGAGTGACCAGGGCAGCGATGG - Intronic
1162860991 19:13505836-13505858 GAGAGAGACCCGGGGGTTGATGG - Intronic
1165700380 19:37932847-37932869 AAGAGTGGGCCGGGTGTTGACGG + Intronic
1166231502 19:41427698-41427720 TAGAGTGACCAGGGCGAGGCAGG + Intronic
925296981 2:2783759-2783781 GTGAGTGACCAGGGTTTTGAGGG + Intergenic
927026242 2:19071963-19071985 AAGATTGACCCTGGCATTGAGGG - Intergenic
930136397 2:47906673-47906695 GAGAGGAAACAGGGCGTTGAAGG - Intergenic
931667276 2:64618335-64618357 AGGAGAGAGCAGGGCCTTGAAGG + Intergenic
932779543 2:74551392-74551414 AAGAGTCACAAGGACTTTGATGG - Intronic
933502572 2:83133776-83133798 CAGAGTGACCATGGTGATGATGG + Intergenic
935172083 2:100618034-100618056 AGGAGAGACCAGGCCATTGAAGG + Intergenic
936526549 2:113245459-113245481 ACCAGTGACCAGGGGGGTGAGGG - Intronic
936631006 2:114202630-114202652 AAAAGTGAACAGGGCCTTAAGGG - Intergenic
936725699 2:115312554-115312576 AAGAGTGTACATGGCCTTGATGG - Intronic
938072308 2:128315182-128315204 AAGAGTGAGCAGAGCATTGGCGG - Intronic
938163589 2:129007893-129007915 ATGAGTGGCCAGGGCATTGAGGG + Intergenic
944028869 2:195207846-195207868 AAGAGTTGCCAGGGGTTTGAAGG - Intergenic
946305289 2:218853461-218853483 GAGTGTGAACAGGGCGTGGAGGG + Intergenic
946337201 2:219045827-219045849 AAGAGCGTCCAGGGCAATGAAGG + Intergenic
947872095 2:233444881-233444903 CAGAGTGACCAGGGCCATGAAGG - Intronic
1168758824 20:334639-334661 AAGAGTGAGAAGGACCTTGAAGG + Intergenic
1169909518 20:10636220-10636242 AAGAGAGCCCAGGGCGTTCCTGG + Intronic
1172100180 20:32480564-32480586 AAGAATGTCCAGGGCCTGGAAGG - Intronic
1173419304 20:42886855-42886877 AGAAGTGAACAGGGCTTTGAAGG + Intronic
1175865695 20:62175203-62175225 AACAGTGAGCAGGGCTTTGAAGG + Intronic
1175908532 20:62393555-62393577 GTGTGTGACCAGGGCGTTGGTGG + Exonic
1178289754 21:31357033-31357055 AAGATGGGCCAGGGAGTTGAGGG - Intronic
1182995599 22:34809163-34809185 AAGAATGACAAGGAGGTTGAAGG + Intergenic
1184908580 22:47509686-47509708 AAGAGTCACCAGGGCGCACAAGG - Intergenic
1185000544 22:48242788-48242810 GAGAGTGCCCAGGGGATTGAAGG + Intergenic
952658199 3:35813169-35813191 AAGAGTAATCAGGGCCCTGATGG - Intergenic
953744786 3:45566082-45566104 AAGAGGGGCCAGGTGGTTGAGGG + Intronic
954132355 3:48567135-48567157 AAGGGTGACCAGGGCGAGAAAGG - Exonic
955587658 3:60499083-60499105 ATGAGTGACCAAGGAGTTGAAGG + Intronic
960985583 3:123278472-123278494 AAGAGAGAAGAGGGGGTTGAAGG + Intergenic
961797849 3:129422575-129422597 AAGAGTGCCCAGGGTGTGGATGG - Intronic
964053935 3:152428728-152428750 AGGAGTGGCCAGGGCATTCACGG + Intronic
964645127 3:158950870-158950892 ATGAGGGAGCAGGGCGTTCAAGG - Intergenic
966708665 3:182947817-182947839 AAAAATGACCAGGGCCTTTAGGG + Intronic
967625731 3:191681625-191681647 GAGAGTGAGCAAGGCATTGAAGG - Intergenic
968882969 4:3310558-3310580 AAGAGTGGCCAGGGACTTGGAGG + Intronic
974074115 4:57153336-57153358 TAGAGTGTCCAGGGCCATGAAGG + Intergenic
976124478 4:81818941-81818963 AAGAGTGAGAAGGGAGTTGTTGG + Intronic
978465865 4:109008267-109008289 AAGAGGGACAAGGAAGTTGATGG - Intronic
981045560 4:140261858-140261880 ATGTGTGACCAGGGCTTGGAAGG + Intronic
982771847 4:159403645-159403667 CAGAGAGGCCAGGGTGTTGATGG - Intergenic
986233242 5:5885745-5885767 GACAGTGACCAGGGCCTTGGTGG + Intergenic
986273205 5:6251981-6252003 AAGTGTGACCAGGGCACTGTGGG - Intergenic
986812249 5:11372903-11372925 AGGAGAGACCACGGCATTGATGG - Intronic
987825867 5:23029690-23029712 AAGAGGGGCAAGGGAGTTGAGGG - Intergenic
990924838 5:61008830-61008852 AATATTGACTAGGGCCTTGAAGG + Intronic
994458222 5:100041770-100041792 CAGAGAGAGCAGGGAGTTGAGGG + Intergenic
997894225 5:137701710-137701732 AAGAGTGACCAAGTCCTTGATGG - Intronic
998266734 5:140672618-140672640 AAGTGTGAGCTGAGCGTTGACGG - Exonic
999545273 5:152622500-152622522 AAGGGTGACCAGGATGATGATGG - Intergenic
999595726 5:153202064-153202086 AAGAGTGATAAGGGGGTGGATGG - Intergenic
1002468961 5:179423252-179423274 CAGAGTGGCCAGGTCGGTGAAGG + Intergenic
1002804311 6:557746-557768 AAGAGGGACCAGCCCTTTGAAGG + Intronic
1006301625 6:33196465-33196487 AAGAGTGACCAGGGCGTTGAGGG - Exonic
1008186171 6:48393795-48393817 AATAGTTGCCAGGGCTTTGAAGG + Intergenic
1014265072 6:119268348-119268370 ATGTGTGACCAGGGCGTTACAGG - Intronic
1015082209 6:129240550-129240572 AGGTGTGACCAGGATGTTGATGG - Intronic
1017522218 6:155212758-155212780 AAGAGTGAGCAGAGTGGTGAGGG + Intronic
1017723210 6:157258762-157258784 GAGAGTTTCCAGGGGGTTGAGGG + Intergenic
1020241132 7:6396051-6396073 AGGAGTAACAAAGGCGTTGAAGG + Intronic
1021839691 7:24712636-24712658 CAGAGTGACCAGCGGGTGGAGGG + Intronic
1022539653 7:31123905-31123927 AAGAGTGCCCAGCTCATTGAAGG - Intergenic
1024048611 7:45602038-45602060 AAGAGTGATCAGGGCTTTGAGGG + Intronic
1024764373 7:52639663-52639685 AAGAATGACCAAGGCATTGCAGG - Intergenic
1028640908 7:93040598-93040620 AAGGGTGAGCAGAGCGGTGAGGG - Intergenic
1034948477 7:155280055-155280077 ATGAGTGACCAGGTCGTGGAGGG - Intergenic
1035065771 7:156104219-156104241 AAGCTTGGCCAGGGCTTTGAGGG + Intergenic
1044021617 8:87112148-87112170 AAGAGTGAGCAGGCAGATGATGG - Intronic
1046619102 8:116509064-116509086 AAGAGGGTCAAGGGAGTTGAGGG + Intergenic
1051599125 9:18854475-18854497 AAGAGGAACCAGGTAGTTGAGGG + Intronic
1061487973 9:130929873-130929895 CACAGTGACCAGGGCGCTGTTGG + Exonic
1189383575 X:40518919-40518941 AAGCGTGGCCAGGGCTTTCAGGG - Intergenic
1195464398 X:105164304-105164326 GAGAGTGACCAATGTGTTGAGGG + Intronic
1196523811 X:116707539-116707561 AAGGGAGACCAGTGCCTTGAAGG - Intergenic
1198875162 X:141216851-141216873 AAGGGTGATCAGAGTGTTGATGG - Intergenic
1199850391 X:151721741-151721763 AAGAGGGCCTAGGGCCTTGAGGG - Intronic
1199950022 X:152699633-152699655 CAGGGTGACCAGAGAGTTGAGGG + Intronic
1199959652 X:152768828-152768850 CAGGGTGACCAGAGAGTTGAGGG - Intronic