ID: 1006301626

View in Genome Browser
Species Human (GRCh38)
Location 6:33196466-33196488
Sequence GAAGAGTGACCAGGGCGTTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 145}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006301626_1006301631 18 Left 1006301626 6:33196466-33196488 CCTCAACGCCCTGGTCACTCTTC 0: 1
1: 0
2: 1
3: 9
4: 145
Right 1006301631 6:33196507-33196529 GCCTCCAGGATCCTGTCCACAGG 0: 1
1: 2
2: 2
3: 46
4: 205
1006301626_1006301636 30 Left 1006301626 6:33196466-33196488 CCTCAACGCCCTGGTCACTCTTC 0: 1
1: 0
2: 1
3: 9
4: 145
Right 1006301636 6:33196519-33196541 CTGTCCACAGGCATCTCCTCGGG 0: 1
1: 0
2: 2
3: 25
4: 266
1006301626_1006301635 29 Left 1006301626 6:33196466-33196488 CCTCAACGCCCTGGTCACTCTTC 0: 1
1: 0
2: 1
3: 9
4: 145
Right 1006301635 6:33196518-33196540 CCTGTCCACAGGCATCTCCTCGG 0: 1
1: 0
2: 3
3: 28
4: 311
1006301626_1006301630 4 Left 1006301626 6:33196466-33196488 CCTCAACGCCCTGGTCACTCTTC 0: 1
1: 0
2: 1
3: 9
4: 145
Right 1006301630 6:33196493-33196515 CCACAGCAAGCTCTGCCTCCAGG 0: 2
1: 161
2: 13899
3: 98792
4: 125071

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006301626 Original CRISPR GAAGAGTGACCAGGGCGTTG AGG (reversed) Exonic
900269234 1:1778630-1778652 GAGCAGTGACCAGGGAGTGGAGG + Intronic
900311060 1:2033318-2033340 CAAGAGGGGCCAGGACGTTGGGG + Intergenic
900751217 1:4399019-4399041 GAAGACTGAACAGAGCATTGTGG - Intergenic
900991577 1:6100558-6100580 GAAGAGGGACCAGCGCGAGGTGG + Exonic
903046016 1:20564710-20564732 GAAGAATGAGCTGGGCGTGGTGG - Intergenic
904009632 1:27382432-27382454 GGAGAGGGGCCAGGGCCTTGGGG + Intronic
904045439 1:27605577-27605599 AGATAGTGACCAGGGAGTTGCGG - Intergenic
904432832 1:30476194-30476216 GACAAGTGACCAGAGCGCTGTGG - Intergenic
905541669 1:38764957-38764979 GAGGAGAGACCAGGGGGTGGGGG + Intergenic
906524022 1:46484054-46484076 GAAGAGTGAACAAGGAGGTGGGG + Intergenic
907372846 1:54014260-54014282 GAATGGTGACCAAGGCGATGAGG + Exonic
914675301 1:149903598-149903620 GGAGAGTGACCACAGGGTTGGGG + Exonic
917039857 1:170792813-170792835 AAAGAGTGACAAGTGCTTTGGGG + Intergenic
918369258 1:183842216-183842238 GAAGAGTGATCATGGTGTGGAGG + Intronic
919118634 1:193312633-193312655 AAAGAGTTACGAGGGCTTTGTGG + Intergenic
921173124 1:212566563-212566585 GAACTGTGACCAGGGCATAGAGG + Intronic
921489557 1:215757994-215758016 GAAGAGTAAGCCGGGCGTGGTGG + Intronic
922125408 1:222716249-222716271 CAAAAATGACCAGGGCGTGGTGG - Intronic
1066367950 10:34794929-34794951 GAGGAGTGTCCAAGGCCTTGTGG - Intronic
1069722778 10:70560279-70560301 CAAGAGTGAGCAGGGAGTGGTGG + Intronic
1072714975 10:97744925-97744947 GAAGAGAGGCCAGGGAGGTGGGG + Intronic
1072888278 10:99299225-99299247 GAATAGGGACCAGGGCGTGTTGG - Intergenic
1073405356 10:103292668-103292690 CAAGAATGACCTGGGCGTGGTGG + Intergenic
1074383334 10:112997615-112997637 GAAGAGTGACCAGGGACCTGAGG + Intronic
1075796717 10:125125693-125125715 GCAGAGTGACCAGAGTGATGGGG + Intronic
1077511775 11:2969141-2969163 GAAAAGTTAGCTGGGCGTTGTGG - Intronic
1083652673 11:64212195-64212217 GAAGAGTGAACAGGGCACAGAGG - Intronic
1084886956 11:72216945-72216967 GAAGGGTGACAAGGGCAGTGGGG + Intronic
1085799404 11:79575049-79575071 GAAGAGTGACCAGGATGATGAGG + Intergenic
1088378684 11:109169685-109169707 AGAAAGTGACCAGGGCTTTGGGG - Intergenic
1092900157 12:13051698-13051720 GGAGAATGACCAGGATGTTGAGG + Intronic
1094317735 12:29150404-29150426 GAAAAGTGACCAGGGAATTCAGG + Intronic
1098742000 12:74184706-74184728 GAAGAGTGGCCATGGCTTTGGGG - Intergenic
1098787352 12:74776495-74776517 GAAAATTTACCAGGGCGTTGTGG + Intergenic
1099027530 12:77484262-77484284 GAAGTGTTAGCAGGGCGTGGTGG + Intergenic
1104024214 12:125014281-125014303 GACCAGGGACCAGGGCGGTGGGG - Intronic
1104218210 12:126755697-126755719 GAAGAGTAAGAAGGGTGTTGAGG - Intergenic
1104366968 12:128186882-128186904 GGAGACTGACCAGGGCCCTGAGG + Intergenic
1105574226 13:21635160-21635182 GAAGACTGAGCATGGCGTGGTGG - Intergenic
1106304596 13:28498388-28498410 GAAGAGTGACCAAAGGGATGTGG - Intergenic
1109761562 13:66836686-66836708 GAAGAGTTTCTAGGGCTTTGTGG + Intronic
1118490044 14:66250056-66250078 GAAGAGTGACCAGTGCTTCCAGG + Intergenic
1118983236 14:70732719-70732741 GGACATTGACCAGGGGGTTGTGG + Exonic
1124230007 15:27936312-27936334 GCCGAGTGACCAGGGGGTTAAGG + Intronic
1126375005 15:47988770-47988792 GAAGATTGACCTGGGGGTGGTGG + Intergenic
1126683998 15:51231484-51231506 GAAGAGGGTCAAGGGAGTTGAGG - Intronic
1128576544 15:68779922-68779944 GAAGAGTGTACTGGGGGTTGCGG - Exonic
1132408027 15:101556413-101556435 GCAGAGCCACCAGGGCCTTGGGG + Intergenic
1132543820 16:524017-524039 GAGGAGTGACATGGGCGGTGTGG + Intergenic
1132946546 16:2534730-2534752 GACATGTGACCAGGGCCTTGTGG + Intergenic
1132969164 16:2676896-2676918 GACATGTGACCAGGGCCTTGTGG - Intergenic
1133368721 16:5231728-5231750 AAAAAGAGACCAGGTCGTTGAGG - Intergenic
1134164553 16:11919715-11919737 GAAAAATTACCAGGGGGTTGGGG - Intergenic
1134418102 16:14062006-14062028 AGAGAGTGGCCAGGGCTTTGTGG + Intergenic
1136131363 16:28223892-28223914 GGAGAGTGAGCTGGGCGTGGTGG - Intergenic
1137569618 16:49557142-49557164 AGAGAGTGACCAGGGCGTGCAGG + Intronic
1139794513 16:69471280-69471302 GAAGAGTGACTAGAGAGTGGAGG - Intergenic
1140937928 16:79692056-79692078 GAAGAGTGGCTAGGTCTTTGGGG + Intergenic
1144273317 17:13640948-13640970 GAAGAGGGACCAGATGGTTGAGG - Intergenic
1144670475 17:17129985-17130007 GAAGTGTGACCAGGGAGGAGAGG + Intronic
1145828798 17:27898305-27898327 CAAGAGGAACCAGGGAGTTGAGG - Intergenic
1148392698 17:47284317-47284339 GAAAAGGGACCAGGGCTTTCTGG + Intronic
1151301370 17:73229713-73229735 AAAGAGTTAGCAGGGCGTGGTGG + Intronic
1152631329 17:81411856-81411878 GAAGAGTGACCAGGGTGTGGAGG - Intronic
1152914258 17:83024800-83024822 GAGGAGTGACCAGAACGCTGTGG + Intronic
1153978381 18:10289065-10289087 GAAGCGTGAGCATGGAGTTGTGG - Intergenic
1155438167 18:25834255-25834277 GCAGAGTTCCCAGGGCGTTCAGG - Intergenic
1156361323 18:36386902-36386924 GACGACTGACCTGGGCCTTGTGG + Intronic
1160262076 18:77303485-77303507 GAAGAGAGACCAGGACGTGGTGG + Intergenic
1161317580 19:3625041-3625063 AAAGAGTTACCTGGGCGTGGTGG - Intronic
1162398602 19:10431796-10431818 GAAGAGGGGCCAGGGCCTTTGGG + Intronic
1162967830 19:14164349-14164371 GAAGAGAGACAAGGGCGTATGGG + Intronic
1165251204 19:34536996-34537018 GAAGAGTGAACAGAGCTTAGTGG - Intergenic
1166462101 19:42996614-42996636 GAAGACTGACCAGGGAGTGTTGG - Intronic
1166501888 19:43347741-43347763 GAAGACTGACCAGGGAGTGTTGG - Intergenic
1166508228 19:43385710-43385732 GAAGACTGACCAGGGAGTGTTGG + Intergenic
1167108858 19:47447303-47447325 GAAGAGTACCCAGGGAGATGTGG - Intronic
1167172593 19:47843169-47843191 GAAGAGTGACAAGGCAGGTGGGG + Exonic
926049628 2:9736366-9736388 GAAGAGGGACCAGATGGTTGAGG - Intergenic
929992540 2:46802181-46802203 GAAGAGTGACCAGTGAGCCGTGG - Intergenic
931812545 2:65868628-65868650 GAAGAGTGGCCAGAGAGTGGAGG + Intergenic
934937043 2:98473048-98473070 GAAGAGTGAGGAGGGCAGTGTGG + Intronic
934968155 2:98741001-98741023 GCAGAGGGGCCAGGGAGTTGAGG + Intergenic
935347391 2:102121248-102121270 GGAGAGAAACCAGGGGGTTGGGG - Intronic
935736673 2:106111921-106111943 GAGGAGTGACCGGGGAGCTGGGG + Intronic
937936092 2:127246764-127246786 AAAAAGTTAGCAGGGCGTTGTGG - Intergenic
938163588 2:129007892-129007914 GATGAGTGGCCAGGGCATTGAGG + Intergenic
941795874 2:169597784-169597806 GAAGAGAGAGCTGGGCGTGGTGG - Intronic
941916536 2:170817235-170817257 GAAGAGTGACGAGGGAGGCGGGG - Intronic
946305288 2:218853460-218853482 GGAGTGTGAACAGGGCGTGGAGG + Intergenic
947907794 2:233778195-233778217 GAAGAGTGCACAGGGCTCTGGGG - Intronic
1174775061 20:53335664-53335686 GAAGGGTGAGAAGGGTGTTGAGG + Intronic
1179614192 21:42571104-42571126 GAACAATGACCAAGGCGTGGTGG - Intronic
1180583526 22:16864707-16864729 GAAGAATTAGCTGGGCGTTGTGG + Intergenic
1181796147 22:25312425-25312447 GGAGAGTGGCCAGGCCCTTGAGG + Intergenic
1181836693 22:25616035-25616057 GGAGAGTGGCCAGGCCCTTGAGG + Intronic
1182422047 22:30253446-30253468 TCAGGGTGGCCAGGGCGTTGTGG - Intergenic
1183042345 22:35191735-35191757 GATCAGTGCCCAGGGCATTGGGG - Intergenic
1183291265 22:37003337-37003359 GAAGAGAGTCCAGTGAGTTGGGG - Intronic
1184896022 22:47407093-47407115 TAACAGTGGCCAGGGCGTGGCGG - Intergenic
953744785 3:45566081-45566103 GAAGAGGGGCCAGGTGGTTGAGG + Intronic
954181038 3:48881534-48881556 GGAGTGTTACCAGGGCCTTGGGG - Intronic
954872838 3:53780786-53780808 GAGGAGTGACCAGGAGGTGGGGG + Intronic
964740005 3:159955192-159955214 GAAGAGTGACCAGAGGTGTGAGG + Intergenic
969297759 4:6279734-6279756 GAAGAGTGACCAGGCCCTCCTGG - Intronic
970848645 4:20574632-20574654 CAAAAATGAGCAGGGCGTTGCGG + Intronic
976629401 4:87220772-87220794 GAAGGCGGACCAGGGCGTGGCGG + Intronic
977581856 4:98733956-98733978 GAAGGGAGAACAGGGCCTTGTGG + Intergenic
980587827 4:134840788-134840810 GAAGAGTGACCTGGGACTTTTGG + Intergenic
981853355 4:149257585-149257607 GAACAGTGTCTAGGGCTTTGTGG - Intergenic
982004658 4:151052042-151052064 GAAGAGTGGGCCGGGCGTGGTGG + Intergenic
985702706 5:1383244-1383266 GGAGGGTGAGCAGGGGGTTGGGG - Intergenic
986273206 5:6251982-6252004 AAAGTGTGACCAGGGCACTGTGG - Intergenic
989402287 5:41021722-41021744 GAAGAATGAGCTGGGCGTGGTGG + Intronic
997262541 5:132475712-132475734 CTAGAGTGACCTGGGCGCTGAGG + Intronic
999263433 5:150251616-150251638 GAAGACTGACCAGGGCCAGGTGG - Intronic
1006301626 6:33196466-33196488 GAAGAGTGACCAGGGCGTTGAGG - Exonic
1006383779 6:33717399-33717421 AAACAGTGACCAGTGCTTTGAGG - Intergenic
1006595851 6:35192186-35192208 GAAGGGTGAGCAGGGCCATGTGG - Intergenic
1006630060 6:35424523-35424545 GAAGGGTAACCTGGTCGTTGAGG - Exonic
1007783461 6:44267121-44267143 GAAGTGAGAACAGGGTGTTGTGG + Intergenic
1015160134 6:130143659-130143681 GAAGATAGACCAGGGCCTTTTGG - Intergenic
1017723209 6:157258761-157258783 GGAGAGTTTCCAGGGGGTTGAGG + Intergenic
1018990685 6:168671429-168671451 GAGGAGGGACCAGGGCGCAGGGG - Intronic
1018990704 6:168671482-168671504 GAGGAGGGACCAGGGCGCAGGGG - Intronic
1018990723 6:168671535-168671557 GAAGAGGGACCAGGGCGCAGAGG - Intronic
1018990761 6:168671681-168671703 GCAGAGGGACCAGGGCGGAGGGG - Intronic
1020178259 7:5899612-5899634 GAAAAGTGAGCCGGGCGTGGTGG + Intronic
1020304670 7:6825389-6825411 GAAAAGTGAGCCGGGCGTGGTGG - Intronic
1023551059 7:41370056-41370078 GAGGAGGGACCAGGGGGTGGGGG + Intergenic
1023556993 7:41434378-41434400 GAAGGGTGTCCAGTGGGTTGGGG - Intergenic
1023904987 7:44515854-44515876 GCAGAGTGATCAGGAGGTTGAGG + Exonic
1024048610 7:45602037-45602059 CAAGAGTGATCAGGGCTTTGAGG + Intronic
1029837095 7:103323863-103323885 GAAGAGATAGCAGGGCGGTGTGG - Intronic
1034948478 7:155280056-155280078 TATGAGTGACCAGGTCGTGGAGG - Intergenic
1035065770 7:156104218-156104240 GAAGCTTGGCCAGGGCTTTGAGG + Intergenic
1044346662 8:91112215-91112237 GCAGAGTGATCACGGCTTTGAGG - Intronic
1044870847 8:96618501-96618523 GAAGGGGAACCAGGGCCTTGGGG + Intergenic
1047703508 8:127473670-127473692 CAAGAGTCACCTGGGGGTTGAGG - Intergenic
1051599124 9:18854474-18854496 GAAGAGGAACCAGGTAGTTGAGG + Intronic
1051796382 9:20876186-20876208 GAAGAGTGAACAAGTCTTTGAGG - Intronic
1052225832 9:26084795-26084817 GAAGAGTGATCTGAGAGTTGGGG + Intergenic
1054961566 9:70975853-70975875 GATGAGGGACCTGGGCTTTGAGG - Intronic
1055025631 9:71717017-71717039 TAAAAGTTAGCAGGGCGTTGTGG + Intronic
1060123237 9:121016344-121016366 GAAGAGTGATCTGGGCTGTGGGG - Exonic
1061099900 9:128484646-128484668 GAAGAGAGACAAGGAGGTTGTGG - Intronic
1061130938 9:128707322-128707344 GCAGAGTGACCCGAGAGTTGCGG + Exonic
1189383576 X:40518920-40518942 GAAGCGTGGCCAGGGCTTTCAGG - Intergenic
1191957931 X:66666576-66666598 GAAACGTGACCAGGTAGTTGTGG - Intergenic
1192452108 X:71251139-71251161 GAAGTGTGACCTGGGAGTTCTGG - Intronic
1196431891 X:115635835-115635857 GAAAAGTTACCTGGGCGTGGTGG + Intronic
1197761605 X:130032000-130032022 GAAGAGGGCCCAGAGTGTTGTGG + Intronic
1200857039 Y:7950154-7950176 GGAGAGTGTCCAGGCAGTTGAGG + Intergenic
1201865500 Y:18648965-18648987 GAAAAGTGACCTGGGCATTGTGG - Intergenic
1202368678 Y:24183189-24183211 GAGGAGTGCCCAGGGCTTAGTGG - Intergenic
1202502107 Y:25486928-25486950 GAGGAGTGCCCAGGGCTTAGTGG + Intergenic