ID: 1006301627

View in Genome Browser
Species Human (GRCh38)
Location 6:33196474-33196496
Sequence GTGGAACAGAAGAGTGACCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 286}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006301627_1006301636 22 Left 1006301627 6:33196474-33196496 CCCTGGTCACTCTTCTGTTCCAC 0: 1
1: 0
2: 1
3: 12
4: 286
Right 1006301636 6:33196519-33196541 CTGTCCACAGGCATCTCCTCGGG 0: 1
1: 0
2: 2
3: 25
4: 266
1006301627_1006301637 23 Left 1006301627 6:33196474-33196496 CCCTGGTCACTCTTCTGTTCCAC 0: 1
1: 0
2: 1
3: 12
4: 286
Right 1006301637 6:33196520-33196542 TGTCCACAGGCATCTCCTCGGGG 0: 1
1: 0
2: 1
3: 13
4: 131
1006301627_1006301635 21 Left 1006301627 6:33196474-33196496 CCCTGGTCACTCTTCTGTTCCAC 0: 1
1: 0
2: 1
3: 12
4: 286
Right 1006301635 6:33196518-33196540 CCTGTCCACAGGCATCTCCTCGG 0: 1
1: 0
2: 3
3: 28
4: 311
1006301627_1006301631 10 Left 1006301627 6:33196474-33196496 CCCTGGTCACTCTTCTGTTCCAC 0: 1
1: 0
2: 1
3: 12
4: 286
Right 1006301631 6:33196507-33196529 GCCTCCAGGATCCTGTCCACAGG 0: 1
1: 2
2: 2
3: 46
4: 205
1006301627_1006301638 24 Left 1006301627 6:33196474-33196496 CCCTGGTCACTCTTCTGTTCCAC 0: 1
1: 0
2: 1
3: 12
4: 286
Right 1006301638 6:33196521-33196543 GTCCACAGGCATCTCCTCGGGGG 0: 1
1: 0
2: 1
3: 16
4: 129
1006301627_1006301630 -4 Left 1006301627 6:33196474-33196496 CCCTGGTCACTCTTCTGTTCCAC 0: 1
1: 0
2: 1
3: 12
4: 286
Right 1006301630 6:33196493-33196515 CCACAGCAAGCTCTGCCTCCAGG 0: 2
1: 161
2: 13899
3: 98792
4: 125071

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006301627 Original CRISPR GTGGAACAGAAGAGTGACCA GGG (reversed) Exonic
900132783 1:1095704-1095726 GTTGGACAGAAGAGTGAGAATGG + Intronic
900988653 1:6087442-6087464 GTGGAACAGAAGAGAAAGAAGGG - Intronic
901834147 1:11912858-11912880 GTGGACAAGGAGCGTGACCATGG + Intergenic
902602824 1:17551623-17551645 AAGGGACAGAAGAGTTACCAGGG + Intronic
902957203 1:19933838-19933860 GTGGAAGAAATGATTGACCAGGG + Intergenic
903995787 1:27304815-27304837 GTTTAAGAGAACAGTGACCAGGG + Intronic
904979912 1:34491001-34491023 ATGGAACAGAAGAGAGAACTTGG + Intergenic
905802596 1:40854767-40854789 GTGAAGCAGAAGTGTGGCCAGGG + Intergenic
906731726 1:48088121-48088143 GTGGATCAGAAAACTCACCATGG - Intergenic
907799593 1:57751466-57751488 CTGGAACTGAAGAGTCATCAGGG - Intronic
908809489 1:67965199-67965221 GTGGGACAGAAGAGCTACAAAGG + Intergenic
909368320 1:74855348-74855370 GTGGAAGAGATGAGAAACCATGG - Intergenic
910110746 1:83680439-83680461 GTGGAACAGAATAGAGACTCTGG - Intergenic
911557506 1:99362871-99362893 ATGGCACAGTAGAGTGACTATGG - Intergenic
913538119 1:119793795-119793817 GTGGGGGAGAAGAGTGTCCAGGG + Intergenic
915330554 1:155109288-155109310 ATGGAACACAAGACTGAGCATGG - Intergenic
915507273 1:156365957-156365979 GAGCAACAGAAGGGTGGCCAAGG - Intronic
916260179 1:162834087-162834109 GTGAGACAGAAGAGTGAAAAAGG + Intronic
916373168 1:164122298-164122320 ATGGAACAGAATAGAGCCCACGG - Intergenic
917361179 1:174177809-174177831 ATGGAACAGAATAGAGACCTCGG - Intronic
917475277 1:175363970-175363992 GTGAAACATCAGCGTGACCATGG - Intronic
918139586 1:181709274-181709296 GTCAAAATGAAGAGTGACCAGGG - Intronic
919141051 1:193572065-193572087 GTGGAACAGAATAGAGGCCTTGG - Intergenic
920717400 1:208353207-208353229 GTTGAACTCAGGAGTGACCATGG - Intergenic
922047105 1:221956538-221956560 ATGGAACAGAAGAGAGGCCTCGG + Intergenic
923656636 1:235922579-235922601 GTGGAAAACAAGAATGGCCAAGG + Intergenic
1063931247 10:11030464-11030486 GAGGAACAGAAGTGGGACCTCGG - Intronic
1064408477 10:15085217-15085239 GTTGAACAGGAGAGAGTCCAGGG - Intronic
1065663254 10:28028605-28028627 ATGGAACAGAATAGAGAACACGG + Intergenic
1065814087 10:29469368-29469390 CTGGAACAGAGCAGTGGCCAGGG - Intronic
1066094236 10:32057066-32057088 GTGGAACAGTAGGGTGAGGAGGG + Intergenic
1067263875 10:44719893-44719915 GTAGAATAGCAGGGTGACCATGG + Intergenic
1067265996 10:44745730-44745752 CTGAGACAGATGAGTGACCAAGG + Intergenic
1067413136 10:46082543-46082565 ATGGAACAGAATAGAGACCTTGG - Intergenic
1068447125 10:57138017-57138039 GTGGAAGTGAAGAGTGATCAGGG - Intergenic
1069378913 10:67822194-67822216 GGGCAACAGAAGAGTCACAAAGG + Intronic
1071071704 10:81701718-81701740 ATGGAACAGAACAGAGACCTCGG + Intergenic
1071233366 10:83615416-83615438 TGGGAACAGAAGAGAGGCCATGG - Intergenic
1072871858 10:99128464-99128486 GTGGTACAGAAGATACACCATGG + Intronic
1074251761 10:111757716-111757738 CTGGAGCAAAAAAGTGACCAAGG - Intergenic
1075025124 10:118978660-118978682 GTGGAAGAGAAGTGTCAACAGGG + Intergenic
1075549848 10:123384050-123384072 CTGGAGCAGAGGAGTGACCTTGG + Intergenic
1075780583 10:125014784-125014806 GTGGACAAGACCAGTGACCACGG + Intronic
1076102788 10:127796541-127796563 GTGAAACACAAGTGTGAACAAGG + Intergenic
1076375022 10:129977822-129977844 AGGGAACAGAAGAGTCAGCAAGG + Intergenic
1077937782 11:6807587-6807609 GTGGAACAGAATAGAGAACCCGG - Intergenic
1078109977 11:8384536-8384558 GCGGAACATAAAAGTGAACAAGG - Intergenic
1078110068 11:8385217-8385239 GTGGAACAAAAGTGGAACCAGGG - Intergenic
1078873092 11:15367222-15367244 GGGGAGGAGAAGAGTAACCAAGG + Intergenic
1079441336 11:20517818-20517840 GGGAAACTGAAGAGTGGCCAAGG - Intergenic
1080352415 11:31400540-31400562 ATGGAACAGAACAGAGACCTTGG + Intronic
1080573940 11:33581083-33581105 GAGGCACAGAAGAGCGGCCATGG + Intronic
1083066557 11:59930027-59930049 GTGGAAGAGCAGAGAGTCCAAGG + Intergenic
1087185447 11:95187891-95187913 GTGGGACAAGAGAGTGACTAAGG - Intronic
1088033778 11:105286313-105286335 GTGGAACAGAGTAGAGAACACGG + Intergenic
1089108065 11:116031721-116031743 GTTGAAGAGCAGGGTGACCAAGG + Intergenic
1089357660 11:117865605-117865627 GAGGAACATAAGAGTGACTGTGG + Intronic
1091070015 11:132554203-132554225 GTGGAACAGCAGACTGACATGGG - Intronic
1091232933 11:134000098-134000120 CTGGGACAGAAGAGTTCCCAGGG + Intergenic
1091232958 11:134000234-134000256 CTGGGACAGAAGAGTTCCCAGGG + Intergenic
1091232983 11:134000370-134000392 CTGGGACAGAAGAGTTCCCAGGG + Intergenic
1091233008 11:134000506-134000528 CTGGGACAGAAGAGTTCCCAGGG + Intergenic
1091233033 11:134000642-134000664 CTGGGACAGAAGAGTTCCCAGGG + Intergenic
1091233058 11:134000778-134000800 CTGGGACAGAAGAGTTCCCAGGG + Intergenic
1091233130 11:134001184-134001206 GGGGAACAGACGAGTGAAAACGG + Intergenic
1091548189 12:1518555-1518577 GTGGACCAGCCGAGTGACGAAGG + Intergenic
1091951229 12:4594582-4594604 GTGGAGCAGAGGAGGGAGCAGGG - Intronic
1093403820 12:18780293-18780315 GTGGAGCAAAACAGAGACCATGG + Intergenic
1095829142 12:46564699-46564721 GTGGAACAGAATAGAGAACCCGG - Intergenic
1095915625 12:47475146-47475168 ATGGAACAGAAGAGGCCCCATGG - Intergenic
1096304360 12:50461316-50461338 GTGGAACAGAATGGGGACTATGG + Exonic
1096883136 12:54688841-54688863 GTGGGAAAGGAGAGTGACCTTGG - Intergenic
1096887347 12:54731118-54731140 GAGGAACATAAGAGTGAATAGGG - Intergenic
1097826460 12:64179359-64179381 GTGGGAGAGAAGAGGGACTAAGG - Intergenic
1098287171 12:68919032-68919054 GTAGAACAGAAGTGAGACCAGGG - Intronic
1099735703 12:86564435-86564457 GTGGAAGGGAAGAATGACCAAGG - Intronic
1100630875 12:96388225-96388247 GTGGAACAGAACAGGGAAAATGG + Intronic
1102835449 12:116054095-116054117 GTGGAGCAGAGCAGTGAGCATGG - Intronic
1103101069 12:118176291-118176313 GAGGAACTGAAAGGTGACCATGG + Intronic
1105274969 13:18912600-18912622 GTGGAACAGAATAGAGAACTCGG + Intergenic
1107384974 13:39898250-39898272 GGGGAACAGATCAGGGACCAGGG + Intergenic
1107502586 13:40995529-40995551 ATGGAACAGAATAGAGAGCACGG + Intronic
1109002572 13:56824990-56825012 ATGGAACAGAACAGAGACCTCGG + Intergenic
1110875308 13:80502410-80502432 GTGGCAGAGAGGAGTAACCATGG + Intergenic
1110880167 13:80561881-80561903 GAGAAATAGAAGAGTGATCAGGG + Intergenic
1111183867 13:84703104-84703126 GAGTAACAGAAGAATGAACAAGG - Intergenic
1111851906 13:93586426-93586448 GTGGAACAGAACAGAGAACCTGG + Intronic
1115059627 14:29173289-29173311 GTGGATATGAAAAGTGACCAGGG - Intergenic
1118393319 14:65314908-65314930 GTGGAAAAGAAGAATGCACATGG + Intergenic
1119047487 14:71332336-71332358 GAGGAACAGAACATTGACAAGGG - Intronic
1119059782 14:71462770-71462792 GTGGAAATGAAAAGTGATCAAGG + Intronic
1119474610 14:74919972-74919994 GTGGGAGACAAGAGTCACCAGGG + Intronic
1120356048 14:83435440-83435462 ATGGAACAGAAGAGAGAACCTGG + Intergenic
1121312470 14:92942667-92942689 GGGGAACAGAACAGAAACCATGG + Intronic
1125324483 15:38522974-38522996 GTGGTTCAGGAGAGAGACCACGG + Intronic
1128128308 15:65209129-65209151 GTGGAACAGAAGACTTCCCAAGG - Intronic
1130823314 15:87517901-87517923 GTGGCAGAGAGGAGTGGCCAGGG - Intergenic
1131465136 15:92648755-92648777 GTGGCACAGAGGAGGGACCATGG - Intronic
1131560955 15:93438878-93438900 GTGTTACTTAAGAGTGACCACGG + Intergenic
1131869307 15:96745225-96745247 GTGGACCAGAACAGCTACCATGG + Intergenic
1132171697 15:99664382-99664404 GTGGCAGAGATGAGAGACCATGG - Intronic
1133944044 16:10333812-10333834 GTGGGACAGAGGAGGGACAAGGG - Intronic
1136604594 16:31324813-31324835 GTGGAAGAGACCAGAGACCAAGG + Intronic
1136643093 16:31584366-31584388 GTGGAACAGAATAGAGACCTCGG - Intergenic
1137269968 16:46896838-46896860 GTGGTTAAGAAGAGTGACCTTGG + Intronic
1137956445 16:52835477-52835499 GAGGAACAGAGGAGTCTCCAGGG + Intergenic
1138278591 16:55755264-55755286 CAGGAGCAGAAGTGTGACCATGG - Intergenic
1138289963 16:55838357-55838379 TAGGAGCAGAAGTGTGACCATGG + Intergenic
1138533790 16:57649143-57649165 CTGGAACAGCAAAGGGACCACGG - Intronic
1139428002 16:66895155-66895177 GTGGAAGGGGAGAGTGTCCACGG + Intronic
1140276462 16:73513200-73513222 GTGAAACTGAACACTGACCATGG + Intergenic
1141855989 16:86681842-86681864 GTGGATCAGAGGAGAGTCCAGGG - Intergenic
1145872428 17:28285979-28286001 GTTCAAAAGAAGAGTGACTAGGG - Intergenic
1146373989 17:32281984-32282006 GAGGCACAGAAGAGTTAGCACGG - Intronic
1146453621 17:32993373-32993395 GTGGAAGAGAAGAGGGCTCAAGG + Intronic
1148579712 17:48735104-48735126 CTTGCACAGAAGAGTGACGACGG + Intergenic
1149434091 17:56618724-56618746 GTGGGAGAGCAGAGTGAGCATGG + Intergenic
1149556701 17:57578535-57578557 TGGGAACAGAAGAATGCCCAGGG + Intronic
1150515587 17:65806670-65806692 GTGGAACAGGAGAGAGAGAAGGG - Intronic
1155996465 18:32335914-32335936 GTGGAAGAGCAGAGTGACCATGG + Intronic
1156134691 18:34023626-34023648 TTGGAAAATAAGAGTGCCCAGGG + Intronic
1156295680 18:35788182-35788204 ATGGCACAGTAGGGTGACCACGG + Intergenic
1156328156 18:36093334-36093356 GTGGAAGTGAAGAGTGAACCAGG + Intergenic
1157465369 18:47939715-47939737 GTGGGACAGCAGAGTTAACAAGG + Intergenic
1157969850 18:52254144-52254166 TTAGAAAAGAAGACTGACCAAGG + Intergenic
1160119849 18:76120569-76120591 CTGGAACAGTAGAATGACAAAGG + Intergenic
1160143330 18:76345715-76345737 GTGGCACACAACAATGACCATGG - Intergenic
1164035592 19:21451332-21451354 GTGGGAAAGCAGAGTTACCAGGG - Intronic
1164596470 19:29533656-29533678 GTGGGACACAAGACTGAGCATGG - Intronic
1165156091 19:33788955-33788977 GTGGATCAAAGGAGTGACAAGGG + Intergenic
1166093457 19:40525115-40525137 GTGGCACAGTGAAGTGACCAGGG - Intronic
1168190609 19:54735848-54735870 AGGGAACAGAACAGTGAACAGGG + Exonic
1168192831 19:54752244-54752266 AGGGAACAGAACAGTGAACAGGG + Exonic
925250759 2:2435414-2435436 GGGGAACAGAAAAGTAACAATGG + Intergenic
925943825 2:8842679-8842701 CTGGAACACAACAGTGAGCAAGG + Intergenic
928111630 2:28515201-28515223 GTGGAATAGAGGAGTTAGCAGGG - Intronic
928814085 2:35268726-35268748 ATGGAACAGAAGAGAGAACCTGG - Intergenic
929062218 2:37933959-37933981 GTGGGACTGAAGACTGGCCATGG + Intronic
929291096 2:40192863-40192885 ATGGAACAGAAGAGAATCCATGG + Intronic
930159634 2:48141477-48141499 GTGGAACAGAATAGTAAACCCGG - Intergenic
930352592 2:50276624-50276646 TTTAAAAAGAAGAGTGACCAAGG + Intronic
930547501 2:52787211-52787233 GTTGAACCGAAAAGTGACAAAGG - Intergenic
931143450 2:59489119-59489141 GTGGGACAGAAGAGAGGCCCAGG + Intergenic
931480864 2:62638390-62638412 ATGGAACAGAACAGAGACCTTGG + Intergenic
931574306 2:63703628-63703650 ATGGAACAGAACAGAGCCCATGG - Intronic
932342667 2:70976205-70976227 GGGGTACAGAGGAGAGACCATGG + Intronic
932584202 2:73014392-73014414 GTGGAACAGAACAGAGAACCTGG - Intronic
933881881 2:86677914-86677936 GTGTAGCAGAGGAGGGACCAGGG + Intronic
934716487 2:96547542-96547564 GTGGCAGGGAAGAGTGCCCAGGG - Intronic
935821296 2:106895511-106895533 CTGAAACAGCTGAGTGACCAGGG - Intergenic
939766338 2:146254731-146254753 GAGGAACTGAAGGGGGACCAGGG - Intergenic
943790190 2:191922649-191922671 GTGGACCCAAAGAGTGAGCAGGG - Intergenic
944351215 2:198729503-198729525 GTGGACCAATAAAGTGACCAGGG - Intergenic
947444633 2:230154687-230154709 GTGGAACTGCAGACCGACCACGG + Intergenic
947629548 2:231643186-231643208 GTGGAATGGAAGAAAGACCAAGG + Intergenic
1169026180 20:2373528-2373550 GGGGAAGAGAAGTGAGACCAAGG - Intergenic
1169925141 20:10775530-10775552 ATGGAACAGAAAAGAGATCAAGG + Intergenic
1170953867 20:20960889-20960911 ATGGAACAGAATAGAGAACATGG + Intergenic
1173697053 20:45026825-45026847 GTGGAACAGATGGGTGCCAAAGG - Intronic
1174556360 20:51398248-51398270 GGGGAACAGCAGAGTGGGCAGGG - Intronic
1174677910 20:52376056-52376078 CTGGAAAAGAACTGTGACCAGGG - Intergenic
1174954985 20:55088106-55088128 GTTGCACAGTAGGGTGACCATGG - Intergenic
1176807924 21:13508726-13508748 GTGGAACAGAACAGAGAACTCGG - Intergenic
1177991151 21:28037761-28037783 GTGGAAGTGAAAAGTGATCAAGG + Intergenic
1178698566 21:34815200-34815222 GTTGACAAGGAGAGTGACCATGG + Intronic
1181127358 22:20709952-20709974 GTCCAACATGAGAGTGACCAGGG + Exonic
1181505682 22:23355133-23355155 CAGGAGCAGAAGTGTGACCATGG - Intergenic
1182116182 22:27757810-27757832 GAGGAACAGAAAAGCTACCAAGG - Intronic
1182884695 22:33763354-33763376 TTGGAACAGATGAAAGACCACGG + Intronic
1183118251 22:35708638-35708660 TTGGAACAGAACTGTAACCATGG - Intergenic
1183337129 22:37256272-37256294 CTGGAACTGAAGAGTGGCCCAGG - Intergenic
1185334265 22:50264569-50264591 CTGGGACAGAAGAGAGCCCAAGG + Exonic
1185340616 22:50289297-50289319 GGGGAACACAACAGTGAGCACGG - Intronic
953767274 3:45753275-45753297 CTGGAACAGAAGAATCACCCAGG - Intergenic
959241858 3:103807260-103807282 ATGGAACAGAACAGAGAACACGG - Intergenic
959279580 3:104321757-104321779 ATGGAACAGAATAGAGAACACGG + Intergenic
959746096 3:109777882-109777904 GTGGAAGGGAAAAGTGATCAAGG + Intergenic
959792274 3:110376195-110376217 GAGGAATACAAGAGTGAACAAGG - Intergenic
959937111 3:112040615-112040637 GGGGAACAGCAGAGAAACCACGG - Intronic
962193980 3:133341695-133341717 GTGGAACAGAATAGAGAACCTGG + Intronic
962635924 3:137331388-137331410 ATGGAAAAGAAGAGTGAGCCAGG - Intergenic
962872320 3:139508200-139508222 GTGGTCCAGAAGAGAGAGCAAGG + Intergenic
962940677 3:140122102-140122124 GCAGAACAGGAGAGAGACCATGG - Intronic
964409090 3:156379613-156379635 GTGGAACCACAGAGTGAACAAGG + Intronic
964600809 3:158498898-158498920 ATGGAACAGAATAGAGAACACGG - Intronic
965078901 3:164012677-164012699 CTGGAACATGAGAGTGATCAGGG - Intergenic
965541331 3:169874514-169874536 GAGGAACAGAAGAGGGAATAGGG - Intergenic
966101548 3:176275228-176275250 GTGAAACAAAAGAGAGACTAAGG + Intergenic
967772736 3:193353013-193353035 GTGGAAAACAAGGGTGGCCATGG + Intronic
968134098 3:196209211-196209233 GGAGAACACATGAGTGACCAAGG + Intronic
968178677 3:196573422-196573444 TTTGAACAGCAGAGTGACAAAGG + Intronic
968382448 4:107937-107959 GTGGAACAGGAGGGTGAACCCGG - Intergenic
968613348 4:1566888-1566910 GTGGAGAAGAAGAGAGACCTGGG - Intergenic
969941783 4:10739335-10739357 GTGGAGCAGGAGAGAGAGCAAGG - Intergenic
972481598 4:39502257-39502279 GTGGAATAGAAGAGTCCCCAAGG + Intronic
972915178 4:43868393-43868415 TTGGAAAAGCAGAGTCACCAGGG + Intergenic
973128324 4:46617322-46617344 GTGGAAAAGAAGAATGAGGAAGG + Intergenic
973568637 4:52214480-52214502 ATGGAACAGAAGAGAGCCCCCGG - Intergenic
974590829 4:63945865-63945887 GTGGAACAGAATAGAGAACCTGG - Intergenic
975146136 4:70969061-70969083 ATGGAACAGAAGAGAGACCTAGG - Intronic
975916868 4:79335651-79335673 GTGGGAGTGAAGAGTGACAATGG + Intergenic
976138606 4:81965757-81965779 GTAGAAGAACAGAGTGACCATGG + Intronic
976741602 4:88362663-88362685 GTTTAACAGAAGTGTGACCTCGG + Intergenic
978050488 4:104193275-104193297 GTGGAACAGAATAGAGAACCTGG - Intergenic
978487807 4:109276012-109276034 ATGGAGGAGAAGAGTGAGCAGGG - Intronic
981462730 4:145031197-145031219 GTGGAAGGGAAAAGTGATCAAGG - Intronic
981631448 4:146823432-146823454 GTGGATCAGAACAGAGACCTCGG - Intronic
982211637 4:153041712-153041734 GTTACACAGAAGAGTGACAATGG + Intergenic
982732622 4:158972526-158972548 CTGAAACAGAAGAGTGCACAAGG - Intronic
982789277 4:159572336-159572358 TTGGAACTGCACAGTGACCAAGG - Intergenic
983582588 4:169324202-169324224 GTGAAAGAGAAAAGTGATCAAGG - Intergenic
984060371 4:174982633-174982655 GTGGAAGTGAAAAGTGATCAAGG + Intergenic
984730462 4:183063698-183063720 GTGCCTCAGAAGAGTGACCATGG - Intergenic
987193807 5:15505008-15505030 GTAGAGCAGCAGAGTTACCAAGG - Intronic
988922767 5:35960343-35960365 GTGGAATAGAAGACTGAGCCCGG + Intronic
990252903 5:53935038-53935060 ATGGAACTGAAGAGTCAACAGGG + Intronic
990812248 5:59741212-59741234 ATGGCACAGAAAAGTGTCCAAGG - Intronic
990991123 5:61684988-61685010 CAGGAACAGAAGAGTAACCCTGG + Intronic
991212896 5:64127899-64127921 GTGGAAGAGAAGAATCACAAAGG - Intergenic
991959306 5:72028006-72028028 GTGAAACTGAAGAGTCACAAGGG - Intergenic
997368028 5:133338321-133338343 GGAGAACACAAGAGTGGCCATGG + Intronic
998024300 5:138800814-138800836 GTGCAACAGAAGGGTGGGCACGG + Intronic
998599883 5:143574810-143574832 GGGGAAAAGAAGGGAGACCAGGG - Intergenic
1000720948 5:164706397-164706419 ATTGCACAGAAGAGTGACTATGG - Intergenic
1001136667 5:169108243-169108265 GTGGAAGAGAAGAGTCTTCAGGG + Intronic
1002966589 6:1972088-1972110 GTGGCAAAGAATTGTGACCACGG - Intronic
1004935922 6:20508458-20508480 GTAGAACAAAAGACTGACCTTGG + Intergenic
1006301627 6:33196474-33196496 GTGGAACAGAAGAGTGACCAGGG - Exonic
1007349991 6:41264818-41264840 GTGGAACAGAATAGAGAACTTGG + Intergenic
1007634808 6:43292961-43292983 GTGGAAGAGAAGAGTGAGGAGGG + Intergenic
1007748926 6:44060186-44060208 CTAGAAGAGAAGAGTTACCAGGG + Intergenic
1008324785 6:50165043-50165065 GTGGACCAGTAGAGTGATTAGGG - Intergenic
1008467475 6:51846900-51846922 GAGGAACAGTAGAGAGTCCAAGG - Intronic
1009619814 6:66061147-66061169 CTTCAACAGAAGAGTGTCCAGGG - Intergenic
1010507710 6:76680831-76680853 GTGGAAGAGCAAAGTGAACAAGG + Intergenic
1010512387 6:76736729-76736751 ATGGAACAGAACAGAGACCTCGG + Intergenic
1012354147 6:98292084-98292106 GTTGACCAGAAGAGAGACGATGG - Intergenic
1013380862 6:109569092-109569114 GTGGAACAGAATAGAGCCCCTGG + Intronic
1013616074 6:111844714-111844736 GTCTAACAAAAGAGTGAACACGG - Intronic
1013995442 6:116302970-116302992 GTGGAACAGAACAGAGGCCTCGG - Intronic
1015504689 6:133970998-133971020 GTTGCACAGTAGGGTGACCATGG - Intronic
1015552480 6:134426530-134426552 GTGGGACAGAAGAGAGACCTAGG - Intergenic
1016626177 6:146172289-146172311 GGGAAACAGAAGAGAGAACAAGG - Intronic
1017061140 6:150486128-150486150 GTTGAACAAAAGAGTGTCCCTGG - Intergenic
1017550671 6:155503797-155503819 GTGGGACAGAACAGTGAAGAGGG - Intergenic
1017827670 6:158094136-158094158 GTGGGACAGAAGAGCAACCCAGG - Intronic
1018935079 6:168269043-168269065 TGGGGACAGAAGAGAGACCAGGG + Intergenic
1021281898 7:18730224-18730246 GTGGAATAGCAGAGTGAAGATGG - Intronic
1022833551 7:34092336-34092358 GAGGGACAGAAGAGGAACCAGGG - Intronic
1022986608 7:35661207-35661229 GTGGAACAGAATAGAGCCCTTGG - Intronic
1024180115 7:46883876-46883898 GTGGAGCAGTAGAGTGATCATGG + Intergenic
1028050484 7:86178764-86178786 GTGGAACAGAATAGAGCCCTTGG + Intergenic
1029004229 7:97190754-97190776 GTGGAACAGAATAGAGAGCCTGG + Intergenic
1030224621 7:107135995-107136017 GTGGAACAGAACAGAGAACCCGG + Intronic
1030277374 7:107735505-107735527 GTGGAAGCGAAAAGTGATCAAGG - Intergenic
1030343705 7:108409498-108409520 ATGGAATTGAAGAGTGACCCAGG - Intronic
1030821520 7:114098391-114098413 GTGGAACAGAATAGAGAGCCTGG + Intronic
1032738737 7:134717372-134717394 TTGGAAAAGCAGAGTGACCTTGG + Intergenic
1033905683 7:146199394-146199416 GTAGAACAGAAGATTGCACAGGG + Intronic
1034086003 7:148323249-148323271 ATGGCACAGAAGAAGGACCATGG - Intronic
1035720369 8:1786727-1786749 GTGGAAAAGAAGTGTCACTAAGG - Intergenic
1035981656 8:4379382-4379404 TTGGAACAGAAAAGTGACAGTGG + Intronic
1036699376 8:11001888-11001910 GCTGAACAGCAGAGGGACCAGGG - Intronic
1037104326 8:15086507-15086529 GTGGAAGAGAAGATGGAACAAGG - Intronic
1038183231 8:25248426-25248448 GTGGAACTGAAGGGTGACACTGG + Intronic
1039030670 8:33306095-33306117 GTGGAACAGAATAGAGCCCTCGG + Intergenic
1040369828 8:46758281-46758303 GTGGCACAGATGAGTGAACCAGG - Intergenic
1041345239 8:56890273-56890295 CGGGAACAGGAGCGTGACCATGG - Intergenic
1041572621 8:59354297-59354319 TGGAAACAGAAAAGTGACCAAGG - Intergenic
1041916292 8:63142603-63142625 ATGGAACAGAAGAGAGCCCTCGG - Intergenic
1044254314 8:90042468-90042490 GTTGTACAGTAGAGTGACTAAGG + Intronic
1045706653 8:104931130-104931152 GTAGAAAAGTAGAGTGAACATGG - Intronic
1045905373 8:107338447-107338469 GTGGAACAGGAGGGTGAGGAGGG + Intronic
1046192960 8:110822514-110822536 GTGGACCAGGAGCGTGACCGCGG - Intergenic
1046383356 8:113477981-113478003 ATGGAACAGAAAAGAGACCTTGG - Intergenic
1046807207 8:118492552-118492574 GTGAAACAGCAGAGAGAGCATGG - Intronic
1051887819 9:21913441-21913463 ATGGAACAGAATAGAGCCCATGG + Intronic
1052059916 9:23946973-23946995 GAGCAACAGAAGTGTGAACATGG - Intergenic
1052644553 9:31216228-31216250 ATGGAACAGAATAGAGAACATGG - Intergenic
1054996634 9:71398573-71398595 GTGGAGCAGAAGAGAGAGCTGGG - Intronic
1055232597 9:74084305-74084327 GCGGAACTCAAGAGAGACCAGGG - Intergenic
1057412149 9:94826312-94826334 GGGGAAGAGGAGAGTGGCCATGG - Intronic
1057875568 9:98751608-98751630 GTGGAACAGCAGAGCCACAAGGG + Intronic
1059895795 9:118863365-118863387 GTGGAACAGAATAGAGAACCCGG + Intergenic
1060054693 9:120403409-120403431 GTGCAACAGCAGAGTGATGAAGG + Intronic
1060116592 9:120946223-120946245 GTGAAAGAGAAGAGTGGCCCTGG + Intergenic
1060315472 9:122506224-122506246 GTAGAACAGAAGAGAGACTGAGG + Intergenic
1060318883 9:122536887-122536909 GTGGAACAGAATAGAGAACCCGG - Intergenic
1062174763 9:135155162-135155184 GTGTCACAGAAGCCTGACCACGG + Intergenic
1186487708 X:9946361-9946383 GGTGAGCAGAAGAGTCACCAAGG - Intronic
1186556158 X:10561030-10561052 ATGGAACAGAACAGAGACCTTGG + Intronic
1187634680 X:21213606-21213628 GTTGCACAGTAGAGTGACTATGG + Intergenic
1193573749 X:83175538-83175560 GTGGAAGCGAAAAGTGTCCAAGG + Intergenic
1195729785 X:107954924-107954946 ATGGAACAGAATAGAGACCTCGG - Intergenic
1195928079 X:110046420-110046442 GTGGCAGAGAAGAGAGGCCAAGG - Intronic
1196134656 X:112195198-112195220 GTGGAAGAGAAGAGTTGACATGG + Intergenic
1196481235 X:116152060-116152082 ATGGAACAGAATAGAGAACATGG + Intergenic
1197556447 X:127960871-127960893 ATGGAACAGAATAGAGACCCTGG - Intergenic
1197951590 X:131903527-131903549 GTGTAGCAGAAGAGGGGCCAGGG - Intergenic
1201341811 Y:12942355-12942377 ATGGAAGAGGAGAGTGGCCAGGG + Intergenic