ID: 1006301628

View in Genome Browser
Species Human (GRCh38)
Location 6:33196475-33196497
Sequence TGTGGAACAGAAGAGTGACC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 246}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006301628_1006301635 20 Left 1006301628 6:33196475-33196497 CCTGGTCACTCTTCTGTTCCACA 0: 1
1: 0
2: 2
3: 18
4: 246
Right 1006301635 6:33196518-33196540 CCTGTCCACAGGCATCTCCTCGG 0: 1
1: 0
2: 3
3: 28
4: 311
1006301628_1006301631 9 Left 1006301628 6:33196475-33196497 CCTGGTCACTCTTCTGTTCCACA 0: 1
1: 0
2: 2
3: 18
4: 246
Right 1006301631 6:33196507-33196529 GCCTCCAGGATCCTGTCCACAGG 0: 1
1: 2
2: 2
3: 46
4: 205
1006301628_1006301636 21 Left 1006301628 6:33196475-33196497 CCTGGTCACTCTTCTGTTCCACA 0: 1
1: 0
2: 2
3: 18
4: 246
Right 1006301636 6:33196519-33196541 CTGTCCACAGGCATCTCCTCGGG 0: 1
1: 0
2: 2
3: 25
4: 266
1006301628_1006301637 22 Left 1006301628 6:33196475-33196497 CCTGGTCACTCTTCTGTTCCACA 0: 1
1: 0
2: 2
3: 18
4: 246
Right 1006301637 6:33196520-33196542 TGTCCACAGGCATCTCCTCGGGG 0: 1
1: 0
2: 1
3: 13
4: 131
1006301628_1006301638 23 Left 1006301628 6:33196475-33196497 CCTGGTCACTCTTCTGTTCCACA 0: 1
1: 0
2: 2
3: 18
4: 246
Right 1006301638 6:33196521-33196543 GTCCACAGGCATCTCCTCGGGGG 0: 1
1: 0
2: 1
3: 16
4: 129
1006301628_1006301630 -5 Left 1006301628 6:33196475-33196497 CCTGGTCACTCTTCTGTTCCACA 0: 1
1: 0
2: 2
3: 18
4: 246
Right 1006301630 6:33196493-33196515 CCACAGCAAGCTCTGCCTCCAGG 0: 2
1: 161
2: 13899
3: 98792
4: 125071

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006301628 Original CRISPR TGTGGAACAGAAGAGTGACC AGG (reversed) Exonic
900889612 1:5440236-5440258 TGTGGTACTGCAGAGTGCCCTGG + Intergenic
900988654 1:6087443-6087465 TGTGGAACAGAAGAGAAAGAAGG - Intronic
901663520 1:10813687-10813709 TGTGGCACAGAGGTGTAACCAGG - Intergenic
902957202 1:19933837-19933859 TGTGGAAGAAATGATTGACCAGG + Intergenic
904854377 1:33486016-33486038 TGTGGAAGAGCAGAGGGAGCTGG + Intronic
905017771 1:34789295-34789317 TTTGGGACAGAGGAGTGACATGG - Intronic
905244805 1:36605249-36605271 TGTGGACCAGAAGTGTCACAAGG - Intergenic
906222301 1:44090538-44090560 TGTGGAAGAGAAGAGGGGGCAGG + Intergenic
908116744 1:60948249-60948271 TGTGGAACAGATGAGAGTCCTGG - Intronic
913517820 1:119619399-119619421 TGTGGCAAAGAAGAATGACATGG + Intergenic
914325230 1:146607773-146607795 TGTGGTACAGGACAGGGACCAGG - Intergenic
916313784 1:163425568-163425590 TCAGGAACAGAAGAGAGACTTGG + Intergenic
920660366 1:207909923-207909945 TGTGGCCCTGCAGAGTGACCTGG - Intronic
920853806 1:209647492-209647514 TGTGGCACAGAAGAATGATCTGG + Intronic
920856663 1:209668291-209668313 TTTGAAAGAGAAGAGTGACATGG + Intergenic
921146590 1:212363901-212363923 TGTGGAGCAGAAAAGTGGCAGGG + Intergenic
921166650 1:212512959-212512981 AGAGGAGCAGAAGAGTGGCCTGG + Intergenic
921170653 1:212545296-212545318 TCTTTAACAGAAGAGTCACCTGG + Intergenic
921416178 1:214890105-214890127 TGTGGAACAGAATGGAGACCAGG + Intergenic
922032944 1:221821915-221821937 TTTGGTACAGTGGAGTGACCTGG - Intergenic
924143910 1:241054259-241054281 TGTGCAACAGAAGAGTCAGAGGG + Intronic
1063936335 10:11082402-11082424 TGTTGAACAGCTGAGTGATCTGG - Intronic
1064718099 10:18197723-18197745 TGTGGACCAGACAAGTGACAGGG + Intronic
1065814088 10:29469369-29469391 TCTGGAACAGAGCAGTGGCCAGG - Intronic
1066094235 10:32057065-32057087 TGTGGAACAGTAGGGTGAGGAGG + Intergenic
1067037140 10:42928911-42928933 TGTTTAACACGAGAGTGACCAGG + Intergenic
1068182672 10:53542651-53542673 TTTGGAAAAGAAGTGTGAACGGG - Intergenic
1068447126 10:57138018-57138040 TGTGGAAGTGAAGAGTGATCAGG - Intergenic
1068766991 10:60775166-60775188 TGTGGAATACAAGAGTGACCTGG - Intergenic
1069191722 10:65499783-65499805 TGTGGAAGAGCAGGGTAACCTGG - Intergenic
1069912164 10:71766265-71766287 TGTGGGACAGGAAAATGACCCGG + Intronic
1072056551 10:91763646-91763668 AATGGAACAGAACAGAGACCAGG + Intergenic
1073582848 10:104683508-104683530 TGAGTAAGAGAGGAGTGACCAGG + Intronic
1077098950 11:812736-812758 TGTGGAACAGAGGAGAGGCATGG - Intronic
1077216208 11:1396214-1396236 GGTGGAAGGGAAGAGGGACCAGG - Intronic
1077216221 11:1396250-1396272 GGTGGAAGGGAAGAGGGACCAGG - Intronic
1077541359 11:3147981-3148003 TGAGGAACAGGAGAGTGACCAGG - Intronic
1077619386 11:3706570-3706592 TGTGGAACTGGACAGTGACATGG - Exonic
1077982196 11:7311460-7311482 TGCGGAGCAGCAGAGTGACAGGG + Intronic
1078620157 11:12899815-12899837 TGTTGAACAGGAGAGGGACCTGG + Intronic
1078973283 11:16440781-16440803 AGTAAAACAGAAGAGTTACCAGG + Intronic
1079754643 11:24240888-24240910 TGTGGAAGAAAAGAGTGAACAGG + Intergenic
1082631413 11:55546438-55546460 TCTGAAACAGAAAAGTCACCTGG - Intergenic
1083078175 11:60063237-60063259 TGTGGTACAGCAGAGAGTCCTGG + Intronic
1083538299 11:63491403-63491425 TTTGGAACAGAGGCGTGACTTGG + Intergenic
1085670933 11:78464276-78464298 TGTGGACCCAAAGAGTGAGCAGG + Intronic
1087065908 11:94027772-94027794 TGTGGAAATGAAGAGTGAAAAGG + Intronic
1087767585 11:102173011-102173033 TTTTGAACAGAGGAGTGACATGG + Intronic
1088626132 11:111731989-111732011 TGCAGAACTGAAGAGTGTCCTGG - Intronic
1089059297 11:115613212-115613234 TTTTGAACAGAGGAGTGACATGG - Intergenic
1090766638 11:129881876-129881898 TGTGGAAGAGAAGTCTGACTGGG - Intronic
1091070016 11:132554204-132554226 TGTGGAACAGCAGACTGACATGG - Intronic
1093850077 12:24025829-24025851 TATGAATCAGAAGAGTGAACTGG + Intergenic
1095368271 12:41435010-41435032 TATAGAACTGAAGAGTGACTTGG - Intronic
1096490567 12:52010509-52010531 TGTGGAACAGAGGAGGCTCCAGG + Intronic
1096887348 12:54731119-54731141 TGAGGAACATAAGAGTGAATAGG - Intergenic
1098287172 12:68919033-68919055 AGTAGAACAGAAGTGAGACCAGG - Intronic
1099622338 12:85019559-85019581 TGTGGGACAGAAGAGAGAATAGG - Intronic
1100792707 12:98148129-98148151 TGTGAAACTGAAGAGAGATCAGG + Intergenic
1101547616 12:105731347-105731369 TGTGGCAAAGAAGTGTGAACAGG + Intergenic
1101891178 12:108716869-108716891 TGTTGAACAAAAGAATGACTGGG - Intronic
1102034694 12:109764306-109764328 TGTGGAATGGCAGAGGGACCAGG + Intronic
1103731402 12:123030164-123030186 TTTGAAACAGAAGAGTCCCCAGG - Intronic
1106179107 13:27355925-27355947 GTTGGAACAGAAGAGTGACATGG - Intergenic
1107384973 13:39898249-39898271 TGGGGAACAGATCAGGGACCAGG + Intergenic
1109387210 13:61646602-61646624 TTATGAACAGAAGAGTGACATGG + Intergenic
1109793548 13:67280170-67280192 TGGGCAACAGAAGAGTGATGGGG + Intergenic
1115059628 14:29173290-29173312 TGTGGATATGAAAAGTGACCAGG - Intergenic
1115223934 14:31084616-31084638 AGTGGAACTGAAGAGTGCACAGG - Intronic
1116929109 14:50672306-50672328 TGTGAAGAAGAAGAGTGAGCTGG - Intergenic
1119474609 14:74919971-74919993 TGTGGGAGACAAGAGTCACCAGG + Intronic
1119945896 14:78693782-78693804 TCTGGTTCAGAAGAGTGACGAGG - Intronic
1120183728 14:81371009-81371031 TGAGGAGCAGACGAGTGGCCAGG - Exonic
1123924192 15:25092101-25092123 GGTGGCACAGAAGAGTTAGCCGG + Intergenic
1128621465 15:69154229-69154251 TTTTGAGCAGAAGAATGACCTGG - Intergenic
1129179711 15:73866307-73866329 TGAGGAAAAGAGGAGTGCCCAGG - Intergenic
1130578183 15:85111528-85111550 AGTGGAACAGAATAGAGTCCAGG - Intronic
1130604031 15:85298705-85298727 TGTGGATAAGAAGATTGACTAGG - Intergenic
1130623687 15:85491054-85491076 TGAGGAACAGAACAGTGGCTGGG + Intronic
1131112558 15:89774671-89774693 TGTGGGAAAGAAAAGTGAACAGG - Intronic
1131438854 15:92443553-92443575 TCTGGAGCAGGAGAGTGACAGGG - Intronic
1132390454 15:101434714-101434736 TGTACAACAGATGACTGACCAGG + Intronic
1132511771 16:346272-346294 TGAGGAATGGAAGTGTGACCAGG - Exonic
1132622333 16:873719-873741 TGTGACACTGAAGAGAGACCTGG - Intronic
1133548072 16:6827529-6827551 TGGAGAACAGAGGAGTGACATGG - Intronic
1133710099 16:8393131-8393153 TGTGGAGCAGAAGAGGGGCAGGG - Intergenic
1135390884 16:22092375-22092397 TGGAGAAAAGCAGAGTGACCTGG + Intergenic
1135669918 16:24366608-24366630 TCTGGAAAAGAAGATTGTCCAGG - Intergenic
1135758708 16:25118942-25118964 TTTGGAACTGAAGAGTGAGGTGG + Intronic
1136084236 16:27873267-27873289 TTTGGAACATAAGCCTGACCTGG + Intronic
1136312644 16:29423362-29423384 TCTGGATGAGAAGTGTGACCAGG - Intergenic
1137261858 16:46837323-46837345 TGTGGAATAGAAGTGAAACCAGG - Intergenic
1137379697 16:47986039-47986061 TGTGGAAGAGAAGAGAGAGAGGG + Intergenic
1137679202 16:50324411-50324433 TTGCGAGCAGAAGAGTGACCCGG - Intronic
1137748736 16:50842420-50842442 TTTTGAGCGGAAGAGTGACCTGG - Intergenic
1137816535 16:51403328-51403350 TGGGGATCTGCAGAGTGACCCGG - Intergenic
1137841773 16:51647686-51647708 TGTGGAAGAGCACAGTCACCTGG - Intergenic
1137919685 16:52474784-52474806 TTTTGAGCAGAAGAGTGACATGG - Intronic
1138461165 16:57148627-57148649 TGTGGAATAAAGGAGGGACCTGG - Intergenic
1140008333 16:71103173-71103195 TGTGGTACAGGACAGGGACCAGG + Intronic
1141219414 16:82055316-82055338 TTTGCAACAGAATAGTGACTGGG - Intronic
1142599774 17:1047953-1047975 TGTGGAATAGAAGAGTTACAAGG - Intronic
1143049903 17:4116457-4116479 TGTGGAACATAACAGAGCCCAGG - Intronic
1143113687 17:4568640-4568662 CGTGGTTCAGAGGAGTGACCTGG - Intergenic
1143687837 17:8533344-8533366 TGGGGCAGAGAAGAGTGAGCAGG - Intronic
1145086632 17:19947654-19947676 TGTGGAAGAGGAGAGTTACATGG + Intronic
1147055206 17:37828828-37828850 TATGGATCAGAAGAGGGTCCTGG - Intergenic
1148126203 17:45238429-45238451 TTTTGAGCAGAAGAGTGACGTGG + Intronic
1148698011 17:49572752-49572774 TGAGCCACAGCAGAGTGACCTGG - Intergenic
1148739448 17:49884241-49884263 TCTGGAACAGAGGAGGGACCTGG + Intergenic
1149556700 17:57578534-57578556 TTGGGAACAGAAGAATGCCCAGG + Intronic
1149911564 17:60571700-60571722 TGTGGCACTGAAGAATGTCCTGG - Intronic
1153180649 18:2429216-2429238 TGTGGGGCAGAAGATTGAGCTGG - Intergenic
1153524953 18:5986025-5986047 TCTGGAAATGAAAAGTGACCTGG + Intronic
1155360400 18:24993957-24993979 TCTGCAACAGAAGGGTGACAAGG + Intergenic
1156134690 18:34023625-34023647 TTTGGAAAATAAGAGTGCCCAGG + Intronic
1156392694 18:36665715-36665737 TGTGCAAAAGAAGAGTGAGTTGG + Intronic
1157335253 18:46733086-46733108 TGTGGGACAGAACAGTGCCGTGG - Intronic
1164946297 19:32295860-32295882 TGTGGAATAGAAAAGTGGCCAGG - Intergenic
1165156090 19:33788954-33788976 TGTGGATCAAAGGAGTGACAAGG + Intergenic
1168471778 19:56646039-56646061 TGTGGGTCAGAAGTTTGACCTGG + Intronic
926724090 2:15984045-15984067 TGTGTAACAGGAGAGTGAAAGGG - Intergenic
928409662 2:31045070-31045092 AGGGGTACAGAAGAATGACCAGG + Intronic
931162673 2:59710917-59710939 TGTGGAACGAAAGAAGGACCAGG - Intergenic
932148158 2:69342989-69343011 TGGAGAACAGAAGAGAGAACTGG - Intronic
932420143 2:71596709-71596731 TGTGGAACAGAAGAGGGCAATGG - Intronic
934636200 2:95992046-95992068 TGTGGAAGAGAAGAGCGCGCGGG - Intergenic
934797449 2:97113380-97113402 TGTGGAAGAGAAGAGCGCGCGGG + Intergenic
934835962 2:97590059-97590081 TGTGGAAGAGAAGAGCGCGCGGG - Intergenic
937363059 2:121242433-121242455 TCGGAAACAGAAGACTGACCGGG - Exonic
938397650 2:130963158-130963180 TGTGGAAGAGTTCAGTGACCGGG - Intronic
938966622 2:136394377-136394399 TGTGGAGGAGAAGGTTGACCTGG - Intergenic
939372679 2:141322388-141322410 TGGGGAACAGAAGAGAGACAGGG + Intronic
942159570 2:173168916-173168938 AGTGGTACTGAAGAGTGACATGG - Intronic
942484889 2:176428591-176428613 TAAGGAACAGAAGGTTGACCAGG - Intergenic
943707045 2:191046754-191046776 TTTAGAACAGAAGACTCACCTGG - Intronic
943790191 2:191922650-191922672 TGTGGACCCAAAGAGTGAGCAGG - Intergenic
944979403 2:205097674-205097696 CGTGGATCAGAAGAATTACCTGG - Intronic
945633906 2:212322179-212322201 GCTGGAACTGAAGAGTGAACTGG + Intronic
946387969 2:219397221-219397243 TGTGGAACAGGAAAGAGACGGGG - Intronic
946993398 2:225361788-225361810 TGAGGAACAGCAGAATGACATGG - Intergenic
947230027 2:227875350-227875372 GCTGGAGCAGAAGAGTGACATGG - Intronic
948527040 2:238577372-238577394 AGTGGAACAGAAGAATCAGCTGG - Intergenic
1169151221 20:3291135-3291157 TCTGGAAGAGAAGAGGGGCCAGG + Intronic
1170577549 20:17675808-17675830 TCTTGAACAGAGGAGTGACATGG + Intronic
1171146694 20:22790308-22790330 TGTGGAATTGAAGAGTGAATTGG - Intergenic
1173530862 20:43768534-43768556 TGTGGACCTGAAGAATTACCTGG + Intergenic
1174096620 20:48094691-48094713 CGTGGACAAGAAGAGTGTCCTGG - Intergenic
1174503200 20:51000457-51000479 TGGTGAACACAAGGGTGACCTGG - Intergenic
1174556361 20:51398249-51398271 TGGGGAACAGCAGAGTGGGCAGG - Intronic
1174677911 20:52376057-52376079 TCTGGAAAAGAACTGTGACCAGG - Intergenic
1174774920 20:53334649-53334671 TTTTGAACAGAGGAGTGACGTGG + Intronic
1175712418 20:61231824-61231846 TGTGGGACAGAAAACTGACACGG + Intergenic
1176256710 20:64156800-64156822 GCTGAAACAGCAGAGTGACCTGG - Intronic
1177506609 21:22027624-22027646 TGGGGAACAGAAGAGAGAGATGG + Intergenic
1178274610 21:31225806-31225828 ACTGGAACAGAAGATTGACATGG - Exonic
1178780188 21:35595447-35595469 TGTAGAAGAGAAGAGTTCCCAGG + Intronic
1180353877 22:11823774-11823796 TGCGGAAGAGAAGCGGGACCTGG - Intergenic
1180384370 22:12168551-12168573 TGCGGAAGAGAAGCGGGACCTGG + Intergenic
1181127357 22:20709951-20709973 TGTCCAACATGAGAGTGACCAGG + Exonic
1182307427 22:29380305-29380327 TGGGGAAGAGAAGAGGTACCAGG - Intronic
1183177562 22:36235660-36235682 TGGGGAATAGAAAAGTTACCAGG + Intronic
1184561147 22:45263631-45263653 TGTGGAGCAGAAGAAGGAGCCGG - Intergenic
1184911390 22:47536924-47536946 GGTGGAACAGAGGAGTGCCAGGG - Intergenic
1185142031 22:49107920-49107942 TGTGGAAAAGAATAGAGCCCAGG - Intergenic
949860809 3:8503001-8503023 TGAGGCTCAGAAAAGTGACCTGG - Intronic
951924182 3:27888794-27888816 TGTGGAACACAAGAGACTCCTGG + Intergenic
952201036 3:31127839-31127861 TGTGGTACAGAAGCGTGAGGAGG + Intergenic
953966883 3:47314943-47314965 TGTGCACCAACAGAGTGACCTGG - Intronic
956011816 3:64840076-64840098 TGGGGAACACACGAGTTACCGGG - Intergenic
956258247 3:67307700-67307722 TGTGAAACAGATGAGAGACAGGG + Intergenic
961406960 3:126686502-126686524 TTTGGAGCAGAGGAGGGACCTGG - Intergenic
961719176 3:128880804-128880826 TGTGCAGCAGAAGAGAGAGCTGG + Intronic
962061492 3:131932428-131932450 AGTGGAACACAAGACTGACCCGG + Intronic
964282865 3:155086025-155086047 TTTTGAACAGAGGAGTGATCAGG + Intronic
965078902 3:164012678-164012700 TCTGGAACATGAGAGTGATCAGG - Intergenic
965786449 3:172340195-172340217 TGTGGAACTGAAGAGAGAAACGG - Intronic
966080027 3:175989398-175989420 TCTGGAACAGCTCAGTGACCTGG - Intergenic
966308303 3:178563083-178563105 TGTGGAACAACTGAGTGAACTGG + Intronic
966411096 3:179646704-179646726 TTTGGAGCAGTAGAGTGACATGG + Intergenic
966504444 3:180683721-180683743 TGGAGAACAGAAGAGAGATCTGG - Intronic
968613349 4:1566889-1566911 TGTGGAGAAGAAGAGAGACCTGG - Intergenic
969560719 4:7946026-7946048 TGTGGATCAGAAGCTTAACCGGG + Intergenic
969975026 4:11089961-11089983 TTGGGAACAAAAGAGAGACCAGG + Intergenic
972915177 4:43868392-43868414 TTTGGAAAAGCAGAGTCACCAGG + Intergenic
973336839 4:48965201-48965223 TGGGGAACAGAAGAATTACAGGG - Intergenic
973374297 4:49276876-49276898 TGCGGAAGAGAAGCGGGACCTGG + Intergenic
976078960 4:81332966-81332988 TGTGGCACATCAGAGTGACTTGG - Intergenic
977611496 4:99038182-99038204 TCTAGAACAGAAGAATCACCTGG - Intronic
978487808 4:109276013-109276035 TATGGAGGAGAAGAGTGAGCAGG - Intronic
978910705 4:114060362-114060384 ATTGGAAGAGAAAAGTGACCAGG + Intergenic
981663205 4:147191215-147191237 TCTGGCACAGAAGAGTCTCCTGG + Intergenic
981808148 4:148740873-148740895 TGTGGGACAGAAGAGTGGCTAGG + Intergenic
984623606 4:181980283-181980305 TGTGGGAGAGATGAGTTACCAGG - Intergenic
991959307 5:72028007-72028029 TGTGAAACTGAAGAGTCACAAGG - Intergenic
992178134 5:74171020-74171042 TGTTGAACGGAAGAGTGAAATGG + Intergenic
992371785 5:76151399-76151421 TGAGCAGCAGAAGAGTGACATGG + Intronic
996566698 5:124887186-124887208 GGTGGAACAGAAGACTAATCTGG - Intergenic
997615766 5:135245219-135245241 TGTGGAAAAGAAGAATGAAGAGG - Intronic
999357729 5:150952907-150952929 TGTGGAACAGGAGAGTCAGCTGG + Intergenic
1000136002 5:158351657-158351679 GGATGAAGAGAAGAGTGACCAGG + Intergenic
1001244206 5:170093667-170093689 TGCGGACCAGAAGACTGACATGG - Intergenic
1002046805 5:176546046-176546068 TGGGGCACAGCAGAGCGACCAGG + Intronic
1003753233 6:9086122-9086144 TGTGATACAGCAGAGTGACGAGG - Intergenic
1004193091 6:13481381-13481403 TGAGGAACAGAAAAGAGGCCAGG + Intronic
1005450060 6:25963458-25963480 TAGGCAACAGAGGAGTGACCAGG - Intronic
1005688243 6:28276245-28276267 TGTGGAAGAGTAGAGTCATCTGG + Exonic
1005940085 6:30554365-30554387 TTTTGAAGAGAAGAGTGAGCTGG + Intronic
1006133316 6:31881420-31881442 TATGGAACAGGAGAGGGGCCAGG + Intronic
1006301628 6:33196475-33196497 TGTGGAACAGAAGAGTGACCAGG - Exonic
1007607925 6:43129791-43129813 TGTGGCAACGAAGTGTGACCTGG - Exonic
1007634807 6:43292960-43292982 AGTGGAAGAGAAGAGTGAGGAGG + Intergenic
1007748925 6:44060185-44060207 TCTAGAAGAGAAGAGTTACCAGG + Intergenic
1008003174 6:46382069-46382091 TGTGGAGCAGTAGAGTGAGATGG + Intronic
1008324786 6:50165044-50165066 TGTGGACCAGTAGAGTGATTAGG - Intergenic
1010837830 6:80612125-80612147 TGAGGAACAGAAGAGTCCCCAGG + Intergenic
1014193918 6:118530240-118530262 TGTGAAAAAAAAGAGTGAACTGG - Intronic
1014477011 6:121886077-121886099 TTTTGAACAGGAGAGTGACGTGG + Intergenic
1015419580 6:132990692-132990714 TTTTGAAGAGAAAAGTGACCTGG - Intergenic
1017550672 6:155503798-155503820 TGTGGGACAGAACAGTGAAGAGG - Intergenic
1020035649 7:4961394-4961416 TGGGGACCAGAAGAGGGAACAGG + Intergenic
1020672918 7:11141009-11141031 TGAGGAACATAAGACAGACCTGG + Intronic
1021018844 7:15570358-15570380 TTTTGAACAGAAGAGTCACATGG + Intergenic
1022833552 7:34092337-34092359 TGAGGGACAGAAGAGGAACCAGG - Intronic
1023210280 7:37796219-37796241 GGTGGAACGGAAGGCTGACCAGG - Intronic
1023562475 7:41490427-41490449 TGATGAACAAAAGAGTGAGCTGG + Intergenic
1026426896 7:70303773-70303795 TGAGGAAGAGAAGAGTGTCAGGG - Intronic
1026586372 7:71659355-71659377 TGTGGAGCAGAAGAACCACCTGG - Intronic
1026850502 7:73720353-73720375 TGGGGAACAGAAGGGAGAGCAGG - Intergenic
1031738010 7:125391344-125391366 TGTGGTACAAAAGAATGACTTGG - Intergenic
1033935619 7:146582006-146582028 TGAAGAACAAAAGAGTGATCTGG + Intronic
1035083377 7:156235986-156236008 TGTGGAACAGGAGAGCCATCAGG - Intergenic
1036801110 8:11793463-11793485 TGGGGTACAGAAGAGTGGGCAGG + Intergenic
1037810502 8:22083757-22083779 TGGGGAACACAGCAGTGACCAGG + Intergenic
1038333378 8:26627388-26627410 GGTGGAAAAGCAGAGGGACCTGG + Intronic
1040351410 8:46572443-46572465 TGTGGACCCAAAGAGTGAGCAGG - Intergenic
1040385582 8:46912969-46912991 TGTGGCAGAGAAGAGAGACCAGG - Intergenic
1040636120 8:49274887-49274909 TGTGGGCCAGAAGACTCACCTGG - Intergenic
1041023603 8:53661432-53661454 TGAGGAACAGGAGAGAAACCCGG + Intergenic
1043874394 8:85467988-85468010 CGGGGAACAGGAGAGGGACCAGG - Intronic
1046099881 8:109602085-109602107 TGTGGAACCTAAGAGCTACCTGG - Intronic
1047594666 8:126366271-126366293 TGAGGAACTGAAGAGAGGCCTGG + Intergenic
1048497491 8:134947243-134947265 CCTGGAACAGAACAGTGCCCTGG + Intergenic
1049403976 8:142443440-142443462 TGCGGAGCAGAAGGGGGACCAGG + Intergenic
1050065579 9:1756082-1756104 TGTTGAAAAGAAGAGTGCACTGG - Intergenic
1050431925 9:5570950-5570972 TGTGGAGCAGAAGGGTAACTCGG + Exonic
1050567607 9:6902465-6902487 TGTGGAATAGTTGTGTGACCTGG + Intronic
1051424210 9:16917377-16917399 CGTGGAAGAGAAAAGGGACCTGG + Intergenic
1054996635 9:71398574-71398596 GGTGGAGCAGAAGAGAGAGCTGG - Intronic
1056821227 9:89843464-89843486 TGTGGGAGAGAAGAGTGTCGGGG - Intergenic
1056910233 9:90692931-90692953 TGTTGAAAAAAAAAGTGACCTGG + Intergenic
1056998278 9:91484096-91484118 GGTGGTACAGCAGAGTGACTTGG + Intergenic
1057875567 9:98751607-98751629 TGTGGAACAGCAGAGCCACAAGG + Intronic
1058538480 9:105988370-105988392 TTTTGAGCAGAGGAGTGACCTGG + Intergenic
1060408417 9:123384021-123384043 TGCGGGACAGGAGAGTGTCCCGG + Intronic
1060717019 9:125941375-125941397 TGGGGAACTGAGGAGTGACATGG + Intronic
1203697968 Un_GL000214v1:114790-114812 TGTGGAAGAGAAGCGGGGCCTGG + Intergenic
1186772351 X:12830459-12830481 TGTGAAACAGTGGGGTGACCAGG + Intergenic
1187718952 X:22131949-22131971 TGTGGACCAGAAGAGAGGACTGG - Intronic
1189515253 X:41707108-41707130 TCTGGATGAGAAGAGTGGCCAGG - Intronic
1190746528 X:53326417-53326439 TTTTGAACAGGAGAGTGACACGG + Intergenic
1194521008 X:94918831-94918853 TGTGGAAGAGACAAGTGAGCAGG - Intergenic
1195951090 X:110273806-110273828 AGTGGAACACAATAGTGAACTGG - Intronic
1197851549 X:130866612-130866634 TGTAGAACAAAAAAGTGAACAGG - Intronic
1198079867 X:133229257-133229279 TCTTGAGCAGAAGAGTGACTTGG + Intergenic
1199575706 X:149311892-149311914 AGAGGAACAGAAGAGTGGCATGG - Intergenic
1201061729 Y:10052267-10052289 TGTGGAACAAAAGTGTAAGCTGG + Intergenic