ID: 1006301630

View in Genome Browser
Species Human (GRCh38)
Location 6:33196493-33196515
Sequence CCACAGCAAGCTCTGCCTCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 237925
Summary {0: 2, 1: 161, 2: 13899, 3: 98792, 4: 125071}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006301621_1006301630 13 Left 1006301621 6:33196457-33196479 CCCCAGGACCCTCAACGCCCTGG 0: 1
1: 0
2: 0
3: 13
4: 205
Right 1006301630 6:33196493-33196515 CCACAGCAAGCTCTGCCTCCAGG 0: 2
1: 161
2: 13899
3: 98792
4: 125071
1006301617_1006301630 22 Left 1006301617 6:33196448-33196470 CCCCGGTTCCCCCAGGACCCTCA 0: 1
1: 0
2: 3
3: 23
4: 237
Right 1006301630 6:33196493-33196515 CCACAGCAAGCTCTGCCTCCAGG 0: 2
1: 161
2: 13899
3: 98792
4: 125071
1006301627_1006301630 -4 Left 1006301627 6:33196474-33196496 CCCTGGTCACTCTTCTGTTCCAC 0: 1
1: 0
2: 1
3: 12
4: 286
Right 1006301630 6:33196493-33196515 CCACAGCAAGCTCTGCCTCCAGG 0: 2
1: 161
2: 13899
3: 98792
4: 125071
1006301614_1006301630 29 Left 1006301614 6:33196441-33196463 CCGCTACCCCCGGTTCCCCCAGG 0: 1
1: 0
2: 2
3: 15
4: 328
Right 1006301630 6:33196493-33196515 CCACAGCAAGCTCTGCCTCCAGG 0: 2
1: 161
2: 13899
3: 98792
4: 125071
1006301626_1006301630 4 Left 1006301626 6:33196466-33196488 CCTCAACGCCCTGGTCACTCTTC 0: 1
1: 0
2: 1
3: 9
4: 145
Right 1006301630 6:33196493-33196515 CCACAGCAAGCTCTGCCTCCAGG 0: 2
1: 161
2: 13899
3: 98792
4: 125071
1006301618_1006301630 21 Left 1006301618 6:33196449-33196471 CCCGGTTCCCCCAGGACCCTCAA 0: 1
1: 0
2: 1
3: 8
4: 240
Right 1006301630 6:33196493-33196515 CCACAGCAAGCTCTGCCTCCAGG 0: 2
1: 161
2: 13899
3: 98792
4: 125071
1006301616_1006301630 23 Left 1006301616 6:33196447-33196469 CCCCCGGTTCCCCCAGGACCCTC 0: 1
1: 0
2: 2
3: 20
4: 320
Right 1006301630 6:33196493-33196515 CCACAGCAAGCTCTGCCTCCAGG 0: 2
1: 161
2: 13899
3: 98792
4: 125071
1006301619_1006301630 20 Left 1006301619 6:33196450-33196472 CCGGTTCCCCCAGGACCCTCAAC 0: 1
1: 0
2: 1
3: 26
4: 234
Right 1006301630 6:33196493-33196515 CCACAGCAAGCTCTGCCTCCAGG 0: 2
1: 161
2: 13899
3: 98792
4: 125071
1006301624_1006301630 11 Left 1006301624 6:33196459-33196481 CCAGGACCCTCAACGCCCTGGTC 0: 1
1: 0
2: 1
3: 8
4: 125
Right 1006301630 6:33196493-33196515 CCACAGCAAGCTCTGCCTCCAGG 0: 2
1: 161
2: 13899
3: 98792
4: 125071
1006301623_1006301630 12 Left 1006301623 6:33196458-33196480 CCCAGGACCCTCAACGCCCTGGT 0: 1
1: 0
2: 0
3: 11
4: 121
Right 1006301630 6:33196493-33196515 CCACAGCAAGCTCTGCCTCCAGG 0: 2
1: 161
2: 13899
3: 98792
4: 125071
1006301628_1006301630 -5 Left 1006301628 6:33196475-33196497 CCTGGTCACTCTTCTGTTCCACA 0: 1
1: 0
2: 2
3: 18
4: 246
Right 1006301630 6:33196493-33196515 CCACAGCAAGCTCTGCCTCCAGG 0: 2
1: 161
2: 13899
3: 98792
4: 125071
1006301625_1006301630 5 Left 1006301625 6:33196465-33196487 CCCTCAACGCCCTGGTCACTCTT 0: 1
1: 0
2: 2
3: 12
4: 119
Right 1006301630 6:33196493-33196515 CCACAGCAAGCTCTGCCTCCAGG 0: 2
1: 161
2: 13899
3: 98792
4: 125071
1006301620_1006301630 14 Left 1006301620 6:33196456-33196478 CCCCCAGGACCCTCAACGCCCTG 0: 1
1: 0
2: 1
3: 27
4: 214
Right 1006301630 6:33196493-33196515 CCACAGCAAGCTCTGCCTCCAGG 0: 2
1: 161
2: 13899
3: 98792
4: 125071

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006301630 Original CRISPR CCACAGCAAGCTCTGCCTCC AGG Exonic
Too many off-targets to display for this crispr