ID: 1006301631

View in Genome Browser
Species Human (GRCh38)
Location 6:33196507-33196529
Sequence GCCTCCAGGATCCTGTCCAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 2, 2: 2, 3: 46, 4: 205}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006301625_1006301631 19 Left 1006301625 6:33196465-33196487 CCCTCAACGCCCTGGTCACTCTT 0: 1
1: 0
2: 2
3: 12
4: 119
Right 1006301631 6:33196507-33196529 GCCTCCAGGATCCTGTCCACAGG 0: 1
1: 2
2: 2
3: 46
4: 205
1006301620_1006301631 28 Left 1006301620 6:33196456-33196478 CCCCCAGGACCCTCAACGCCCTG 0: 1
1: 0
2: 1
3: 27
4: 214
Right 1006301631 6:33196507-33196529 GCCTCCAGGATCCTGTCCACAGG 0: 1
1: 2
2: 2
3: 46
4: 205
1006301626_1006301631 18 Left 1006301626 6:33196466-33196488 CCTCAACGCCCTGGTCACTCTTC 0: 1
1: 0
2: 1
3: 9
4: 145
Right 1006301631 6:33196507-33196529 GCCTCCAGGATCCTGTCCACAGG 0: 1
1: 2
2: 2
3: 46
4: 205
1006301621_1006301631 27 Left 1006301621 6:33196457-33196479 CCCCAGGACCCTCAACGCCCTGG 0: 1
1: 0
2: 0
3: 13
4: 205
Right 1006301631 6:33196507-33196529 GCCTCCAGGATCCTGTCCACAGG 0: 1
1: 2
2: 2
3: 46
4: 205
1006301628_1006301631 9 Left 1006301628 6:33196475-33196497 CCTGGTCACTCTTCTGTTCCACA 0: 1
1: 0
2: 2
3: 18
4: 246
Right 1006301631 6:33196507-33196529 GCCTCCAGGATCCTGTCCACAGG 0: 1
1: 2
2: 2
3: 46
4: 205
1006301629_1006301631 -9 Left 1006301629 6:33196493-33196515 CCACAGCAAGCTCTGCCTCCAGG 0: 1
1: 3
2: 143
3: 1234
4: 2893
Right 1006301631 6:33196507-33196529 GCCTCCAGGATCCTGTCCACAGG 0: 1
1: 2
2: 2
3: 46
4: 205
1006301627_1006301631 10 Left 1006301627 6:33196474-33196496 CCCTGGTCACTCTTCTGTTCCAC 0: 1
1: 0
2: 1
3: 12
4: 286
Right 1006301631 6:33196507-33196529 GCCTCCAGGATCCTGTCCACAGG 0: 1
1: 2
2: 2
3: 46
4: 205
1006301623_1006301631 26 Left 1006301623 6:33196458-33196480 CCCAGGACCCTCAACGCCCTGGT 0: 1
1: 0
2: 0
3: 11
4: 121
Right 1006301631 6:33196507-33196529 GCCTCCAGGATCCTGTCCACAGG 0: 1
1: 2
2: 2
3: 46
4: 205
1006301624_1006301631 25 Left 1006301624 6:33196459-33196481 CCAGGACCCTCAACGCCCTGGTC 0: 1
1: 0
2: 1
3: 8
4: 125
Right 1006301631 6:33196507-33196529 GCCTCCAGGATCCTGTCCACAGG 0: 1
1: 2
2: 2
3: 46
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006301631 Original CRISPR GCCTCCAGGATCCTGTCCAC AGG Exonic
900503831 1:3019405-3019427 GCCTCCCAGATCCTGTCCCAGGG + Intergenic
900786397 1:4653258-4653280 GCCTCCAGGATCTTTGCCAACGG - Intergenic
900841248 1:5050316-5050338 GCCTGCAGGATCCTCCCCACTGG + Intergenic
901207171 1:7503896-7503918 GCCTCCATGCTTCTGTCCCCTGG - Intronic
901375808 1:8838583-8838605 GCCCCCAGGATGCTTTACACTGG + Intergenic
902051344 1:13565886-13565908 GCCTGCAGGATCCTCCCCGCTGG + Intergenic
902135329 1:14300177-14300199 CCCTGCAGGATCCTGTCCTAGGG - Intergenic
904048092 1:27621509-27621531 GACTCCAGGGTCCTGTCCATAGG + Intronic
905913244 1:41668199-41668221 GCCTGAAGGATCCTGTGCTCAGG + Intronic
907504758 1:54909968-54909990 GCCTGCAGGATCCTTCCCACTGG - Intergenic
907526035 1:55054658-55054680 GCCTCCAGTCTCCAGGCCACTGG + Intronic
907657938 1:56363671-56363693 GCATCCAGCTTCCTGTCCTCTGG - Intergenic
911086346 1:93980503-93980525 GCCTGCAGGCCCCTGTGCACTGG - Intergenic
912965087 1:114230199-114230221 GCCTCTAGAATCCTTTCCAGAGG - Intergenic
916503974 1:165411007-165411029 GCTTCTAGAATCCTCTCCACAGG + Exonic
919659647 1:200231309-200231331 TCCTCTTGGAACCTGTCCACAGG + Intergenic
921520455 1:216149851-216149873 GCCTGCAGGATCCTCCCCACTGG + Intronic
922535502 1:226377554-226377576 GACTCCAGGATTCAGTCCTCAGG - Intronic
922541133 1:226420776-226420798 GCCTCTTGGGTCATGTCCACTGG - Intergenic
1062936688 10:1395594-1395616 GCCTCCAGGTTCCAGTGCAGGGG + Intronic
1063211913 10:3888325-3888347 GCCTTCAGGACCTTGTCCTCCGG - Intergenic
1063450486 10:6146999-6147021 GCCTCCAAGAGCCTGTGCCCTGG - Intronic
1065610670 10:27468132-27468154 GCCTGCAGGATCCTCCCCACTGG + Intergenic
1067014277 10:42744904-42744926 CCCCCCAGGATCATGTCCATAGG - Intergenic
1069897830 10:71689808-71689830 GATTCCAGGAACCTGTGCACCGG + Intronic
1072026703 10:91467192-91467214 GCCTCCGGAATCCTGGCAACAGG + Intronic
1074366602 10:112862530-112862552 GGCTCCTGGATCCTGTAGACAGG - Intergenic
1074457331 10:113606685-113606707 AGCCCCAGGATCCTTTCCACAGG + Intronic
1075147980 10:119898938-119898960 GCCTCCAGGATCTTTGCCACCGG + Exonic
1076157059 10:128212218-128212240 TCCTCCAAGATGCTGTCCTCGGG - Intergenic
1076535000 10:131171334-131171356 GCTTCCAGGACCCTGACCCCGGG - Intronic
1076790944 10:132776404-132776426 GCCCCCCGGACCCTGCCCACAGG - Intronic
1077077082 11:706724-706746 GCCTCCTGGCTCCGGCCCACAGG - Exonic
1077141484 11:1026780-1026802 GCCTCCAGCTGCCTGGCCACAGG + Intronic
1077240876 11:1509978-1510000 ACCTCCAGGTCCCTGCCCACTGG - Intergenic
1078415067 11:11158053-11158075 GCCTCCAAGATCCTGTTGGCAGG + Intergenic
1080936782 11:36871687-36871709 GCTGCCTGGCTCCTGTCCACTGG + Intergenic
1081695841 11:45108573-45108595 GCCTCTGGAATCCTGTCCAAGGG - Intronic
1082175170 11:49049912-49049934 GCCTCCAGGATGCCCTCCTCCGG + Intergenic
1083822829 11:65182334-65182356 GCCTCTTTGATCCTGTTCACAGG - Intronic
1083943591 11:65911760-65911782 GCCTCCAGGCTCCTGCCCTCTGG - Intergenic
1084177025 11:67428296-67428318 GCCTGCAGAATCCTTTCCGCAGG - Intergenic
1084397761 11:68924818-68924840 TGCCCCAGGATCCTGGCCACTGG - Intronic
1084492489 11:69486413-69486435 GCCTCCAGGTTCATCTCCCCAGG + Intergenic
1084750516 11:71201878-71201900 GCCTCCCGGAACCTGCCCAGTGG + Intronic
1085430802 11:76445759-76445781 GCCTCCAAGATCCTGTCGGGAGG + Intronic
1086583073 11:88421691-88421713 GCCTCCAGGAACCTGAAAACTGG + Intergenic
1087167587 11:95020640-95020662 ACCTGCAGGATCCTCCCCACTGG - Intergenic
1087197380 11:95314975-95314997 GCCTGCAGGATCCTCCCCACTGG + Intergenic
1088139017 11:106593116-106593138 ACCTCCAGGACCCAGTCCTCAGG - Intergenic
1088729942 11:112671524-112671546 GCCTCCAGGAGCCTCTCCCCAGG - Intergenic
1089953834 11:122552795-122552817 ACCTGCAGGATCCTCCCCACTGG + Intergenic
1090011230 11:123047568-123047590 GCTGCCAGGATCCTGGCGACTGG + Intergenic
1090666862 11:128920179-128920201 GCCTGAAGGATCCTGTCCCCAGG + Exonic
1091294522 11:134464346-134464368 GACTGCAGGATCCTGATCACGGG - Intergenic
1091410702 12:237376-237398 GCCTCCAGGCTCTTGTCCAAAGG + Intronic
1091897303 12:4115892-4115914 GCCTCCTGGTTTCTGCCCACTGG - Intergenic
1092139574 12:6173707-6173729 GCTTCCAGGTTCAAGTCCACGGG + Intergenic
1092210124 12:6640350-6640372 GCCTCCCAGAGCCTGTCCATCGG - Exonic
1093358961 12:18200867-18200889 GCCTACAGGATCCTCCCCACTGG + Intronic
1093575378 12:20721832-20721854 GCCACCAGGCTCCTACCCACTGG - Exonic
1094826251 12:34271400-34271422 GCCTGCAGGATCCTCCCCACTGG + Intergenic
1095806265 12:46323975-46323997 GCCTGCAGGATCCTACCCACTGG - Intergenic
1097993656 12:65863673-65863695 ACCTCCAAGATCCTGTCCATGGG - Intronic
1102185922 12:110948714-110948736 GCCTCCAAATTCATGTCCACTGG - Intergenic
1102689909 12:114752134-114752156 GCCTCCAGGATCATGTAAAGGGG - Intergenic
1104179307 12:126363033-126363055 GCCTCCAGGCTCCAGTCAATGGG + Intergenic
1106618178 13:31349802-31349824 GCCTCCAGGATCGTGGCCAAAGG - Intergenic
1107616004 13:42168940-42168962 GCCTTCCTGATCTTGTCCACTGG + Intronic
1108120772 13:47183713-47183735 CCTTACAGGATCCTGACCACAGG - Intergenic
1108854456 13:54775624-54775646 GCCTGCAGGTTCCCCTCCACGGG - Intergenic
1111125384 13:83907336-83907358 GCCTCCAGGGCCCTGTGGACAGG + Intergenic
1115514137 14:34168287-34168309 CCCTCCAGCATCCTGTGCTCTGG + Intronic
1118068975 14:62224188-62224210 ACCTCCAGGATCCTAGCCACAGG - Intergenic
1121192785 14:92044810-92044832 GCCTGCAGGATCCTCCCCACTGG - Exonic
1121389502 14:93562159-93562181 ACCTGCAGGATCCTCCCCACTGG - Intronic
1122038382 14:98964715-98964737 GCCTCCATTCTCCTCTCCACTGG + Intergenic
1122041387 14:98990106-98990128 GCCTGCAGGATCCTCCCCACTGG + Intergenic
1122217091 14:100211813-100211835 TGCTCCAGGATCCTCTCCGCAGG + Intergenic
1122722450 14:103729905-103729927 GCCACCTGGCTTCTGTCCACGGG + Intronic
1122975736 14:105170015-105170037 TCCTCCAGGATCCAGGCCGCAGG + Intergenic
1124653717 15:31490722-31490744 ACCTGCAGGCTCCTCTCCACAGG + Intronic
1124687813 15:31797513-31797535 GCCTCCTGGAGCTTGTCCTCTGG - Intronic
1126941256 15:53768201-53768223 GTCTCCAGTATCCTGTACAGGGG - Intergenic
1129164662 15:73769714-73769736 GCCTCCAGGCTCCTGGCAACTGG - Intergenic
1131459784 15:92609935-92609957 GGCTCTAGGATCTTGTCCAGAGG + Intergenic
1132497253 16:269696-269718 GCCTCCAGCACCCTGTCCGCCGG - Intronic
1132887753 16:2189924-2189946 GCCTCCAGGACCCTGATCCCAGG + Intronic
1133392951 16:5423843-5423865 GCCTCAATGAGCCTGGCCACTGG - Intergenic
1133745884 16:8686378-8686400 CCCTCCTGGAACCTGTCCCCAGG - Intronic
1135532901 16:23269823-23269845 GCTTCCAGGTTCCTGTCCACTGG + Intergenic
1135760990 16:25137898-25137920 GCCCCCATCATGCTGTCCACAGG + Intronic
1136497410 16:30652770-30652792 ACCATCAGGATCCTGTCCACAGG + Exonic
1138170343 16:54843644-54843666 GCCTATAGGATCCTGTTCACCGG + Intergenic
1141762693 16:86039055-86039077 CCCTCCAGGCTCCTGCACACTGG - Intergenic
1141851595 16:86649920-86649942 TCCTCCAGGATCCTCTCCCGGGG + Intergenic
1142172182 16:88628586-88628608 GCCTCCAGGACCCGGACCAAGGG - Intronic
1143309213 17:5974697-5974719 TCCACCAGGATCCTGGCCTCAGG + Intronic
1144489967 17:15700105-15700127 GCCTCAGGGATGCTGTCCCCGGG + Exonic
1144910994 17:18681854-18681876 GCCTCAGGGATGCTGTCCCCGGG - Intronic
1147531711 17:41284822-41284844 GCCTCCAGGCAACTGCCCACAGG - Intergenic
1152353203 17:79794771-79794793 TCCCCCAGGATTCTGGCCACAGG + Exonic
1153424328 18:4945538-4945560 GCCTCTTGGAGCCTCTCCACAGG - Intergenic
1153914478 18:9733630-9733652 CCCTCCAGGATTCGGTCCACAGG + Intronic
1156326715 18:36080056-36080078 GCCTCCAACATCCTGGCAACTGG + Intergenic
1156916294 18:42467079-42467101 GCCTGCAGGATCCTCCCCACTGG + Intergenic
1156923643 18:42553161-42553183 GCCTGCAGGATCCTCCCCACTGG - Intergenic
1157607840 18:48937408-48937430 GCCTCACGCATCCTGTCCCCAGG - Intronic
1158394256 18:57067430-57067452 GCCTGCAGGATCCTCCCCACTGG - Intergenic
1160205121 18:76825029-76825051 TCCTCCAGGATCCTGTTGATCGG + Intronic
1160418470 18:78728014-78728036 GCCACCAGGATTCTGACCAGAGG + Intergenic
1161089448 19:2352757-2352779 GCACCCAGGACCCTGTCCATCGG - Intronic
1161319375 19:3633913-3633935 GCTTCCAGGAGCCTGTGCGCTGG - Intronic
1162099831 19:8333142-8333164 CCTTCCAGCATCCTGGCCACGGG + Exonic
1163265344 19:16217433-16217455 GCCTGCAGGTTCTTGCCCACAGG - Intronic
1163439765 19:17316189-17316211 GCCTCCAGCCTCCTGAGCACTGG - Intronic
1163899688 19:20090491-20090513 GCCTGCAGGATCCTCCCCACTGG - Intronic
1164153441 19:22573707-22573729 GCCTGCAGGATCCTCCCCACTGG + Intergenic
1164507894 19:28874464-28874486 CCCCCCAGCATCCAGTCCACTGG - Intergenic
1164801228 19:31078460-31078482 GCCACCAGGAGCCAGTCCAATGG - Intergenic
1165110328 19:33498593-33498615 GCCTCCAGGACCCTGTCTCAAGG - Intronic
1165110362 19:33498725-33498747 GCCTCCAGGACCCTGTCTCAAGG - Intronic
1165110376 19:33498769-33498791 GCCTCCAGGACCCTGTCTCGAGG - Intronic
1165110385 19:33498813-33498835 GACTCCAGGATCCTGTCTCAAGG - Intronic
1165110397 19:33498857-33498879 GCCTCCAGGACCCTGTCTCAGGG - Intronic
1166397135 19:42449726-42449748 GCCTGCAGGATCCTCCCCATTGG - Intergenic
1168126267 19:54285348-54285370 GCCCTTAGGATCCTGCCCACAGG + Intergenic
925096243 2:1206338-1206360 GCCTCCAGCATCCTCTCCTTAGG - Intronic
925920274 2:8633358-8633380 GCCTCCAATTTCCTGTCCAGGGG + Intergenic
926336799 2:11869568-11869590 GCCTTCAGGATCCTGTTTACTGG + Intergenic
926861795 2:17317598-17317620 TCCACCAGGATCCTGTGCCCTGG - Intergenic
929757333 2:44778578-44778600 GCCTCCAGGGGCCTGTGCAGAGG + Intergenic
930144518 2:47987800-47987822 GCCTCCAGAATCCTGGGAACAGG - Intergenic
934870297 2:97858704-97858726 GCCTCCAGGTTCCTTCTCACGGG - Intronic
935199061 2:100840173-100840195 GCTTCTAAGATCCTGCCCACAGG + Intronic
935206557 2:100901547-100901569 GTCTGCAGGATCCTCTGCACAGG - Intronic
936327918 2:111521752-111521774 GCCTCCGGCATCCTGGCCTCCGG - Intergenic
936837551 2:116726714-116726736 GCCTCCTGGATACTTCCCACAGG - Intergenic
939134968 2:138282686-138282708 GCATCCAGCATCCTGCCTACAGG - Intergenic
939505199 2:143037167-143037189 GCCACCAGGTTCCTGGCCTCAGG - Intronic
940183421 2:150958512-150958534 GCCTGCAGGATCCTCCCCACTGG + Intergenic
940253745 2:151707655-151707677 CCCATCAGGAGCCTGTCCACAGG + Intronic
940707838 2:157126453-157126475 GCCTCCAGGAGCCCATCCTCAGG - Intergenic
941455672 2:165710365-165710387 GCCTGCAGAATCCTCCCCACTGG - Intergenic
942208580 2:173648159-173648181 GCCTCCAGGCTGCTGTGTACAGG - Intergenic
942603679 2:177667698-177667720 CCCTCAAGGATCTTGTCAACTGG - Intronic
943412466 2:187560725-187560747 GCCTGCAGGATCCTCCCCACTGG - Intronic
943784316 2:191860241-191860263 GCCTCCAGGATCCCCACCGCTGG - Intergenic
945516445 2:210768448-210768470 CCCTCCAGGATCATGTGAACTGG + Intergenic
947490876 2:230593591-230593613 GCCTCTGGGATCCTAGCCACAGG + Intergenic
948222821 2:236287116-236287138 GCCTCCTAAATCCTGTCCATGGG + Intergenic
948706664 2:239798054-239798076 CTCTCCAGGATCCTGACCCCTGG + Intronic
948846237 2:240684032-240684054 GCAGCATGGATCCTGTCCACTGG + Intergenic
948875855 2:240827594-240827616 GCTTCCAGGACCCTCTCCTCAGG - Intergenic
1176385972 21:6138688-6138710 GCGTCCAGGGTTCTGGCCACAGG - Intergenic
1178289277 21:31353087-31353109 GCCTCCAGCATACTGTGCAAGGG - Intronic
1179134856 21:38670348-38670370 TCCTCCTGGATCAGGTCCACGGG - Intergenic
1179287227 21:39988020-39988042 CACACCTGGATCCTGTCCACAGG - Intergenic
1179665038 21:42905329-42905351 GCTTTCAGCATCCTGTGCACAGG + Intronic
1179737501 21:43399564-43399586 GCGTCCAGGGTTCTGGCCACAGG + Intergenic
1181268215 22:21643215-21643237 TCCGCCAGGATCCTGCCCTCAGG + Intronic
1181579053 22:23816886-23816908 TCCTCCAGGATGCTGTCCGTGGG - Exonic
1183628758 22:39020744-39020766 GACTCCCGGATCCTGCCCTCGGG - Intronic
1183632235 22:39040503-39040525 GACTCCCGGATCCTGCCCTCGGG - Intergenic
1183633513 22:39047291-39047313 GACTCCTGGATCCTGCCCTCAGG - Intronic
1183638057 22:39076904-39076926 GACTCCCGGATCCTGCCCTCGGG - Intronic
1184932566 22:47692057-47692079 GCCTCCATGATCCTGTGAGCTGG + Intergenic
949671555 3:6402582-6402604 GCCTGCAGGATCCTCCCCACTGG + Intergenic
951888850 3:27550829-27550851 ACCTGCAGGATCCTCCCCACCGG - Intergenic
952554315 3:34514603-34514625 GCCTCCAGGATCATGTTGAGGGG - Intergenic
953784250 3:45898533-45898555 GCCTCCAGGATCCTGCTCCTGGG + Intronic
955539455 3:59959050-59959072 ACCTCCAGGGTCCTCTCCCCTGG + Intronic
958542077 3:95490919-95490941 CCCTCTAGGATCTTGTTCACAGG + Intergenic
959196384 3:103188203-103188225 GGGCCCAGGATGCTGTCCACAGG + Intergenic
960988290 3:123294683-123294705 TGGTCCAGGATCCTGTGCACAGG - Intronic
962886445 3:139632363-139632385 ACCACCATGATCCTGTCAACAGG + Intronic
962947128 3:140182431-140182453 GCCTTCAGGATCATGGGCACAGG + Intronic
963320266 3:143803131-143803153 ACCTGCAGGATCCTCCCCACTGG + Intronic
965335619 3:167428432-167428454 ACCTGCAGGATCCTCCCCACTGG + Intergenic
967768144 3:193305005-193305027 GCCCCCATGATCCAGTCAACAGG + Intronic
968618327 4:1592462-1592484 GCCTCCGGGATCCTGCCCCCTGG - Intergenic
969574660 4:8029983-8030005 GCCTGCTGGATCCTTGCCACAGG + Intronic
971342124 4:25780324-25780346 TCCTCCTGGATCCTGCCTACCGG - Intronic
972670882 4:41213725-41213747 GACTCCAGGAAACTGGCCACTGG - Intronic
978734232 4:112067030-112067052 GTCTCCAGGATCCTACCCAAAGG - Intergenic
982317244 4:154044185-154044207 GCCTCCAGGGTCCTGGCCACGGG - Intergenic
985577338 5:679427-679449 ACCCCCAGGATCCTGCCCCCAGG - Intronic
985800172 5:2000777-2000799 CCCTCCAAAATCCTGTCCAGAGG + Intergenic
986300212 5:6472472-6472494 GCCTCTAGGGTCCTGTCAAGGGG - Intronic
986368462 5:7058184-7058206 GCCTGCAGGATCCTCCCCACTGG - Intergenic
988663856 5:33303263-33303285 GCCTGAAGGATGCTGTCCAAAGG + Intergenic
989555239 5:42787212-42787234 GCCTCCATGATCCAGTAGACTGG + Intronic
992158175 5:73975114-73975136 GACTTCTGGATCCTGTCCTCAGG + Intergenic
992858216 5:80885809-80885831 GCCTTCTGGCTCTTGTCCACAGG + Intergenic
996358227 5:122619685-122619707 GCCTGCAGGATCCTCCCCACTGG - Intergenic
1000297023 5:159921065-159921087 CCCTACAGGATCCTGTTCAGGGG + Intronic
1001640685 5:173242251-173242273 GCCACCAGGGTCCTGTTCCCAGG - Intergenic
1002857109 6:1047826-1047848 CCCTCCAGGAAACTGACCACAGG + Intergenic
1004963889 6:20824780-20824802 GCCTCCAGAATCCTGACTCCTGG - Intronic
1006301631 6:33196507-33196529 GCCTCCAGGATCCTGTCCACAGG + Exonic
1006741596 6:36312888-36312910 CTCCCCAGGATCCTGTCCAAGGG + Intergenic
1006926655 6:37659221-37659243 GCTCCCGGGTTCCTGTCCACAGG + Intronic
1009343716 6:62588971-62588993 GCCTGCAGGATCCTCCCCACTGG + Intergenic
1010586228 6:77660796-77660818 GCCTGCAGGATCCTCCCCACTGG - Intergenic
1010967399 6:82227225-82227247 CCCTCCAGGACCATGACCACAGG + Exonic
1015258336 6:131205444-131205466 GCTTCCGGGGTCCTGTCCTCTGG + Intronic
1015636082 6:135275766-135275788 GCCTCCAGGATCCACTCCTGTGG - Intergenic
1015878068 6:137844376-137844398 GCCTGTTGGATCCTGGCCACGGG + Intergenic
1016204945 6:141457936-141457958 GCCTGCAGGATCCTCCCCACTGG + Intergenic
1023416381 7:39937028-39937050 ACCTCCAGCAGCCTGTGCACGGG + Intergenic
1026853504 7:73738743-73738765 GCCTCCAGGCTCGGGTCCAGCGG + Exonic
1027948499 7:84781061-84781083 ACCTCCAGAATCCTGGCAACAGG - Intergenic
1029466231 7:100726707-100726729 GCCCCCAGGAGGCTGCCCACTGG - Intergenic
1031036656 7:116794747-116794769 CCCCCCTGGGTCCTGTCCACAGG + Intronic
1031589681 7:123574406-123574428 GCCTCCCTGATCCTATCCCCAGG + Intronic
1033604642 7:142917733-142917755 GCCTCCAGCACTCTGTCCCCGGG + Intronic
1034016398 7:147591744-147591766 GCCTTCAGGATAATGTCCACTGG + Intronic
1034141680 7:148824496-148824518 GCCTCCAGTATCCAGTACAGTGG + Intronic
1034692078 7:153021881-153021903 GCCTCCAGGTCCCTGTCCTTAGG - Intergenic
1035012604 7:155732944-155732966 GCCTTCAGGAGCCTGGCCACAGG + Intronic
1038088837 8:24230885-24230907 GCCTTCAACATTCTGTCCACTGG - Intergenic
1039236720 8:35510042-35510064 GCCTCCAGGTTGCTGGACACTGG - Intronic
1040383201 8:46893052-46893074 TCTTCCAGGGTCCTGCCCACAGG - Intergenic
1041208849 8:55525919-55525941 GCCCCCAGGAACCTGGCCAGGGG + Exonic
1042965816 8:74350681-74350703 GCCTCCAGTGTCCTGACCCCGGG + Intronic
1045645178 8:104290842-104290864 GCCTGCAGGATCCTCCCCACTGG + Intergenic
1048925906 8:139271043-139271065 CCCTCCAGGATCCAGTCTAGGGG - Intergenic
1049660965 8:143819562-143819584 GCTTCCAGGCCCCTCTCCACGGG - Intronic
1050045594 9:1541558-1541580 GCCTGCAGGAACCTGTACAACGG - Intergenic
1050203785 9:3176807-3176829 GCCTTCAGGATCCTGTCCACAGG + Intergenic
1050239915 9:3624315-3624337 GCCTTCAGCCTCCTTTCCACTGG + Intergenic
1052357187 9:27517203-27517225 GCCTCCAGGAACCTCTGCAAGGG + Intronic
1052489668 9:29149648-29149670 GCCTCCAGGATCCTAGCTACAGG + Intergenic
1053527535 9:38845153-38845175 GCTTGCAGGAGCCTGGCCACTGG + Intergenic
1054199760 9:62069582-62069604 GCTTGCAGGAGCCTGGCCACTGG + Intergenic
1054638595 9:67518775-67518797 GCTTGCAGGAGCCTGGCCACTGG - Intergenic
1056324353 9:85464110-85464132 GCCTGCAGGATCCTCCCCACTGG + Intergenic
1056822923 9:89856267-89856289 GCCTCTAGGGCCCTGTGCACAGG - Intergenic
1057909010 9:99003942-99003964 GCCTTCAGCATCCTTTCCCCAGG - Intronic
1058979919 9:110159757-110159779 GCCTCTGGGGTCCTGTCCACAGG + Intronic
1059099251 9:111453904-111453926 CCCCCCAGGATCCTGTGCAAGGG - Intronic
1059383116 9:113943822-113943844 CCCTCCACTATCCTGACCACCGG - Intronic
1060583513 9:124771665-124771687 GCCTCCAGGGCCCCGCCCACAGG - Intergenic
1060599982 9:124870862-124870884 GCCTCAAGGAACCTGTCACCAGG - Intronic
1062020134 9:134315506-134315528 GCCTCCAGCCTGCTGTCCTCAGG - Intergenic
1062044088 9:134417238-134417260 GCCTCCAGGATCCTCTCCACCGG - Exonic
1062614666 9:137390976-137390998 GCCTCCAGGACCCTGGGGACGGG - Intronic
1203782912 EBV:110838-110860 GTCTCCAGGATTATGGCCACTGG - Intergenic
1190745001 X:53317339-53317361 GCATCCTGGAACCTGTCCAGAGG + Intronic
1191761810 X:64654805-64654827 ACCTGCAGGATCCTCCCCACTGG + Intergenic
1193425522 X:81337265-81337287 GCCTCTATGAGCCTGTCCCCAGG + Intergenic
1197533509 X:127661574-127661596 ACCTCCAGGATCCCGGCTACAGG + Intergenic
1199924259 X:152446037-152446059 CCCTCCAGGCTCATGTCCACAGG - Intronic
1200156928 X:153981776-153981798 GCCTCCATGTTCCTGACCCCCGG - Intronic
1201233791 Y:11891168-11891190 GCCTTCAGGATACTCCCCACTGG - Intergenic
1201937607 Y:19424873-19424895 GCCTGCAGTATCCTCCCCACTGG + Intergenic