ID: 1006301635

View in Genome Browser
Species Human (GRCh38)
Location 6:33196518-33196540
Sequence CCTGTCCACAGGCATCTCCT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 311}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006301625_1006301635 30 Left 1006301625 6:33196465-33196487 CCCTCAACGCCCTGGTCACTCTT 0: 1
1: 0
2: 2
3: 12
4: 119
Right 1006301635 6:33196518-33196540 CCTGTCCACAGGCATCTCCTCGG 0: 1
1: 0
2: 3
3: 28
4: 311
1006301628_1006301635 20 Left 1006301628 6:33196475-33196497 CCTGGTCACTCTTCTGTTCCACA 0: 1
1: 0
2: 2
3: 18
4: 246
Right 1006301635 6:33196518-33196540 CCTGTCCACAGGCATCTCCTCGG 0: 1
1: 0
2: 3
3: 28
4: 311
1006301629_1006301635 2 Left 1006301629 6:33196493-33196515 CCACAGCAAGCTCTGCCTCCAGG 0: 1
1: 3
2: 143
3: 1234
4: 2893
Right 1006301635 6:33196518-33196540 CCTGTCCACAGGCATCTCCTCGG 0: 1
1: 0
2: 3
3: 28
4: 311
1006301626_1006301635 29 Left 1006301626 6:33196466-33196488 CCTCAACGCCCTGGTCACTCTTC 0: 1
1: 0
2: 1
3: 9
4: 145
Right 1006301635 6:33196518-33196540 CCTGTCCACAGGCATCTCCTCGG 0: 1
1: 0
2: 3
3: 28
4: 311
1006301627_1006301635 21 Left 1006301627 6:33196474-33196496 CCCTGGTCACTCTTCTGTTCCAC 0: 1
1: 0
2: 1
3: 12
4: 286
Right 1006301635 6:33196518-33196540 CCTGTCCACAGGCATCTCCTCGG 0: 1
1: 0
2: 3
3: 28
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006301635 Original CRISPR CCTGTCCACAGGCATCTCCT CGG Exonic
900086915 1:903072-903094 CTTCTCCAGAGGCCTCTCCTTGG + Intergenic
900308218 1:2021249-2021271 CCTGTCCACACACATGTGCTGGG + Intronic
900311409 1:2035237-2035259 CCAGTCTGCAGGCATCTCCACGG + Intergenic
900402382 1:2477904-2477926 CCTGGCCACAGGTGGCTCCTGGG - Intronic
900739870 1:4324244-4324266 CCGGTCCCCAGGCATCCTCTGGG - Intergenic
901661892 1:10803906-10803928 CCTATCCACACACATCTCCCAGG - Intergenic
902288151 1:15419768-15419790 GCTGGAAACAGGCATCTCCTGGG - Intronic
902464576 1:16608093-16608115 CCTGTCCACCTGCATCCCCCAGG - Intronic
903080217 1:20804956-20804978 CCTGACCACAGGCTTTGCCTGGG - Intergenic
903156231 1:21445612-21445634 CCTGTCCACCTGCATCCCCCAGG + Intronic
903231718 1:21926371-21926393 TCTGTCCCCAGGAAACTCCTGGG + Intronic
903816387 1:26067195-26067217 CCTGTCCAGAGGCCTCTGCAGGG + Intronic
904931383 1:34090164-34090186 ACTGTGCACACGCATCACCTGGG + Intronic
905787272 1:40768331-40768353 CCTGCCCTCAGGCATCTTATAGG + Intronic
905944428 1:41889790-41889812 CCTATCCAGAGCCATCACCTTGG - Intronic
906674636 1:47684358-47684380 CATGACCACAAGCATGTCCTTGG + Intergenic
908354358 1:63316843-63316865 CCTGTCCACAGCCCTGTCCCGGG + Intergenic
908423290 1:63980665-63980687 TCTGTCTACAGGCATCTCAATGG + Intronic
912473811 1:109923533-109923555 CCTCTCCAGAGGCTTCTTCTGGG - Exonic
912498382 1:110106043-110106065 CCTGATCACAGGCTTCACCTGGG - Intergenic
912595927 1:110875645-110875667 CCTGTCCTCAGGAAGCTCCTAGG + Intronic
913123967 1:115768240-115768262 CCTGGCCAAAGGCATTCCCTCGG + Intronic
913276134 1:117139938-117139960 CTTGTGCTCACGCATCTCCTTGG - Intergenic
913380490 1:118204885-118204907 ACTGTCCACATACTTCTCCTTGG - Intergenic
913600879 1:120420514-120420536 CCTGTCCACCCGCATCCCCCAGG + Intergenic
914086176 1:144456119-144456141 CCTGTCCACCCGCATCCCCCAGG - Intronic
914192070 1:145420070-145420092 CCTGTCCACCCGCATCCCCCAGG - Intergenic
914362015 1:146943956-146943978 CCTGTCCACCCGCATCCCCCAGG + Intronic
914464093 1:147910716-147910738 TCTGCTCACAGGCATGTCCTGGG + Intergenic
914489610 1:148142999-148143021 CCTGTCCACCCGCATCCCCCAGG - Intronic
914589977 1:149098020-149098042 CCTGTCCACCTGCATCCCCCAGG - Intronic
915562347 1:156694527-156694549 CCTGCTCTCAGGGATCTCCTGGG + Intergenic
915726049 1:158018408-158018430 CCTGCCCACAGGTCTCTCCCGGG - Intronic
917394938 1:174583338-174583360 CCTGCCCATCTGCATCTCCTAGG + Intronic
917534201 1:175862917-175862939 CCTGGCTACAGGCCTGTCCTTGG - Intergenic
918515520 1:185358795-185358817 CCTGTCTGCTGGCCTCTCCTAGG + Intergenic
919741735 1:200985013-200985035 CCTGCCCACAGGCCCCTACTTGG + Intronic
919820843 1:201470883-201470905 CCACTCCACAGGGGTCTCCTGGG + Intergenic
920263906 1:204707766-204707788 CTTGTCCCCAGGCATCTGCAAGG + Intergenic
920277023 1:204814014-204814036 ACTGTCCACAAGCCTTTCCTGGG + Intergenic
920438376 1:205962735-205962757 CCTGTCCACAGGCAGATACCTGG + Intergenic
920710562 1:208290712-208290734 GCTATCCTCAGGCTTCTCCTAGG + Intergenic
920769200 1:208864746-208864768 TCTGGCCACAGGCATTTCCTTGG + Intergenic
921208987 1:212876112-212876134 CCTGACCTCAGGCATCACCTAGG + Intronic
922364397 1:224850560-224850582 CCTAACCACAGGCATCCCATTGG + Intergenic
922571838 1:226638989-226639011 CCTGGCCCCAGGCTTCTGCTTGG - Intronic
922781528 1:228256669-228256691 CCTGTGCACTGGCTGCTCCTTGG - Exonic
923685109 1:236148260-236148282 TCTGTGCCCAGGCAGCTCCTGGG + Intronic
1063461332 10:6216553-6216575 CCTGCCCACAGTCCTCTCCAGGG - Intronic
1064458289 10:15508747-15508769 CCTGCCCACAGACATCGCCATGG - Intergenic
1064562798 10:16609284-16609306 CCTAGCCAGAGGCAGCTCCTAGG - Intronic
1064707307 10:18086323-18086345 CCAGCTCACAGGCATCTTCTGGG - Intergenic
1067180510 10:43982350-43982372 CCTGTCTACTGGCTGCTCCTTGG + Intergenic
1067458107 10:46437996-46438018 CCTGTCTTCAGACTTCTCCTTGG + Intergenic
1067629089 10:47946638-47946660 CCTGTCTTCAGACTTCTCCTTGG - Intergenic
1068803706 10:61171160-61171182 CCAGAGCACAGGCATCTCTTTGG - Intergenic
1069750786 10:70743939-70743961 CCTGTCCAGGGACATCTCCCAGG + Intronic
1072473781 10:95738527-95738549 CCTGACCACACACAACTCCTTGG - Intronic
1072523885 10:96254459-96254481 GCTGTACACAGTCAGCTCCTCGG - Intronic
1073205808 10:101768754-101768776 TCTGTCCATTGGCATCTCCTGGG - Intergenic
1073544088 10:104334643-104334665 CCTGGCTATGGGCATCTCCTTGG - Intronic
1074944744 10:118270561-118270583 CCTGTCTCCAGGCATATCCGAGG + Intergenic
1076190578 10:128480577-128480599 TCTGTACACAGGCAGCTCCTTGG + Intergenic
1076220799 10:128731696-128731718 ACGGTCCCCAGTCATCTCCTTGG - Intergenic
1076868712 10:133182265-133182287 CCTGGCCCCAGGCCTCTCCCTGG - Intronic
1077015293 11:396597-396619 CCTCTCCACAGGCACATCCAGGG + Exonic
1077024788 11:434230-434252 CCCGCCTACAGCCATCTCCTCGG - Intronic
1077248113 11:1548842-1548864 CCTGTCCCCAGGCAGCTCCCAGG - Intergenic
1077373029 11:2192534-2192556 CCTGCCCACGGGCATGCCCTCGG - Intergenic
1078241118 11:9531426-9531448 CCTGCCCACAGGCATCTGTGAGG + Intergenic
1079312021 11:19375335-19375357 CCTGTGCCCAGCCATCTTCTGGG - Intronic
1080770029 11:35332051-35332073 TCTGTCCAAAGCCATCTCCATGG - Intronic
1081621794 11:44623086-44623108 CTAGCCAACAGGCATCTCCTGGG + Intergenic
1083099284 11:60286021-60286043 GCTGTCCATAGGCACCCCCTGGG + Intronic
1083679981 11:64347120-64347142 CATGTTTACAGGCATCTTCTTGG + Intronic
1084434727 11:69132129-69132151 CCTCTCCACAGTCCCCTCCTGGG - Intergenic
1087917861 11:103831311-103831333 CCTGTCCACTGGCCTCTCCTAGG + Intergenic
1090621249 11:128562842-128562864 ACTGCCCACAGTCATCTCCCTGG + Intronic
1090808154 11:130215715-130215737 TCTATACACAGGCTTCTCCTTGG - Intergenic
1090996584 11:131871662-131871684 CCTCTCTCCATGCATCTCCTTGG - Intronic
1091395557 12:152318-152340 TGTGTCCACGGGCTTCTCCTTGG + Intronic
1092298461 12:7222155-7222177 GCAGGCCACAGGCATCTGCTGGG - Intergenic
1096069393 12:48766541-48766563 CCTGTCCCCAGCCATATCCCTGG - Exonic
1097161320 12:57048475-57048497 CTGGTCCAGAGGCCTCTCCTAGG - Intronic
1101943933 12:109121626-109121648 CCTGGGCACAGGCATCTGCACGG - Intronic
1103320845 12:120092207-120092229 CCTGTCCACAGGCTTCTCTATGG + Intronic
1104035483 12:125094467-125094489 CCTGTCCACTGAGAGCTCCTCGG + Intronic
1104471313 12:129032168-129032190 CCTTTCCGCAGGCAGCTCCCGGG + Intergenic
1107741063 13:43450972-43450994 ACTGTCCACAGGGATCACCCGGG + Intronic
1113203385 13:107890853-107890875 CCTGTACAGAGCCATGTCCTGGG - Intergenic
1113705930 13:112433032-112433054 CCTGGCCCCAGGCTTCTCCTAGG + Intronic
1113893577 13:113749163-113749185 CATGTCCCCAGACACCTCCTGGG - Intergenic
1114187140 14:20411336-20411358 CCTGTGCACAGGCAGATCCCTGG + Intronic
1114482130 14:23042478-23042500 CCTGTGCACCAGCACCTCCTGGG + Exonic
1115780174 14:36760139-36760161 AGTGTCCACATACATCTCCTGGG - Intronic
1115862358 14:37701388-37701410 CAAGTCAACAGGCAGCTCCTGGG - Intronic
1120872529 14:89350671-89350693 CCTGTCCTCAGGCATATCAAAGG - Exonic
1122259114 14:100502055-100502077 CCTGTCCCCAGACAGCTCTTTGG + Intronic
1122386914 14:101355066-101355088 CCTGTGCTCAGACATCTCCTGGG + Intergenic
1122540872 14:102497079-102497101 GGTCCCCACAGGCATCTCCTCGG - Exonic
1122543951 14:102512144-102512166 CATGTCCACAGGAAGCTTCTAGG - Intergenic
1122945490 14:105006770-105006792 GGTGTCCACAGGCACCTCTTGGG - Intronic
1123059462 14:105587943-105587965 CCTGTCCACCACCACCTCCTGGG + Intergenic
1123083797 14:105708213-105708235 CCTGTCCACCACCACCTCCTGGG + Intergenic
1124670437 15:31634101-31634123 CCTGTGCCCAGGTCTCTCCTGGG - Intronic
1125512245 15:40298354-40298376 CCAGTTCTCAGGCCTCTCCTCGG - Exonic
1125609544 15:40961141-40961163 CCTTGCCTCAGGCATTTCCTTGG + Intergenic
1125622836 15:41079791-41079813 CCAGTACAGAAGCATCTCCTTGG + Exonic
1128173394 15:65531961-65531983 CCTCTGAACAGGCATCTGCTTGG + Intronic
1128880766 15:71240546-71240568 AGTGTTCACAGGCATCACCTGGG - Intronic
1130175077 15:81559744-81559766 CCTGGCCCCAAGCAGCTCCTGGG - Intergenic
1130398963 15:83531226-83531248 CCTGTCCCCAGGCATCTCATAGG + Intronic
1132569913 16:639820-639842 GCTGTGCCCAGGCCTCTCCTGGG - Intronic
1132905550 16:2280883-2280905 GCTGTCCAGAGGCATGTGCTGGG + Intronic
1132925101 16:2425163-2425185 CCTGTCCTCTGCCATCTCCATGG + Intergenic
1135762063 16:25145677-25145699 CCAGTCCCCAGGCAACACCTCGG - Intronic
1136639119 16:31546951-31546973 CCTGACCATAGCCAACTCCTAGG + Intergenic
1136665542 16:31808676-31808698 CCTGACCATAGCCAACTCCTTGG - Intergenic
1138800594 16:60023405-60023427 ACATTCCACAGGCATCTGCTGGG + Intergenic
1139062857 16:63275947-63275969 CTTGTATACAGACATCTCCTGGG - Intergenic
1139106752 16:63835554-63835576 CCTGTCTGCTGGCCTCTCCTGGG + Intergenic
1141212437 16:81994044-81994066 CATGTCCACAGTCCACTCCTGGG - Exonic
1141838885 16:86561313-86561335 CCTGGGCCCAGGCATCTGCTCGG - Intergenic
1142438586 16:90078501-90078523 CCTGTCCACTGGCCCCTCCCAGG - Intronic
1144835239 17:18153399-18153421 CCCGGCCACAGGCACCTCCTAGG - Intronic
1144844994 17:18212630-18212652 CCTGTTCCCAGCCATCTCCTAGG + Intergenic
1145241329 17:21242443-21242465 CCAGCCCCAAGGCATCTCCTCGG + Exonic
1146004739 17:29154257-29154279 CCTGTCTACACGCCTCTCCCAGG - Intronic
1146612839 17:34322955-34322977 GCTGCCCCCAGGCTTCTCCTGGG + Intergenic
1147389809 17:40102192-40102214 CTTCTCCACAGGCAGCTCCTGGG + Intergenic
1147964945 17:44189537-44189559 CCTAGCCACAGCCAGCTCCTCGG - Exonic
1148071559 17:44911600-44911622 CTTCTCCCCTGGCATCTCCTGGG + Intronic
1150339303 17:64353496-64353518 CATTTCCACTGGCATCTGCTTGG + Exonic
1150828235 17:68495326-68495348 CCTGGCCCCAGGCTTCTTCTAGG + Intergenic
1151893762 17:76966641-76966663 CCTGCCCTCAGGGAGCTCCTGGG + Intergenic
1152472978 17:80500481-80500503 CCTCCCCACAGGCAGCCCCTGGG - Intergenic
1154493002 18:14935389-14935411 CCTGTCCACAGACTACTCCCTGG + Intergenic
1155070228 18:22308476-22308498 TCTGTCTACAGGCTTTTCCTGGG - Intergenic
1156459327 18:37312858-37312880 CCCTTCCACAGCCATGTCCTTGG - Intronic
1158618254 18:59007451-59007473 CCTGTGCCCTGGCATCTCTTAGG + Intergenic
1158683322 18:59589112-59589134 CCTGTCCACAGGGATCCCCAAGG - Intronic
1160276688 18:77443787-77443809 GCTCTCCAGAGGCATCTTCTGGG + Intergenic
1161323921 19:3653874-3653896 CCTGCCCACAGACATCGCCCTGG + Intronic
1161849988 19:6733190-6733212 CCTGGCCGCTGGCATCTTCTGGG - Exonic
1163698579 19:18776016-18776038 CTGGTCCAGAGGCATCTCCCTGG - Intronic
1165073435 19:33268448-33268470 CCTGGCCACGTGCCTCTCCTTGG - Intergenic
1165225939 19:34355127-34355149 CCTCTCCAAAGGCCTCACCTTGG + Exonic
1167749668 19:51372063-51372085 CTTGTCCCCAGCCATCTCCATGG - Exonic
925378932 2:3410004-3410026 CCTTTCCACCTGCATCTCCCAGG - Intronic
928179378 2:29057205-29057227 CCAGTGCACAGGAATCACCTGGG + Exonic
928200952 2:29247227-29247249 TGTGTGCACAGGCATCTCCGTGG - Intronic
928733433 2:34259334-34259356 CCTTTCCACAGGCATTTATTGGG - Intergenic
928947540 2:36785239-36785261 ACTGTGCACAGGAATCACCTGGG + Intronic
929761447 2:44810810-44810832 CCTGTACCCAGCCATCCCCTGGG - Intergenic
929905537 2:46042836-46042858 CTTGTTCACAGGCACCTCCCTGG + Intronic
932074397 2:68649719-68649741 CCAGTTCAAAGGCCTCTCCTCGG - Intronic
932690967 2:73913474-73913496 TCTGTCCACAGGCATCGTCCTGG + Exonic
932756895 2:74415420-74415442 CCAGTCTAGAGGCCTCTCCTCGG - Exonic
933377787 2:81502170-81502192 CCTATCCACACTCATGTCCTTGG - Intergenic
934651221 2:96092289-96092311 CCTGAAAACAGGCATGTCCTGGG - Intergenic
934934630 2:98455862-98455884 CCTCTCCACTGACATATCCTTGG - Intronic
935595508 2:104874252-104874274 CCTCTCCAGAGGTCTCTCCTGGG - Intergenic
936044492 2:109176096-109176118 TCTGTCCACCTGCATTTCCTGGG + Intronic
936119209 2:109726839-109726861 TCTGTCCACTGGGATCTCCTGGG - Intergenic
936235392 2:110738132-110738154 CCTCTCAACAGGCATCAGCTTGG - Intronic
936283870 2:111165994-111166016 CCTTTCCCCAAGAATCTCCTTGG + Exonic
936811981 2:116413469-116413491 CCTGTCCACTTGCCTCTCCTGGG + Intergenic
937094808 2:119228527-119228549 CCAGTCCAGAGACATCTCCAAGG - Intronic
937127393 2:119483185-119483207 CCTGTCCCCAGGCATCCCTGGGG - Intronic
938664691 2:133522402-133522424 CCTTTCCAAAGGCATCTCCATGG - Intronic
940762092 2:157749879-157749901 CCTGTCCTCAGGCCTCCCATTGG - Intronic
940974783 2:159930714-159930736 CCTCACCACAGGGATGTCCTTGG + Intergenic
942401671 2:175609619-175609641 TCTGTCCAGAGACATCTCCAGGG - Intergenic
943631929 2:190263523-190263545 CCTGTCTACATGCATTCCCTAGG + Intronic
944436454 2:199695603-199695625 CCTGGCCCCAAGCAGCTCCTGGG + Intergenic
946621800 2:221570572-221570594 CCTGCCCACAGACATCGCTTGGG - Intronic
947643876 2:231723347-231723369 TCTGCACACAGGCATCTCCTTGG - Intergenic
948272577 2:236686071-236686093 GCTGGCCAGATGCATCTCCTTGG - Intergenic
948574182 2:238939271-238939293 CTTGGCCAAAGGCCTCTCCTGGG + Intergenic
948686503 2:239673766-239673788 CCTGGCTGCAGGCGTCTCCTGGG - Intergenic
1168888989 20:1281615-1281637 CTCCTCCACAGGCAGCTCCTGGG + Intronic
1170457594 20:16547889-16547911 GCTGCTCACAGGAATCTCCTGGG + Intronic
1172488123 20:35311955-35311977 CCTGACCACAGGAGTCACCTGGG - Intronic
1173251685 20:41366945-41366967 CCTGTTCGCAGGCGGCTCCTCGG - Intergenic
1173551709 20:43937360-43937382 CCTTCCCACGGGCAGCTCCTGGG + Intronic
1174256755 20:49262062-49262084 GCTGTGAACTGGCATCTCCTTGG + Intronic
1174363909 20:50044718-50044740 CCTCTCCACTGCCATTTCCTGGG + Intergenic
1174862143 20:54100794-54100816 CCTGTGCACAGTCCTGTCCTAGG - Intergenic
1175513013 20:59547383-59547405 CCTGGCCCCAAGCAGCTCCTGGG + Intergenic
1176670825 21:9734363-9734385 ATTGTCCACAGGCATCTGCAAGG + Intergenic
1176688152 21:9873269-9873291 CCTGTCGACTGGCCTCTCCTGGG + Intergenic
1178808743 21:35861513-35861535 GCTCTCCACATCCATCTCCTGGG - Intronic
1179456953 21:41506965-41506987 CCTGCCCACAGGGCTCACCTCGG + Intronic
1179876728 21:44272517-44272539 TCTGAGCACAGGCTTCTCCTCGG + Intergenic
1180108073 21:45633023-45633045 CCCGTGCACAGGTATTTCCTAGG + Intergenic
1180144638 21:45912488-45912510 CCTTTCCTCCGTCATCTCCTGGG - Intronic
1180797425 22:18613012-18613034 CCTGTCCCCAGGAAGCACCTGGG + Intergenic
1180980532 22:19876195-19876217 CCTGTCCACAGGCATCTTGGGGG + Intronic
1181224300 22:21382272-21382294 CCTGTCCCCAGGAAGCACCTGGG - Intergenic
1181254332 22:21552551-21552573 CCTGTCCCCAGGAAGCACCTGGG + Intronic
1183024077 22:35050543-35050565 GCTTTCCACAGGCATCCCATAGG - Intergenic
1183269319 22:36850753-36850775 CCTGTCCCCAGCCCTCACCTGGG - Intergenic
1183270715 22:36861030-36861052 CCTCCCCAAAGGCAGCTCCTGGG + Exonic
1183414994 22:37676845-37676867 CCTTTCCCCAGGCTTCCCCTTGG + Intronic
1183667578 22:39254419-39254441 CCTGTCCACCCGCAGCTGCTAGG + Intergenic
1183736040 22:39645507-39645529 CTTGTCCACAAGCATTTCCTGGG - Intronic
1184351003 22:43944205-43944227 CCTGACCACAGACATCCCCCCGG - Intronic
949229010 3:1728758-1728780 GCTCTCCACAGGCATCACCTGGG + Intergenic
950040672 3:9917308-9917330 CCAGGGCACAGGCATCTTCTAGG - Exonic
950720698 3:14880639-14880661 CAAGGCCACAGGCAGCTCCTTGG - Intronic
950848982 3:16044017-16044039 CCTGTCTACTTGCCTCTCCTGGG - Intergenic
951569070 3:24043353-24043375 CCTGTCCACTGGGAGCTCCATGG + Intergenic
951991465 3:28679919-28679941 CCTGTCCACAAGGATCACTTTGG + Intergenic
953574329 3:44101035-44101057 CCTGTCCCCAGGCGTCTTCAGGG - Intergenic
953982189 3:47418485-47418507 CCTGGCCACCGGCATCGTCTTGG - Exonic
954397428 3:50300248-50300270 CATGTCCATATGCATCTACTTGG - Exonic
954673607 3:52303705-52303727 TCTGTCCACAGCCTTCCCCTCGG + Intergenic
956889787 3:73601231-73601253 TGTGGCCACAGGCTTCTCCTGGG - Intronic
957640638 3:82849310-82849332 GCTGGCCACATCCATCTCCTGGG - Intergenic
958064762 3:88528992-88529014 CCTGTCTGCTGGCCTCTCCTAGG - Intergenic
958064816 3:88529339-88529361 CCTGGCCCCAAGCAGCTCCTGGG - Intergenic
961090431 3:124106609-124106631 CCTCTCCACAGTCTTCTCCAAGG - Intronic
961817198 3:129557173-129557195 CCGGTACTCAGGAATCTCCTTGG + Exonic
962129190 3:132654531-132654553 GCTCTCCACAGACATCTCCATGG - Intronic
963934059 3:151034456-151034478 CATGGCCACAGGCATGTTCTAGG - Intergenic
967500255 3:190189093-190189115 CATTTGCACAGGCATCTCCATGG + Intergenic
967945709 3:194802209-194802231 CCTTCCCCCAGGCCTCTCCTTGG + Intergenic
968392479 4:205019-205041 CCTCTCCACAGGCAGCCCATGGG + Intergenic
968548378 4:1210117-1210139 CCTCTCCACAGGCAAGCCCTGGG - Intergenic
968591925 4:1463817-1463839 CGTGTCCCCAGGCATCCCCAAGG + Intergenic
968652445 4:1765623-1765645 CCTGCCCACTGCCATCTCCCAGG - Intergenic
968655893 4:1778323-1778345 CCTGGCCACGGCCATCTCCGGGG - Intergenic
968684493 4:1948278-1948300 CCTTTCCAAATGCATCTCGTTGG + Intronic
969363014 4:6677131-6677153 CATGTCCACAGGCAGGCCCTCGG - Intergenic
971358056 4:25912715-25912737 ACTGTCCACAGCCCTCACCTGGG + Intronic
971385344 4:26136559-26136581 CCTGCCCCCATGCCTCTCCTTGG + Intergenic
974053713 4:56964761-56964783 CCTGTCCAGAGGCTTCTGCCAGG - Intronic
975296287 4:72738256-72738278 CCTGGCCCCAAGCAGCTCCTAGG + Intergenic
975909193 4:79248093-79248115 CCTGTCTACTGGCCTCTCCTAGG + Intronic
976364288 4:84215626-84215648 ACTCTCCACAGGCAGCTCCAGGG + Intergenic
978054724 4:104249318-104249340 CCTGTCCGCCAGCATCTCCTGGG - Intergenic
980351525 4:131691108-131691130 CCTGTTGACTGGCCTCTCCTGGG + Intergenic
982840215 4:160174949-160174971 CCTGTCTGCTGGCTTCTCCTGGG + Intergenic
984620795 4:181949911-181949933 CCTCTGCACAGCCACCTCCTCGG + Intergenic
985174257 4:187184778-187184800 CCTGCCCACAGTAATCACCTGGG - Intergenic
985246546 4:187984928-187984950 CCTGTCAGCAGGCAGCTCGTCGG - Intergenic
987419221 5:17699056-17699078 CCTTTCCACAGGAACATCCTTGG - Intergenic
991124965 5:63059977-63059999 CCTTTCCACAGCCCTCTCCAAGG - Intergenic
992089709 5:73306144-73306166 CCTGGCCACTGGCCTCTCCATGG - Intergenic
992479294 5:77134636-77134658 CTTGACCACAGGGATCACCTGGG - Intergenic
996804050 5:127434876-127434898 TCTGTCCTCAGGCCTCCCCTTGG + Intronic
997629237 5:135354177-135354199 CTTGTGCACAGCCCTCTCCTGGG - Intronic
999268704 5:150283825-150283847 CCTTTCAACAGGTATTTCCTGGG - Intronic
999825362 5:155268518-155268540 GCTTTCCACAGGCTTCTCCCAGG + Intergenic
1000434753 5:161194765-161194787 CCTGTCCAAAGTGATCTGCTTGG - Intergenic
1001548016 5:172582582-172582604 CTTTTCCAAAGGCATCTCATGGG - Intergenic
1001997884 5:176176439-176176461 CCTTTCCACAGGTGTCTTCTAGG - Intergenic
1002169257 5:177366276-177366298 GCTGGCCACAGGCTGCTCCTCGG - Exonic
1003311320 6:4972036-4972058 CCTGCCCACGGTCAGCTCCTGGG - Intergenic
1004046088 6:12024982-12025004 CCTTTCCACAGGTCTCTACTAGG + Intronic
1004220258 6:13740908-13740930 GGTGTCCACAGGCATATCATAGG + Intergenic
1004302895 6:14474719-14474741 CTGGTCCTCAGGCAACTCCTGGG - Intergenic
1004925302 6:20410573-20410595 TCCTTCCACAGGCATCTCATGGG + Intronic
1005890879 6:30136898-30136920 CCTGTCCCCAGGCTGCTCCAGGG + Exonic
1006301635 6:33196518-33196540 CCTGTCCACAGGCATCTCCTCGG + Exonic
1007353677 6:41294431-41294453 CCTGTCTGCTGGCCTCTCCTGGG + Intergenic
1007529867 6:42532638-42532660 GCTGACCACTAGCATCTCCTGGG - Intergenic
1007623711 6:43230254-43230276 TCTGTCCACAGCACTCTCCTTGG - Intergenic
1007950861 6:45871148-45871170 CATGTGCCCAGCCATCTCCTGGG - Intergenic
1010655169 6:78503283-78503305 CCTGTCCCCAAGCAGCTCCTAGG - Intergenic
1010732456 6:79405201-79405223 CCTGAGCATAGGCATGTCCTTGG - Intergenic
1011081599 6:83495858-83495880 CCTGACCCCTTGCATCTCCTGGG - Intergenic
1011242547 6:85287905-85287927 CCTGTCCACAGGGATGGCCGGGG + Intergenic
1011246056 6:85322540-85322562 TCTGGCCACACGCATTTCCTGGG - Intergenic
1012253695 6:97008365-97008387 CCTGTCTTCTGGCCTCTCCTAGG - Intronic
1013009314 6:106105493-106105515 CCTGTCTACAGCAATCTCCTCGG + Exonic
1013312383 6:108908080-108908102 ACTGTGCACATGCATCCCCTGGG + Intronic
1014780370 6:125558566-125558588 GCTGTGCACAGGCGTCTCCACGG + Intergenic
1014798124 6:125748847-125748869 CCAGTCCACGGGCTTCTCCGCGG + Intronic
1015117004 6:129660692-129660714 ACTGTGCACAGGCGTCACCTTGG - Intronic
1016065893 6:139683122-139683144 CCTGACCTCAGGAGTCTCCTTGG + Intergenic
1016396576 6:143629722-143629744 CCTCTCAATACGCATCTCCTTGG - Intronic
1018047968 6:159981394-159981416 CCTGTCCGGAGGCATCTCCTAGG - Intronic
1020567999 7:9822281-9822303 CCTCTCCACAGGCAGGTCATTGG + Intergenic
1021188584 7:17594209-17594231 CCTGTCCCCATGCCTCCCCTCGG + Intergenic
1021763560 7:23924905-23924927 ACTGTACACAGGAATCCCCTAGG + Intergenic
1022267225 7:28768912-28768934 CCTCTCCTCAGGCAGCCCCTCGG + Intronic
1022762405 7:33369650-33369672 CATCACCATAGGCATCTCCTAGG - Intronic
1023561892 7:41483317-41483339 CCTGCCCCCAAGCATCTCTTTGG - Intergenic
1026929224 7:74213917-74213939 TCTGTCCCCAGCCATCTCCAGGG + Intronic
1026947865 7:74327825-74327847 CCTGGCCACGGGCTTCTCCATGG + Intronic
1027197024 7:76037626-76037648 CCTGACCACAGGCTTCTTGTAGG + Intronic
1030401680 7:109059350-109059372 CCTGTCTGCTGGCTTCTCCTGGG - Intergenic
1032850226 7:135788778-135788800 CCTGCCCTCTGGCATCTGCTGGG - Intergenic
1034748449 7:153545096-153545118 TCTGTCCAAGGGCAACTCCTGGG - Intergenic
1035125286 7:156604615-156604637 CCCATCCACAGGCATCGCATGGG - Intergenic
1036635400 8:10547044-10547066 CCTGCCCACTGCCATCTGCTGGG - Intronic
1037892656 8:22631645-22631667 CCTGTCCACTGGCTTCCTCTAGG - Intronic
1038102488 8:24394058-24394080 GCTCTCTACAGGCACCTCCTGGG + Exonic
1039916139 8:41861730-41861752 CCTGTCCATGGGTATTTCCTCGG - Intronic
1040333803 8:46405935-46405957 GATGTCCACAGGGCTCTCCTGGG + Intergenic
1040575595 8:48648442-48648464 CCTGAACACAGGCATCGGCTGGG + Intergenic
1041727362 8:61030635-61030657 CCTGTCCACAGCCACCTTCTCGG - Intergenic
1045658431 8:104410909-104410931 CCTGTCCAGAGCCACCTCCAAGG + Intronic
1047297805 8:123586880-123586902 CCTTCCCACAGGTACCTCCTTGG - Intergenic
1048455167 8:134571092-134571114 CTTGTCCACTCTCATCTCCTGGG - Intronic
1048531474 8:135253975-135253997 CCTGTCTGCATGCTTCTCCTAGG + Intergenic
1048921917 8:139239272-139239294 CCTGCCCACAAGCAGCTCTTGGG + Intergenic
1049390046 8:142363148-142363170 CCTGTGCACTGGTATCTACTGGG + Intronic
1049427021 8:142542241-142542263 CGTGTCCAGAGCCTTCTCCTGGG - Exonic
1049577137 8:143394605-143394627 CCTGGCCACAGCCTTCACCTGGG - Intergenic
1049700946 8:144012290-144012312 CCTGTACACAGGCCTTGCCTCGG - Intronic
1050302621 9:4274771-4274793 CCTGTGCACATGAATCACCTGGG + Intronic
1051169613 9:14307121-14307143 CCTGTTCAAAGGCATCCCCTTGG - Exonic
1051199109 9:14597580-14597602 CCTGTCCTCAGGCCTCTGCGTGG - Intergenic
1053781188 9:41608604-41608626 CCTGTCGACTGGACTCTCCTGGG - Intergenic
1054169135 9:61818757-61818779 CCTGTCGACTGGACTCTCCTGGG - Intergenic
1054668397 9:67762059-67762081 CCTGTCGACTGGACTCTCCTGGG + Intergenic
1055564960 9:77559238-77559260 ACTTCCCAGAGGCATCTCCTTGG + Intronic
1056579476 9:87880542-87880564 CTGGTCCTCAGGCATCTCCAGGG - Intergenic
1057083012 9:92186935-92186957 CCGGTGCACAGACATCTTCTGGG + Intergenic
1057979855 9:99650084-99650106 CCAGTCTACTGGCCTCTCCTGGG + Intergenic
1058937105 9:109779893-109779915 CCTCTCCACTGGCATCTGCCCGG + Intronic
1059218548 9:112590096-112590118 CCTGACCATTGGCATCACCTGGG + Intronic
1059566368 9:115386152-115386174 CCTCTCCACAGGCAAGTCATTGG - Intronic
1059713070 9:116887394-116887416 TCTGTCCAAAAGCCTCTCCTCGG - Intronic
1059789530 9:117625302-117625324 GCTGTCCTCAGGCATCTCTTTGG - Intergenic
1060472782 9:123962504-123962526 ACTGTCCAAAGGCCTCCCCTGGG - Intergenic
1061805167 9:133133693-133133715 CCTGACCCCAGGCTTCTCCCAGG + Intronic
1061970487 9:134042140-134042162 CCTGTCCGCAGGAATTGCCTGGG - Intronic
1185631612 X:1519541-1519563 CTGGTCCCCAGTCATCTCCTTGG + Intronic
1187607851 X:20905805-20905827 CCTGTCTTCTGGCATCTCCCAGG - Intergenic
1189170675 X:38906408-38906430 GCTGTGCTCAGGCATCTCGTTGG - Intergenic
1189219319 X:39357584-39357606 CATGCCCAAAGGCATCTTCTTGG - Intergenic
1190561112 X:51686146-51686168 CCTGTCCACATGCTACTCTTTGG + Intergenic
1190563179 X:51707171-51707193 CCTGTCCACATGCTACTCTTTGG - Intergenic
1193392841 X:80949269-80949291 CCTGTCTGCTGGCCTCTCCTAGG - Intergenic
1193476115 X:81967966-81967988 CCTTTCCAGGGCCATCTCCTTGG + Intergenic
1193515016 X:82452197-82452219 TCAGTCCACTGGCCTCTCCTGGG + Intergenic
1193882207 X:86936831-86936853 CCTGGCCCCAAGCACCTCCTGGG - Intergenic
1194699888 X:97101309-97101331 CCTTTCAAGAGGCATATCCTTGG + Intronic
1196239019 X:113318303-113318325 CCTGCCCGCAGGGTTCTCCTGGG + Intergenic
1196574478 X:117302280-117302302 CCTGTCTGCTGGCCTCTCCTGGG - Intergenic