ID: 1006301754

View in Genome Browser
Species Human (GRCh38)
Location 6:33197323-33197345
Sequence ATGGAGACACAGAAGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1585
Summary {0: 1, 1: 1, 2: 23, 3: 190, 4: 1370}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006301751_1006301754 4 Left 1006301751 6:33197296-33197318 CCTAGGAATCTGACTTAAGAAGA 0: 1
1: 0
2: 0
3: 24
4: 344
Right 1006301754 6:33197323-33197345 ATGGAGACACAGAAGAAGGAAGG 0: 1
1: 1
2: 23
3: 190
4: 1370

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006301754 Original CRISPR ATGGAGACACAGAAGAAGGA AGG Intronic
900681673 1:3920125-3920147 AGGGAGAGAGGGAAGAAGGAAGG - Intergenic
901595571 1:10382837-10382859 GGGGAGAAACAGAAGAAGGGAGG + Intergenic
901953071 1:12763901-12763923 GGGGAGACAGAGAGGAAGGAAGG - Intergenic
902273914 1:15325822-15325844 TTGGAGATACAGGAGAGGGAAGG - Intronic
902665646 1:17935796-17935818 AGGGAGGGACAGAAGAAGAAAGG - Intergenic
902675611 1:18006556-18006578 AGGGGGGAACAGAAGAAGGAAGG + Intergenic
902754403 1:18539800-18539822 ATTGAAACTCAAAAGAAGGAAGG + Intergenic
903393551 1:22982139-22982161 GAGGAGACACTGCAGAAGGAGGG + Intergenic
903751949 1:25628749-25628771 TTGGAGACTCAGAAGGGGGAGGG - Intronic
904171820 1:28596725-28596747 ATGGAGATAGAGTAGAATGATGG - Intronic
904270783 1:29348715-29348737 AGAGAGAGAGAGAAGAAGGAAGG - Intergenic
904333957 1:29785046-29785068 GGGGAGACAGAGAAGGAGGAGGG + Intergenic
904353167 1:29922076-29922098 ATGGAGGCAGTGCAGAAGGATGG - Intergenic
904654036 1:32029073-32029095 ATGGAGAGGCAGATGAAGGGAGG - Intronic
904859669 1:33526177-33526199 AAGGAGTGACAGAAGAAGGGAGG + Intronic
905295389 1:36951416-36951438 AAGAAGACAAAGGAGAAGGAAGG - Intronic
905488983 1:38328851-38328873 GAGGAGACAGAGAAGAGGGAAGG - Intergenic
905714298 1:40134869-40134891 AAGGAGACAGAGAAGGAGAAGGG - Intergenic
905898151 1:41562496-41562518 AAGGAGAAAGAGAGGAAGGAAGG - Intronic
906352198 1:45071295-45071317 ATAGAGATAGAGTAGAAGGATGG - Intronic
906516722 1:46443360-46443382 AAGAAGAAAAAGAAGAAGGAGGG - Intergenic
906628775 1:47347111-47347133 AAGGAGGAACAGAAGGAGGAAGG - Intronic
906736161 1:48130938-48130960 ATGGAGACTCAGAAGGGTGAGGG - Intergenic
906874146 1:49517508-49517530 ATGAAGACAAAGGAGAATGAGGG + Intronic
907235947 1:53047830-53047852 ACAGATACACAGGAGAAGGAAGG - Intronic
907410001 1:54277107-54277129 ATGAAGTCACAGAAGGAGAAAGG - Intronic
907560776 1:55385636-55385658 GGGGAGAGAAAGAAGAAGGAAGG - Intergenic
907620637 1:55974700-55974722 ATGGAGTCAGAGTAGAAGTAGGG + Intergenic
907639602 1:56173681-56173703 TTAGAGACCCAGAAAAAGGAGGG - Intergenic
908156341 1:61357514-61357536 AAGGAGACAGGGAAGAATGAAGG - Intronic
908406656 1:63820829-63820851 ATGGAGAAACAGATGAGGAATGG + Intronic
908478512 1:64512970-64512992 ATGGAAAAACAGAACAAGGATGG - Intronic
908581161 1:65519086-65519108 AGAGAGACACAGAGGATGGAAGG - Intronic
908706775 1:66965838-66965860 ATGGAGATACAGCAGAAGGATGG - Intronic
908724155 1:67157094-67157116 ATGGAGAGAGAGCAGAAGCAGGG - Intronic
909331886 1:74423216-74423238 ATGGAGAGACAAAAGAAAGAGGG - Intronic
909700607 1:78517676-78517698 TTGAGGACACAGAAGAAGGTAGG + Intronic
909779053 1:79520035-79520057 AAGAAGAAAAAGAAGAAGGAAGG + Intergenic
910022299 1:82606701-82606723 ATGGTGACACAAAGGAGGGAAGG + Intergenic
910549449 1:88459613-88459635 ATGAAGACACTGATGAAGGTGGG - Intergenic
910713068 1:90201972-90201994 AGAGAGACAGAGAGGAAGGAAGG + Intergenic
910718422 1:90257858-90257880 ACGGGGACAAAGAAGCAGGAAGG + Intergenic
910735040 1:90444360-90444382 AAGGAGAGAAAGAGGAAGGAAGG + Intergenic
911042462 1:93601747-93601769 ATAAAGAAAAAGAAGAAGGAGGG + Intronic
911067412 1:93802905-93802927 TTGCAGACAAAGGAGAAGGAGGG - Intronic
911493204 1:98595082-98595104 ACAGAGATACAGTAGAAGGATGG - Intergenic
911620040 1:100056193-100056215 ATGGAGACAGAGCAGAATGATGG - Intronic
911912728 1:103655304-103655326 AGGGAGAAACAGAATATGGAAGG + Intronic
911915727 1:103696644-103696666 AGGGAGAAACAGAATACGGAAGG - Intronic
911920140 1:103749442-103749464 AGGGAGAAACAGAATATGGAAGG + Intronic
912048757 1:105495443-105495465 CTGGGGACACTGAAGAAGCAAGG - Intergenic
912091507 1:106081764-106081786 ATAGAAACAGAGTAGAAGGAAGG - Intergenic
912547392 1:110460802-110460824 AAGGATACACAAATGAAGGAAGG - Intergenic
912859779 1:113203359-113203381 ATGGACACAGAGTAGAAGGATGG - Intergenic
913099395 1:115549379-115549401 GTAGAGACACAGAAGGAGGGGGG + Intergenic
913540119 1:119811437-119811459 CTGGAGACACTGAAGAAGGCAGG - Exonic
913540906 1:119819996-119820018 AGGGAGAAAGAGAAGAAGAAGGG - Intergenic
914857716 1:151364657-151364679 ATGTAGACACAGTAAAAGGAGGG - Exonic
915017016 1:152743807-152743829 AAAGAGAGACAGAAGAAGGCAGG + Intronic
915177849 1:154031558-154031580 ATGGAGACAGAGTAGAATGATGG - Intronic
915694891 1:157729888-157729910 TTGGAGACTCAGAAGAAGGAGGG + Intergenic
915983804 1:160442925-160442947 TTGGAGACTCAGAAGCAGGAAGG - Intergenic
916180658 1:162080680-162080702 ATGCACACACAGAAGTAGCAGGG - Intronic
916282389 1:163066148-163066170 ATGGAGCCTCAGAAGGATGAGGG - Intergenic
916589073 1:166172907-166172929 AGGGAGAAACAGGAGAAGGAAGG - Intergenic
916636847 1:166680054-166680076 ATGGAGACTGAGAAGGAGGAGGG - Intergenic
916902779 1:169247640-169247662 TTGGCGACTCAGAAGAGGGAGGG - Intronic
916993304 1:170267984-170268006 AAGGAGACACTGAAGAGGGTAGG - Intergenic
916998374 1:170326963-170326985 GTGGAGACACTGAAGGAGGCAGG + Intergenic
917354712 1:174115005-174115027 AGAGAAACACAGAAGGAGGAAGG - Intergenic
917482931 1:175427917-175427939 ATGGAGACAGGAAGGAAGGAAGG - Intronic
917554351 1:176068215-176068237 AGGGAGAGAAGGAAGAAGGAAGG - Intronic
917593237 1:176498954-176498976 AGGGAGAGAAAAAAGAAGGAGGG - Intronic
917790439 1:178495873-178495895 AGGGAGGCAGAGAAGAATGAAGG + Intergenic
917794526 1:178522977-178522999 ATGGATATAGAGTAGAAGGATGG - Intronic
918029670 1:180793113-180793135 AGGGAGAGAGGGAAGAAGGAAGG + Intronic
918080909 1:181207057-181207079 CTGGAGACACAGGAGACAGAAGG + Intergenic
918301497 1:183208136-183208158 AAGGAGGAAAAGAAGAAGGAAGG + Intronic
918570483 1:185985779-185985801 ATGGAGACACAGAATGATGAAGG - Intronic
918761847 1:188420536-188420558 AGGGAGAGACAGAAGGAGGAAGG - Intergenic
918761874 1:188420625-188420647 AGGGAGAGAGGGAAGAAGGAAGG - Intergenic
918876129 1:190046259-190046281 AAGGAGAAAAGGAAGAAGGAAGG + Intergenic
919038986 1:192357411-192357433 AGGGAGACACAGAAAGAGGGAGG + Intronic
919061586 1:192640902-192640924 TTGAAAACACAGAAGAAAGAAGG - Intronic
919211611 1:194494144-194494166 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
919739943 1:200975336-200975358 ATGGAGACAGAGGAGGAAGAGGG + Intronic
920019675 1:202945849-202945871 ATGGAGACTTAGAAGCGGGAGGG + Intronic
920110500 1:203583857-203583879 AAGGAGAGAGAGAAGGAGGAAGG + Intergenic
920110526 1:203583962-203583984 AAGGAGAGAGAGAAGGAGGAAGG + Intergenic
920611143 1:207438966-207438988 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
921226295 1:213023275-213023297 ATTGAGACAATGAAGAAGGGTGG + Intergenic
921403533 1:214753476-214753498 ATGGGGAGCCAGAAGAGGGATGG - Intergenic
922279001 1:224104828-224104850 TTGGAGACTCAGAAGCAGGGAGG + Intergenic
922504539 1:226118901-226118923 TTGGAGAGCCAGAACAAGGATGG + Intergenic
922595903 1:226812693-226812715 AGGGAGGGAGAGAAGAAGGAAGG - Intergenic
922817184 1:228458187-228458209 ACCAAGGCACAGAAGAAGGACGG + Exonic
922916479 1:229262107-229262129 ATGGAGACACAGATGAGAAAGGG - Intergenic
923077548 1:230623437-230623459 ATGGAAAAAAAGAAGAAGGTGGG - Intergenic
923127757 1:231047292-231047314 AAGGAGAGAGAAAAGAAGGAAGG - Intergenic
923286911 1:232505081-232505103 ATGAAAAGACTGAAGAAGGAAGG + Intronic
923469912 1:234281238-234281260 ATGAAGACACAGAAGGGTGATGG + Intronic
924039171 1:239966611-239966633 ATGGAAACAAAAAGGAAGGAAGG - Intergenic
924108113 1:240669712-240669734 ATGGAGACTCAGAAGGGTGAAGG - Intergenic
924175655 1:241388871-241388893 ATGGAGACACCGTGGAAGTAGGG + Intergenic
924355394 1:243169575-243169597 ATGGAGAAAGAGAAGAAAAAAGG + Intronic
924833985 1:247629481-247629503 AAAGAGACACTGAAGAAGGTAGG - Intergenic
1063016108 10:2079361-2079383 ATGAAGACACAGAAGGAAGGGGG - Intergenic
1063182326 10:3615439-3615461 TTGGAAGCACAGAAGAAAGATGG - Intergenic
1063197797 10:3759460-3759482 AGGAAGACAGAGAAAAAGGAAGG + Intergenic
1063225639 10:4013027-4013049 AGGGAGAAAGAAAAGAAGGAAGG - Intergenic
1063236066 10:4117752-4117774 ATGGAGGGAGAGAGGAAGGAAGG + Intergenic
1063243439 10:4194244-4194266 ATGAAGTCAGAGAAGAAGGTGGG - Intergenic
1063525257 10:6778875-6778897 AGGGAGAGAATGAAGAAGGAAGG + Intergenic
1063907057 10:10792013-10792035 AGGGAGACAGGGAGGAAGGAAGG + Intergenic
1064020086 10:11801977-11801999 CTGGAGACTCAGAAGGAGGGAGG + Intergenic
1064055079 10:12090471-12090493 AGAGAGAGAAAGAAGAAGGAAGG - Intronic
1064196703 10:13249519-13249541 ATAGATATACAAAAGAAGGAAGG + Intergenic
1064259373 10:13772768-13772790 ATGGAGACAGAATAGAAGGATGG + Intronic
1064460336 10:15529008-15529030 AGGGAGACAGGGAGGAAGGAAGG - Intronic
1064652081 10:17519589-17519611 AGGGAGAAAGAGAGGAAGGAGGG + Intergenic
1064662825 10:17623423-17623445 GTGGAGACTCAGAAGCAGGGAGG - Intergenic
1064688190 10:17886331-17886353 AGGGAGGGAAAGAAGAAGGAAGG - Intronic
1064805681 10:19128853-19128875 AAGGAGAGAGAGAAGAAGAATGG - Intronic
1064944264 10:20770680-20770702 ATGAAGAAACAGAACAAGGAAGG - Intergenic
1064951270 10:20853695-20853717 ATGAAGACAGAGTAGAATGATGG + Intronic
1064955500 10:20903856-20903878 ATGGAGACTCAGAAGGGAGAAGG + Intronic
1064991786 10:21262768-21262790 ATGGAGTCACAGACCAGGGAGGG - Intergenic
1065162530 10:22937851-22937873 ATGGAGACAGAGAAACAGCATGG + Intronic
1065257020 10:23880413-23880435 ATGGAGATAGAGTAGAAGGATGG + Intronic
1065431108 10:25656861-25656883 ATGGAGATAGAGTAAAAGGATGG - Intergenic
1065638325 10:27753346-27753368 AGGGAGAGAGAGAGGAAGGAAGG - Intergenic
1065669685 10:28102839-28102861 AGGGAGAAACAGCAGAAGCAGGG - Intronic
1065736560 10:28758296-28758318 AAGTAGAGACAGAAGGAGGAAGG - Intergenic
1065920359 10:30387534-30387556 ATGGAGACAGAGACAAGGGAAGG - Intergenic
1066169710 10:32828413-32828435 AAGGAGAAGAAGAAGAAGGAAGG + Intronic
1066762053 10:38764608-38764630 AAGGAGACAGAAAGGAAGGATGG + Intergenic
1066959538 10:42207860-42207882 AGGGAGACAGAAAGGAAGGATGG - Intergenic
1067150792 10:43731666-43731688 AAGCAGAAACAGAAGGAGGAAGG - Intergenic
1067426899 10:46217358-46217380 GTGAAGACACAGGAGAAAGAGGG + Intergenic
1067511225 10:46896409-46896431 ATGAGGACACAGAAAAAGTAAGG + Intergenic
1067516747 10:46954228-46954250 GTGAAGACACAGAGGAAAGACGG - Intronic
1067645504 10:48097598-48097620 GTGAAGACACAGAGGAAAGACGG + Intergenic
1067651028 10:48155453-48155475 ATGAGGACACAGAAAAAGTAAGG - Intergenic
1067696369 10:48538246-48538268 ACAGAGACACAGAGGGAGGAAGG - Intronic
1067935266 10:50605904-50605926 ATGGAGACTCAGAAGGGTGAAGG - Intronic
1068416963 10:56735304-56735326 AAGGAAAGACAGAAGAAGGCAGG - Intergenic
1068547034 10:58359163-58359185 ATAGAGACAAACAAGAAGGAGGG - Intronic
1068553280 10:58429594-58429616 ATGGAGACTCAGAAGAGTGAAGG - Intergenic
1068640260 10:59396956-59396978 ATGGAGACTCAGAAGGGTGAGGG - Intergenic
1068919733 10:62470478-62470500 ATGCATACACAGGATAAGGAGGG + Intronic
1069020800 10:63486277-63486299 ATTGGGAGACAGAAGAAGCATGG + Intergenic
1069238184 10:66104601-66104623 TTGGAGACTCAGAAGCAGGGAGG - Intronic
1069835432 10:71305019-71305041 AAGTAGAGACAGAGGAAGGAGGG - Intergenic
1070065306 10:73027819-73027841 AGGGAGAGAGAGAGGAAGGAAGG + Intronic
1070068225 10:73059172-73059194 ATGGTCACATAGAAAAAGGAAGG + Intronic
1071110774 10:82152766-82152788 AAGGAGAAGGAGAAGAAGGAAGG - Intronic
1071167829 10:82827454-82827476 ATGGAGCCAAAGGAGAAGGGTGG - Intronic
1071431537 10:85610773-85610795 AGGGAGAGAGGGAAGAAGGAAGG + Intronic
1071771714 10:88736129-88736151 ATGGAGCCAGGGAAAAAGGAAGG + Intronic
1071899875 10:90108702-90108724 ATGGAGAAAGAGCAGAGGGATGG + Intergenic
1072155608 10:92721010-92721032 ATAAAAACACATAAGAAGGATGG - Intergenic
1072200669 10:93155873-93155895 ATGGAGAATAAGAAAAAGGAAGG + Intergenic
1072223104 10:93344405-93344427 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1072268808 10:93755537-93755559 ATGAAGACACAGCCGAAGAAAGG - Intergenic
1072526561 10:96276800-96276822 GTGGAGACAAGGAAGAAAGAAGG + Intergenic
1072735015 10:97873402-97873424 AGGCTGACACAGAAGAAAGAGGG - Intronic
1072872214 10:99132585-99132607 ATGGAGAGCAAGACGAAGGAGGG + Intronic
1072872907 10:99139271-99139293 CTGGAGACTCAGAAGCAGAAGGG + Intronic
1073112602 10:101071578-101071600 AAGAGGACACAGAAGAAGGAAGG - Intergenic
1073431392 10:103489809-103489831 ATGGAGAGAGAGAAAGAGGAAGG + Intergenic
1073560208 10:104489775-104489797 TTGTTGACACAGAGGAAGGAGGG + Intergenic
1073578455 10:104643083-104643105 ATGGAGCCAGAGAAGAGGAAAGG - Intronic
1073662645 10:105493861-105493883 ATGGAGGGAAAGAAGAAGGAAGG + Intergenic
1073988808 10:109240539-109240561 AGGGAGACAGGGAGGAAGGAAGG + Intergenic
1074119778 10:110485372-110485394 ATGGAATCACAGCAGAAGGTTGG + Intergenic
1074214123 10:111367530-111367552 ATGGAGGCACAGCACAAGGCAGG + Intergenic
1074615891 10:115067859-115067881 AGGAAGACAGAAAAGAAGGAAGG + Intergenic
1074619428 10:115103718-115103740 ATGGAGACAGAGTAGAATGATGG - Intronic
1074724133 10:116289932-116289954 AAGGAGACAGGGAAGCAGGAAGG - Intergenic
1074732174 10:116390825-116390847 AAGGAGAAGAAGAAGAAGGAAGG + Intergenic
1074734847 10:116419596-116419618 TTGGAGACTCAGAAGTGGGAGGG - Intergenic
1075209352 10:120477985-120478007 AGGAAGACACACAACAAGGAAGG + Intronic
1075315876 10:121453063-121453085 ATGAAGGCTCAGAAGAAGCAGGG + Intergenic
1075765262 10:124887844-124887866 ATGAAGACGCAGAGGAAGGGAGG + Intergenic
1075847263 10:125555017-125555039 AGGAAGACACAGAAGAGGGAAGG - Intergenic
1075906414 10:126085641-126085663 ATGGACAGACAGACAAAGGATGG - Intronic
1075948336 10:126456740-126456762 ATAGAGACACAGACGCAGGGAGG + Intronic
1076214245 10:128679969-128679991 CTGGAGGCAGAGAGGAAGGAAGG + Intergenic
1076258673 10:129048802-129048824 TTGGGGACACAGAACAGGGAGGG + Intergenic
1076286627 10:129305426-129305448 TGGGACACACAGAAGAAGTATGG + Intergenic
1076326922 10:129631360-129631382 ATGATGAGACAGAAGAATGAAGG + Intronic
1076558701 10:131346976-131346998 AAGGAGAGAAGGAAGAAGGAAGG - Intergenic
1076558713 10:131347023-131347045 AAGGAGAGAAGGAAGAAGGAAGG - Intergenic
1076577511 10:131479529-131479551 TTGGAGACACAGCAGAGGAAAGG - Intergenic
1077268591 11:1664680-1664702 ATGGAGGGAGGGAAGAAGGAAGG + Intergenic
1077280582 11:1743316-1743338 ATGGACAAACGGAAGATGGATGG + Intronic
1077828716 11:5839389-5839411 ATGGAGACAGAGTAGAATGATGG + Intronic
1077947116 11:6911793-6911815 AGGGAGACAATGAAGACGGAAGG - Intergenic
1078028527 11:7723691-7723713 CTGGGGAAACAAAAGAAGGAAGG - Intergenic
1078304426 11:10169361-10169383 AGAGAGAGAGAGAAGAAGGATGG - Intronic
1078363360 11:10687345-10687367 CTAGAGAAACAGAAGAGGGAGGG - Intronic
1078766187 11:14300771-14300793 AAGGAGGAAAAGAAGAAGGAAGG + Intronic
1078786326 11:14498003-14498025 ACGGAGACAGAGTAAAAGGATGG + Intronic
1078991324 11:16649060-16649082 ACGGAGACAAAGAAAAAAGAAGG + Intronic
1079327345 11:19505572-19505594 GGGGAGAGAGAGAAGAAGGAAGG + Intronic
1079490506 11:20983921-20983943 ATGGAGACAAAGAGGCAGCATGG - Intronic
1079944621 11:26726216-26726238 ATAGAGAGGGAGAAGAAGGAAGG - Intergenic
1080096871 11:28418720-28418742 ATGTAGCCACTGCAGAAGGATGG - Intergenic
1080187696 11:29510086-29510108 AGTGAGAGACATAAGAAGGAAGG - Intergenic
1080543258 11:33289839-33289861 ATGGAGATAGAGTAGAATGATGG - Intronic
1080694983 11:34595649-34595671 GTGTACACACAGAAGAAGGAAGG - Intergenic
1081303096 11:41477742-41477764 ATTGAGACAAAGAAGATAGAGGG + Intergenic
1081306252 11:41515699-41515721 TGGGAGAGAAAGAAGAAGGAAGG - Intergenic
1081359063 11:42150321-42150343 AAGGAGACACACTAGAAGTAAGG - Intergenic
1081405808 11:42696267-42696289 CTGGAGACTCAGAAGAGGGGAGG + Intergenic
1081504430 11:43700514-43700536 ATGGACAGACAGTAGAAGGATGG - Intronic
1081641274 11:44755975-44755997 ATGGAGAGAGAGATGGAGGAGGG + Intronic
1082053851 11:47796501-47796523 ATTGAGAGAGAGAGGAAGGAAGG + Intronic
1082119269 11:48360618-48360640 TTGGAGACTCAGAAGCGGGAAGG + Intergenic
1082255027 11:50024529-50024551 CTGGAGACTCAGAAGCGGGAAGG - Intergenic
1082718673 11:56646561-56646583 CAGGGGAGACAGAAGAAGGATGG - Intergenic
1083132662 11:60640300-60640322 CTGGAGACTCAGAAGCGGGAGGG + Intergenic
1083153085 11:60805778-60805800 ATGGAGACGGAGAAGGAAGAGGG - Intergenic
1083370327 11:62173816-62173838 AAAGAGAGAGAGAAGAAGGAAGG - Intergenic
1083783984 11:64933563-64933585 ATGGAGTCACAGAACAAAAATGG + Intronic
1084286174 11:68132515-68132537 AGGGAGAGAGAGAGGAAGGAAGG + Intergenic
1084441796 11:69178882-69178904 AGGGAGGCAAAGAGGAAGGAGGG + Intergenic
1084445135 11:69199242-69199264 ATGGAGAGATAGGAGATGGATGG - Intergenic
1084470273 11:69355478-69355500 TGGGAGGCACAGAATAAGGAGGG - Intronic
1084684656 11:70686492-70686514 ATGGATAGACAGATGATGGATGG - Intronic
1084941073 11:72613652-72613674 CTGGAGACACAGGAGTAGGTGGG - Intronic
1084955654 11:72689912-72689934 AGGCACACACAGAAGAAGCAAGG + Intronic
1084987395 11:72888003-72888025 ATGGATACACAGTAGTAGCAAGG + Intronic
1085670526 11:78460081-78460103 CTGAAGACACAGAAGAAGGGTGG + Intronic
1085774456 11:79352744-79352766 AAGGAGACAGAGAAGAAGGGAGG + Intronic
1085886334 11:80526724-80526746 CTGGAGACCCAGAAGAGGGGAGG + Intergenic
1086004902 11:82026712-82026734 TTGGAAACAGAGAATAAGGAGGG - Intergenic
1086203570 11:84232643-84232665 GTGAGGACACAGCAGAAGGATGG + Intronic
1086719197 11:90099399-90099421 AGAGAGAGAGAGAAGAAGGAAGG + Intergenic
1087245624 11:95833010-95833032 ATGGGGGCACAGAGGAAGGTGGG + Exonic
1087574914 11:99977554-99977576 ATGCAGACAGACAAGAAGCAAGG + Intronic
1088046969 11:105464758-105464780 ATGAAGATACAGTAGAATGAAGG + Intergenic
1088202981 11:107360115-107360137 ATAGAGACTCAGAAGAATAAGGG - Intronic
1088375439 11:109135637-109135659 ATGGAAATAGAGTAGAAGGATGG - Intergenic
1088381269 11:109195069-109195091 AGGAAGAAAGAGAAGAAGGAAGG - Intergenic
1088799662 11:113293920-113293942 AGGGAGGCAGAGAAAAAGGATGG + Intergenic
1089051372 11:115548898-115548920 ATGGTGAGCCAGAGGAAGGAGGG + Intergenic
1089126705 11:116181290-116181312 ATGGAGTCACACAGGCAGGAAGG + Intergenic
1089826046 11:121278834-121278856 AAAGAGACAAAGAAGGAGGAAGG - Intergenic
1089950602 11:122522159-122522181 ATGAGGAGAAAGAAGAAGGAAGG + Intergenic
1090003836 11:122983452-122983474 AGGGAGAGAGAGAGGAAGGAAGG + Intergenic
1090246615 11:125220685-125220707 ATGGAGAAATAGAACAAGGCCGG - Intronic
1090378703 11:126309915-126309937 GTTGAGAAAAAGAAGAAGGAAGG - Intronic
1091004089 11:131936478-131936500 TTGGAGACTCAGAAGGAGGGTGG + Intronic
1091773439 12:3168771-3168793 GTGGAGACACAGAAAAGAGAGGG - Intronic
1091810072 12:3389684-3389706 CTGGGGACACAGAAAAGGGAAGG + Intronic
1091865892 12:3836641-3836663 ATGGTGGCACAGAAGAAAGCTGG + Intronic
1092027761 12:5257380-5257402 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1092037764 12:5353792-5353814 AGAGAGACAGAGAGGAAGGAAGG + Intergenic
1092276232 12:7062897-7062919 CAGGAGACACTGAAGAAGGGAGG + Exonic
1092298213 12:7219371-7219393 ACGGAGATAGAGTAGAAGGATGG - Intergenic
1092330090 12:7578764-7578786 TTGGAGACACAGAACAGGGTAGG - Intergenic
1092575847 12:9782028-9782050 ATGAATGCACAGAAGAAGGCCGG - Intergenic
1092600850 12:10062397-10062419 ATATAGTCACAAAAGAAGGATGG - Intronic
1092780123 12:11978559-11978581 AGGGAGAGAGAGAGGAAGGAAGG + Intergenic
1092915453 12:13185208-13185230 CTGGAGACTCAGAAGGCGGAGGG + Intergenic
1093075864 12:14758127-14758149 ATAGAAAAACACAAGAAGGAAGG + Intergenic
1093200302 12:16178591-16178613 AGGGAGTGACAGAAGAAGGGAGG - Intergenic
1093405798 12:18802425-18802447 ATGGAAGCAGAGAAAAAGGAAGG + Intergenic
1093473597 12:19531450-19531472 AAGGAGAGACAGAAGAACAAAGG - Intronic
1093536459 12:20229457-20229479 ATGGAGGGAGAAAAGAAGGAAGG + Intergenic
1093593373 12:20933054-20933076 ATATAGACAGAGTAGAAGGATGG - Intergenic
1093612519 12:21179772-21179794 ATGGAGATAAAGAAGCGGGAAGG - Intronic
1093977971 12:25443907-25443929 TTGGAGACTCAGAAGGGGGAAGG - Intronic
1094143975 12:27209624-27209646 ATGGAGGCTCAGAAGGGGGAGGG + Intergenic
1094322101 12:29195858-29195880 ATGGGGACTCAGAAGGACGAGGG - Intronic
1094387266 12:29908895-29908917 AAGGAGGAACAGAAGAAGGGAGG - Intergenic
1094449550 12:30570059-30570081 ATGGAGACAGAGTAGAAGGATGG - Intergenic
1094483072 12:30900387-30900409 CTGGGGACACAGAAAAAGCAAGG - Intergenic
1094615366 12:32031500-32031522 ATGGAGGCACTGAAGATGGCAGG + Intergenic
1095042608 12:37459411-37459433 CCGAAGACACAGAAGAAGGCAGG - Intergenic
1095458169 12:42412250-42412272 ATGGAGACTCACAAGCAGGAGGG - Intronic
1095557914 12:43529640-43529662 TTGGAGACTCAGAAGCGGGAGGG + Intronic
1095693260 12:45115048-45115070 GGAGAGAGACAGAAGAAGGATGG + Intergenic
1095887640 12:47205742-47205764 AGGGAGAGAGAGAGGAAGGAAGG + Intronic
1095942448 12:47735904-47735926 GTGGGGACACAGGAGAAGCACGG - Intronic
1095999384 12:48116133-48116155 AGGGAGAGAGAGAGGAAGGAAGG - Intronic
1096000307 12:48124199-48124221 ATGAAGAAACTGAGGAAGGAGGG + Intronic
1096037320 12:48483782-48483804 ATGAAGTCAGAAAAGAAGGAGGG + Intronic
1096291754 12:50349488-50349510 ATGGACATAGAGTAGAAGGATGG - Intronic
1097257343 12:57689293-57689315 ATGGAGACTCAGAAGGATGATGG + Intergenic
1097472791 12:60016563-60016585 AGGGAAAGAAAGAAGAAGGAAGG - Intergenic
1097507498 12:60494290-60494312 ATGGAGAAGCAGAGGAAGCAGGG + Intergenic
1097620952 12:61938893-61938915 TTGGAGACTCAGAAGGAGGAGGG + Intronic
1098081607 12:66791834-66791856 CTGGAGACTCAGAAGCAGGGAGG - Intronic
1098132836 12:67368360-67368382 CTGGAAACACAGAGAAAGGATGG + Intergenic
1098384297 12:69902424-69902446 ATGGAGAAACAGTGGTAGGAGGG - Intronic
1098427995 12:70388002-70388024 ATGGATAGAGAGTAGAAGGATGG - Intronic
1098460797 12:70731043-70731065 AAGGAGACAGAGAGGAAGGAAGG + Intronic
1098460812 12:70731119-70731141 AAGGAGAGAGAGAGGAAGGAAGG + Intronic
1098579901 12:72087386-72087408 CTGAAGACACAGAAGAAAGATGG + Intronic
1098876260 12:75869120-75869142 ATGCAGACACAGAAGAGGTTAGG - Intergenic
1098992733 12:77082433-77082455 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
1099224208 12:79949566-79949588 ATGGAGAAATAGAAAAAGAAAGG - Intergenic
1099389575 12:82062839-82062861 GTGAAGACACAGAAAAAAGATGG + Intergenic
1100176207 12:92033881-92033903 ATGAAGAAAGAGAAGAAGAAAGG + Intronic
1100292076 12:93225309-93225331 TTGGAGACTAAGAAGAGGGAAGG - Intergenic
1100473881 12:94917900-94917922 ATTGAGACACTGAGGCAGGAGGG + Intronic
1100892170 12:99137745-99137767 ATGGAAGCACAGAAAAAGCATGG - Intronic
1101059891 12:100959820-100959842 ATGGAGATACAGAAGAAAAGGGG - Intronic
1101117480 12:101546465-101546487 ATGGAGACAGAGTAGAAGGATGG + Intergenic
1101348554 12:103907184-103907206 AGGGAGGGAAAGAAGAAGGAAGG + Intergenic
1101638836 12:106570587-106570609 AGGAAGAAACAAAAGAAGGAAGG - Intronic
1101813016 12:108123796-108123818 ATGGAGCCACATAATAAGGGGGG - Intergenic
1101855423 12:108438612-108438634 ATGGATGCACAGAAAAAGGCTGG + Intergenic
1101916959 12:108903276-108903298 AGGGAGAGAGAGAGGAAGGAAGG + Intergenic
1102010528 12:109615814-109615836 AAGGAGACAGAGAAGAGTGAGGG + Intergenic
1102749171 12:115277248-115277270 AAGAAGAAAAAGAAGAAGGACGG + Intergenic
1102764797 12:115423228-115423250 AGGGAGAGAGAGAGGAAGGAAGG + Intergenic
1102919996 12:116784766-116784788 GTGGAGATATAGAAGGAGGATGG - Intronic
1103105680 12:118222761-118222783 TTGGAGACTCAGAAGAGGAAGGG + Intronic
1103171700 12:118825889-118825911 AAGGAAAGAGAGAAGAAGGAAGG + Intergenic
1103358785 12:120341838-120341860 AGGGACACACAGAAGGGGGATGG + Exonic
1103663457 12:122541324-122541346 AGGGAGAGACAGAGGAAGGACGG - Intronic
1104110394 12:125699033-125699055 TAGGAGACCCAGCAGAAGGAAGG + Intergenic
1104301697 12:127570410-127570432 AGGAAGAAAGAGAAGAAGGAAGG + Intergenic
1104386300 12:128354507-128354529 AAAGAGAGAGAGAAGAAGGAGGG - Intronic
1104970975 12:132530570-132530592 GTGGAGACCCAGAAGCAGAAGGG - Intronic
1105028605 12:132867086-132867108 AAGGAGCCTCTGAAGAAGGAAGG + Intronic
1105726461 13:23167075-23167097 ATGGAGACAGAGTAGAAGGATGG - Intergenic
1105747205 13:23388716-23388738 CTGGAGACTCAGAAGCAGGGAGG + Intronic
1105966340 13:25388181-25388203 AAGGAGAGAAAGAAGGAGGAAGG + Intronic
1106068915 13:26387730-26387752 GTGGAGACCTAGAAGATGGAAGG - Intronic
1106442694 13:29791653-29791675 ATGGAAACTCTGAGGAAGGAAGG - Intronic
1106451529 13:29886841-29886863 GCAGAGACACAGAAGAGGGAAGG + Intergenic
1106572690 13:30941651-30941673 ATGGAGACTCAGAAGCAGAGAGG - Intronic
1106625844 13:31420319-31420341 CTGGATACACACAGGAAGGAAGG + Intergenic
1107683997 13:42878624-42878646 AAGGAGAAAGAGAGGAAGGAAGG + Intergenic
1108008025 13:45972429-45972451 TTGGAGACTCAGAAGGGGGAGGG + Intronic
1108101790 13:46964814-46964836 ATGAAGACACAGAATAAAGAGGG - Intergenic
1108379139 13:49840120-49840142 ATGGAGGGAGAGAACAAGGAAGG + Intergenic
1108738994 13:53315143-53315165 TTGGAGACTCAGAAGAGGGAGGG + Intergenic
1108807476 13:54176715-54176737 ATGCAGACCCAAAAGGAGGAAGG + Intergenic
1108859161 13:54832147-54832169 ATTGAGACAGAGAGGAAGAATGG + Intergenic
1109377922 13:61522833-61522855 ATGGAGAGCCAGAAGGTGGAGGG + Intergenic
1109585634 13:64398871-64398893 AGGGAGAATCAGAGGAAGGAAGG + Intergenic
1109799582 13:67358706-67358728 AGGGGGAAAGAGAAGAAGGAAGG - Intergenic
1109826022 13:67723195-67723217 ATGGATATAGAGTAGAAGGATGG - Intergenic
1110778183 13:79433744-79433766 AAGGAGACAGAGGAGGAGGAAGG + Intergenic
1111055995 13:82952456-82952478 ATGGAGACAGAGTAGAAGCAGGG + Intergenic
1111467837 13:88640844-88640866 ATGGAGACAGAGTAGAAGGATGG - Intergenic
1111572205 13:90103686-90103708 AAAGAGACACTGAAGAAGGTAGG - Intergenic
1111668486 13:91299687-91299709 ATGGATACATAAAACAAGGAAGG - Intergenic
1111904253 13:94237299-94237321 ATGGAGAAAAGAAAGAAGGAAGG - Intronic
1112163210 13:96890313-96890335 ATGCAGACACACAAGGAGTAAGG + Intergenic
1112176837 13:97034254-97034276 AAGGAGGCACTGAAGAAGGTAGG + Intergenic
1112523036 13:100115235-100115257 ATAGAGAGAGAGTAGAAGGATGG + Intronic
1112559610 13:100501371-100501393 ATGGAGACTCAGAAGGGTGACGG - Intronic
1112633610 13:101189267-101189289 AAGGAGAGAAAGAAGAAGAATGG + Intronic
1112674322 13:101681041-101681063 ATTGAGATACAAAAGAAAGAAGG - Intronic
1112752869 13:102599456-102599478 ATGGATAGAAAGAAAAAGGAAGG + Intronic
1112940302 13:104854032-104854054 AAAGAAACACAGAAGAGGGAAGG + Intergenic
1113508910 13:110836169-110836191 AGGGAGGGAGAGAAGAAGGAAGG + Intergenic
1113588316 13:111480780-111480802 ATGGGGAGCCAGAAGAAGGAGGG - Intergenic
1114196926 14:20486325-20486347 ATGTGGACACACAAGAAGTAAGG - Intergenic
1114231902 14:20790718-20790740 ATGGGGAGCCAGAAGAGGGAAGG - Intergenic
1114251226 14:20963189-20963211 ATGGAGATAGAGTAGAAGAATGG + Intergenic
1114354094 14:21888383-21888405 ATGGTGACAAAGAAGATGGAAGG + Intergenic
1114799403 14:25755968-25755990 ATGGAGAAATAGAAGAATGCTGG - Intergenic
1114819216 14:25996301-25996323 ATGAAAACATAGAAGAATGAAGG - Intergenic
1115027787 14:28764451-28764473 ATGGAGAGACAGAGGAATGGAGG + Intergenic
1115582161 14:34771843-34771865 AAGGAGAGAAAGAAGAGGGAAGG + Intronic
1115617848 14:35113298-35113320 ATGGAGAGGAAGAAGAAAGAAGG + Intronic
1115778046 14:36737826-36737848 AGGGAGGCACAGAAGCAAGAAGG + Intronic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1116142921 14:41023104-41023126 ATGGTGACTCAGAGGAATGAGGG - Intergenic
1116215669 14:42014099-42014121 AAGGAGAAAGAGAAAAAGGATGG - Intergenic
1116688544 14:48074782-48074804 AAGGAGACTAAAAAGAAGGAAGG - Intergenic
1116754774 14:48933362-48933384 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1117243169 14:53856047-53856069 AAGGAAAGAAAGAAGAAGGAAGG + Intergenic
1117346221 14:54835533-54835555 ATAGTTACACAGAATAAGGAGGG + Intergenic
1118009663 14:61596877-61596899 AAAGAGGCAGAGAAGAAGGAGGG + Intronic
1118010927 14:61609738-61609760 CTGGAGACACAGCAGAGGGAAGG - Intronic
1118636977 14:67756961-67756983 ATGGAGACACAGACTGAGAAAGG - Intronic
1118800887 14:69188472-69188494 AGGGAGAGAGGGAAGAAGGAAGG - Intergenic
1119184764 14:72632578-72632600 AAGGAGAGAGAGAGGAAGGAGGG + Intronic
1119199834 14:72744149-72744171 ATAAAGAAACAGAAGAGGGATGG + Intronic
1119537851 14:75417532-75417554 ATAGAGTCACAGAAGAAGTCAGG + Intergenic
1120005692 14:79355268-79355290 TTGGAGGGACAGAGGAAGGAGGG - Intronic
1120039120 14:79732077-79732099 ATAGAGACAAAGAGGAAGAACGG - Intronic
1120086851 14:80285416-80285438 ATGGACAGAGAGGAGAAGGATGG + Intronic
1120191270 14:81441919-81441941 AAGGAGACACAGAAAAATCAGGG + Intergenic
1120395958 14:83967002-83967024 AAGAAGAAAGAGAAGAAGGAAGG - Intergenic
1120664679 14:87291994-87292016 AGGGAGAGAGAAAAGAAGGAAGG - Intergenic
1120689917 14:87581042-87581064 ATGCAGACAAAGAAGAAACAAGG + Intergenic
1120736614 14:88060160-88060182 ATGGAGACAGAGTAGGAGGATGG + Intergenic
1120809150 14:88785150-88785172 ATGGACATAGAGTAGAAGGATGG + Intronic
1120809259 14:88786330-88786352 GGGGAGACACAGAATAAAGAAGG - Intronic
1120891640 14:89496814-89496836 ATAGAGACAAAGTAGAATGAAGG - Intronic
1121373949 14:93388364-93388386 AGGGAGAAAGAGAGGAAGGAAGG - Intronic
1121451329 14:94010122-94010144 AAAGATACACGGAAGAAGGAAGG + Intergenic
1121485086 14:94308546-94308568 ATGCAGACTCAGAAGCAGGGGGG - Intronic
1121818914 14:96950064-96950086 AGGGAGACACAGAAGAATCCAGG + Intergenic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1121881083 14:97500813-97500835 ATGCAGACATAGGAGAAGGGGGG + Intergenic
1121918762 14:97860775-97860797 GTGAAGACACAGAAGACAGATGG + Intergenic
1121979508 14:98442485-98442507 ATTGAGACCCAGAAGAACGATGG + Intergenic
1122409105 14:101517039-101517061 AAGGGGAAACAGAAGAAGGGAGG + Intergenic
1122868389 14:104621306-104621328 AGGGAAACAGAGAGGAAGGAGGG + Intergenic
1123462522 15:20486152-20486174 ATGGAGATAGAGTAGAATGATGG - Intergenic
1123655539 15:22514250-22514272 ATGGAGATAGAGTAGAATGATGG + Intergenic
1123805172 15:23863337-23863359 ATGGAGGCTCAGAAGCAGAAAGG + Intergenic
1124205558 15:27716066-27716088 ATGGAGATGGAGAAGAAGGGTGG - Intergenic
1124273209 15:28302172-28302194 ATGGAGATAGAGTAGAATGATGG - Intronic
1124309446 15:28609445-28609467 ATGGAGATAGAGTAGAATGATGG + Intergenic
1124557798 15:30744081-30744103 TTGGAGATAGAGAAGAAGCATGG + Intronic
1124673438 15:31661575-31661597 TTGGAGATAGAGAAGAAGCATGG - Intronic
1125546909 15:40512631-40512653 ATGGAGACAAAAAAGCTGGAGGG - Intergenic
1126431314 15:48588004-48588026 CTGGAGAAGCAGCAGAAGGAAGG + Intronic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1126496377 15:49295147-49295169 AAGAAGAAAGAGAAGAAGGAGGG + Intronic
1126620466 15:50634381-50634403 ATAAACAAACAGAAGAAGGAGGG - Exonic
1126715864 15:51516795-51516817 TTAGAGACTCAGAAGAGGGAGGG - Intronic
1126904893 15:53353972-53353994 ATGGAGATAGAGTAGAAGGATGG - Intergenic
1127155324 15:56118369-56118391 ATGGAGATACAGTAGGATGATGG - Intronic
1127295508 15:57605290-57605312 ATGGAGACAAAGTAAAAGAAGGG + Intronic
1127449526 15:59103277-59103299 TTAGAGACTCAGAAGAGGGAGGG - Intergenic
1127747925 15:61999856-61999878 AGGGAGAGAAGGAAGAAGGAAGG + Intronic
1128077459 15:64836607-64836629 ATTGAGTCACCAAAGAAGGAAGG - Intergenic
1128078012 15:64840620-64840642 AAGGAGAGAGAGAGGAAGGAGGG - Intergenic
1128541670 15:68539202-68539224 ACAGAGACATAGCAGAAGGAAGG - Intergenic
1128716809 15:69914521-69914543 AGAGAGAGACAGAAGGAGGAGGG - Intergenic
1129329153 15:74818027-74818049 AAAGAGAGAGAGAAGAAGGAGGG + Intronic
1129514147 15:76146683-76146705 CTGGGGACAAAGAAAAAGGAGGG + Intronic
1129645589 15:77428260-77428282 ATGGTAACAAAGAAGGAGGAAGG + Intronic
1129834952 15:78696578-78696600 ATGGAGATAGAGTAGAAGGATGG - Intronic
1129905653 15:79185468-79185490 AAGGAGAGAGAGAGGAAGGAAGG - Intergenic
1129949377 15:79572434-79572456 ATGGAGGGATGGAAGAAGGAAGG + Intergenic
1130127420 15:81105381-81105403 ATGGAGGAAGGGAAGAAGGAAGG - Intronic
1130182849 15:81648805-81648827 TTGGAGACTCAGAAGAAGGAAGG - Intergenic
1130185730 15:81679541-81679563 ATGGAGAAACAGAAAAAAGCAGG + Intergenic
1130797539 15:87225937-87225959 ATGGCCTCAGAGAAGAAGGAAGG + Intergenic
1130814597 15:87418051-87418073 AAGCAGACAGAGAAGTAGGAAGG + Intergenic
1130991232 15:88877268-88877290 ATGGAGACACAGAAAAGGGCTGG + Exonic
1131148297 15:90030393-90030415 ACTGAGGCACAGAGGAAGGAGGG + Intronic
1131307693 15:91259761-91259783 ATGGAGACACAGAGGCATCAGGG - Intronic
1131652179 15:94412062-94412084 ATGGAGCCACAGAATGAGGTAGG + Intronic
1132208618 15:100003824-100003846 ATAGAGACAAAGTAGAATGATGG + Intronic
1132342455 15:101087044-101087066 CTGGAGACAGAGGAGAAGGAGGG + Intergenic
1132612256 16:823001-823023 ATGTAGACACAGAAAAGTGATGG + Intergenic
1132945660 16:2530348-2530370 AAGGGGACACAGAAGATGGCAGG - Exonic
1133416898 16:5613866-5613888 AAGGAGTCAGAGAAGAAAGAGGG - Intergenic
1133537993 16:6720582-6720604 ATGGAGAAACAGAAGTGAGAGGG + Intronic
1133542090 16:6765962-6765984 TTGGAGACTCAGAAGATGGGAGG + Intronic
1133589546 16:7229541-7229563 AAGGAGAGAGAGAGGAAGGAAGG + Intronic
1133607940 16:7406433-7406455 AGGGTGACACAGTAAAAGGAAGG - Intronic
1133696258 16:8265838-8265860 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1133911460 16:10070001-10070023 TTAGAGAAACAGAAGTAGGAGGG - Intronic
1133927349 16:10203910-10203932 AGGGAGAGAGAGAGGAAGGAAGG + Intergenic
1134145282 16:11755807-11755829 ATGAAGACACAGAACAGAGAAGG + Intronic
1134287966 16:12879084-12879106 AAGGAGGGAGAGAAGAAGGAAGG - Intergenic
1134287978 16:12879120-12879142 ATGGAGGGAGAGAAGGAGGAAGG - Intergenic
1134470088 16:14516976-14516998 AATCAGACACAGAAGAGGGAAGG + Intronic
1135007497 16:18839592-18839614 CTGGAGGGACAGAGGAAGGAAGG + Intronic
1135182359 16:20286919-20286941 TTGAAGCCACAGAAAAAGGATGG - Intergenic
1135200129 16:20430030-20430052 TTGGAGACTCAGAAGGAAGAAGG + Intronic
1135218560 16:20593564-20593586 TTGGAGACTCAGAAGGAGGAAGG - Intergenic
1135253655 16:20922864-20922886 CTGGAGACCCAGAAGAAAGCTGG + Intronic
1135543340 16:23349002-23349024 AAGGAGAGAAAGGAGAAGGAAGG - Intronic
1135618622 16:23933814-23933836 ATCGACAAACAGAAGATGGATGG - Intronic
1135973013 16:27086005-27086027 CTGGAGACTCAGAAGGTGGAGGG + Intergenic
1136076343 16:27819951-27819973 GTGGAGGCAGAGAAAAAGGAAGG + Intronic
1136090905 16:27919345-27919367 ATGGAGTCAGAGAGGAAGGTAGG - Intronic
1136507317 16:30713060-30713082 ATGGAGCGACAGAAAGAGGAGGG - Intronic
1137774075 16:51041086-51041108 ATGAAGACAAGGAAGAAGGAAGG + Intergenic
1137903603 16:52295948-52295970 ATGGAGACAGGGAAGAAGTAGGG + Intergenic
1138300809 16:55928404-55928426 CTGGAGACTCAGAAGGTGGAAGG + Intronic
1138462001 16:57154663-57154685 ATGGGGAAACTGAAGGAGGAAGG + Intronic
1138495889 16:57409181-57409203 CTGGGGACATAGAGGAAGGAAGG + Intronic
1138513921 16:57525556-57525578 ATGGAGACAGGGAAGTTGGAAGG - Intronic
1139004126 16:62550455-62550477 AAGCAGGGACAGAAGAAGGAAGG - Intergenic
1139054740 16:63168832-63168854 AAGAAGACACAGCAAAAGGATGG + Intergenic
1139144767 16:64310036-64310058 ATGAAGAAAGAGAAGAAGGAAGG + Intergenic
1139264307 16:65624696-65624718 CTGGAGACAGAGGAGAAAGAGGG - Intergenic
1139306442 16:65990268-65990290 ATAGAGAAAGAGAGGAAGGAAGG + Intergenic
1139553434 16:67689866-67689888 ATAGAGACAAAGTAGAATGATGG - Intronic
1139813914 16:69651173-69651195 ATGAAGGCAAAGAAGAAGAAAGG - Intronic
1139842715 16:69894504-69894526 ATGGGGACAGAGAAAAGGGATGG - Intronic
1140659629 16:77175435-77175457 TTGGAGACTCGGAAGAAGGTGGG + Intergenic
1141030387 16:80582631-80582653 TTAGAGACTCAGAAGGAGGAAGG + Intergenic
1141031919 16:80596599-80596621 ATGGAGGAACAGAAGGATGATGG + Intergenic
1141141657 16:81500382-81500404 AAGGAGAGAGAGAAGGAGGAAGG - Intronic
1141161081 16:81629545-81629567 AAGGAGACAGAGAGGGAGGAAGG - Intronic
1141177152 16:81728554-81728576 AAGGAGAGAGAGAGGAAGGAAGG - Intergenic
1141202857 16:81910939-81910961 ATGAAGACAAAGTAGAAGAAAGG - Intronic
1141221924 16:82078835-82078857 ATGGAGATAGAGTAGAAGGATGG + Intronic
1141275545 16:82584645-82584667 ATGGAGAAGAAGAAGAAGTAGGG + Intergenic
1141373412 16:83508042-83508064 AGAGAGAAAGAGAAGAAGGAAGG + Intronic
1141411643 16:83838262-83838284 AGGGAGAAAGAAAAGAAGGAAGG + Intergenic
1142034456 16:87854890-87854912 GTGGAGACACAGGTGAAGGGAGG - Intronic
1142303518 16:89272959-89272981 ATGGACACAGAGTAGAACGACGG + Intronic
1142879846 17:2875777-2875799 AGGGAGACAGAGAAGAGGAAGGG - Intronic
1143019953 17:3912202-3912224 ATGAAGACACAGGAGGAGTAAGG - Intronic
1143249427 17:5511811-5511833 ATGAAGAAAAAGAGGAAGGAAGG - Intronic
1143794820 17:9327978-9328000 AGAGAGAGACAAAAGAAGGAAGG - Intronic
1143924056 17:10353906-10353928 AAGGAGAGAGAGAGGAAGGAAGG + Intronic
1143947426 17:10605466-10605488 TTGGAGAAAGAGAAGGAGGAGGG + Intergenic
1144038541 17:11388341-11388363 ATAGAGCCACACAAGAAAGACGG - Intronic
1144348913 17:14375555-14375577 ATGGAGGGAGAGAGGAAGGAAGG - Intergenic
1144427050 17:15152979-15153001 ATGGAGCCAGAGAAGAACCAGGG - Intergenic
1144628214 17:16856348-16856370 ATGGTGACACACCAGGAGGAGGG + Intergenic
1144646149 17:16974929-16974951 AAGGAGAAAGAGGAGAAGGAAGG + Intergenic
1145159806 17:20566915-20566937 ATGGCGACACACCAGGAGGAGGG + Intergenic
1145829896 17:27907450-27907472 ATGGAGAGTCAGAGGAAAGAGGG + Intergenic
1146097659 17:29947401-29947423 ATGGAGACTCAGAAGTGGGAGGG + Intronic
1146294927 17:31642036-31642058 ATGCAGACACACCAGAATGAAGG - Intergenic
1146373478 17:32279762-32279784 ATGGAGAAACAGAGGCAGGGTGG + Intronic
1146460020 17:33038957-33038979 ATGCAGACACAAAGGAGGGAAGG - Intronic
1146799513 17:35807480-35807502 TTGGAGAGACAGAAATAGGAAGG - Intronic
1146917905 17:36689942-36689964 ATGCAGAGACAGAACAAGAAAGG - Intergenic
1146951865 17:36912556-36912578 AAGGCCACACAGATGAAGGAGGG - Intergenic
1146954658 17:36930513-36930535 ACGGAGACAATGAAGACGGATGG + Intergenic
1147364337 17:39950651-39950673 ATGGAGATGCTGAAGAAGGGGGG + Intergenic
1147533829 17:41304721-41304743 ATGAATACAGACAAGAAGGAGGG - Intergenic
1147702323 17:42403939-42403961 ATGGAAAAATAGAAGAAGGTCGG - Exonic
1147946815 17:44084989-44085011 GTTGAGAGCCAGAAGAAGGAGGG + Intronic
1148001556 17:44390520-44390542 ATGGAAACACACACTAAGGATGG + Intergenic
1148002355 17:44397330-44397352 TTAGAAACACAGAAGAGGGAGGG + Intronic
1148019935 17:44547101-44547123 ATGGAGGCTCAGGAGAAGGGGGG + Intergenic
1148065838 17:44869104-44869126 ATGGAGACAGAGAAGTCTGAAGG - Intronic
1148387015 17:47241484-47241506 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1148446235 17:47739287-47739309 ATGGAGACACAGGAAGAGGCTGG - Intronic
1148547351 17:48528501-48528523 ATGGAGAAACAGAAGCAGGCAGG + Intergenic
1148571909 17:48677163-48677185 AGGAAGACCCTGAAGAAGGAAGG - Intergenic
1148783890 17:50135859-50135881 AGGGAGGCACAGAAGTTGGAGGG - Intronic
1148947982 17:51282462-51282484 ATGAAGAGAAAGAGGAAGGAAGG + Intronic
1149000019 17:51747851-51747873 GGGGAGGCATAGAAGAAGGAGGG - Intronic
1149143833 17:53466034-53466056 ATGCATAAACAGAGGAAGGAAGG + Intergenic
1149235658 17:54587707-54587729 ATAGAGATTCAGTAGAAGGATGG + Intergenic
1149275350 17:55027400-55027422 TTGGAGACTCAGAAGGGGGATGG + Intronic
1149337820 17:55655322-55655344 GTGGAGAGAGAGAAGAAAGAAGG - Intergenic
1149620293 17:58039779-58039801 GTGCAGCCACAGAAGAAGGAGGG + Intergenic
1150466829 17:65400698-65400720 AAGGAGAAACAAAAGAAGGAAGG - Intergenic
1150771996 17:68050193-68050215 AGAGAGAAAGAGAAGAAGGAAGG - Intergenic
1150772007 17:68050257-68050279 AGAGAGAAAGAGAAGAAGGAAGG - Intergenic
1150822207 17:68444838-68444860 ATGGAGGGAGGGAAGAAGGAAGG - Intronic
1150917413 17:69450883-69450905 ATGCAGACACACAAAAAGGAGGG + Intronic
1151377935 17:73704170-73704192 AGGGAGAGAGAGAGGAAGGAAGG - Intergenic
1151867825 17:76816051-76816073 AGGGAGAGAAGGAAGAAGGAAGG + Intergenic
1152003234 17:77660432-77660454 AGGGAGGGAGAGAAGAAGGAAGG - Intergenic
1152850922 17:82634980-82635002 ATGGAGACAGAAAAGTAGCACGG + Intronic
1152913082 17:83016625-83016647 GAGGAGGGACAGAAGAAGGAGGG + Intronic
1153299161 18:3577599-3577621 GAGGAGACAGAAAAGAAGGAGGG + Intronic
1153568203 18:6441863-6441885 AAGGAAAGAAAGAAGAAGGAAGG - Intergenic
1155087242 18:22470614-22470636 ATGGAGGCACAGAAAAGGGCCGG + Intergenic
1155128501 18:22904420-22904442 CTTGAGACACAGAAGAAGACTGG + Intronic
1155315134 18:24563740-24563762 ATGGAGACTCAGAAGGGGGACGG - Intergenic
1155315410 18:24566323-24566345 AAGGAGACAGAGAGGAAGAAAGG - Intergenic
1155317045 18:24582257-24582279 ATTGAGACGGAGAAGAAGGGAGG - Intergenic
1155317201 18:24583849-24583871 ATGCAGACAGAGTAGAAGGATGG - Intergenic
1155767922 18:29659099-29659121 ATGGAGATAGAGTAGAATGATGG + Intergenic
1155771342 18:29704342-29704364 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1155905190 18:31442329-31442351 AGGGAGACAGACAAGGAGGAGGG + Intergenic
1156021690 18:32606636-32606658 AAGGAGGCACTGAAGAAGGTAGG - Intergenic
1156048133 18:32900237-32900259 ATGGAGACAAGGAAGTAGGAGGG + Intergenic
1156310576 18:35918543-35918565 GTGGAGACCCAGAGGAGGGAAGG - Intergenic
1156692608 18:39726539-39726561 ATAGAGCCACAGAAGGAGCAGGG - Intergenic
1156768543 18:40689609-40689631 AAGGAGAAAAAGAAGGAGGAGGG - Intergenic
1157382545 18:47232560-47232582 CTGGGGACACAGAGGAGGGATGG - Intronic
1157576425 18:48746800-48746822 ATGGAGACAGAGAAGTAGTGGGG - Intronic
1157621155 18:49018169-49018191 AGGAAGACACAGGAGAAGGAAGG + Intergenic
1157656209 18:49391646-49391668 CTGGAGAGACAGAAGAATAAAGG + Intronic
1158205804 18:54991029-54991051 AGGGAGAGAGAGAGGAAGGAAGG + Intergenic
1158367696 18:56757172-56757194 ATGGGAAAACAGAAGTAGGAAGG + Exonic
1158369557 18:56784434-56784456 ATGGAGACTCAGAAGGGGAAGGG - Intronic
1158465619 18:57687269-57687291 ATAGAGACAAAGCAGAATGATGG - Intronic
1158487272 18:57878687-57878709 ATGAAGACACAGAGGAACAATGG + Intergenic
1158816423 18:61103169-61103191 CTGGAGACTCAGAAGCAGGGAGG + Intergenic
1158882643 18:61795872-61795894 AGGGAAGAACAGAAGAAGGAAGG + Intergenic
1159274014 18:66192307-66192329 ATGAAGCCACAGATGGAGGAAGG - Intergenic
1159376744 18:67603234-67603256 AGACAGACACAAAAGAAGGATGG + Intergenic
1159446771 18:68550509-68550531 ATGAAGACAGAGTAGAATGATGG + Intergenic
1159446854 18:68551414-68551436 ATGAAGACAGAGTAGAATGACGG - Intergenic
1159491498 18:69140743-69140765 ATGGAGCAAGAGAAGAAGAAGGG + Intergenic
1159522813 18:69547735-69547757 ATGGAGAGAGAGTAGAATGATGG - Intronic
1159801301 18:72903244-72903266 TTGGAGAATCAGAAGAAGGGAGG - Intergenic
1159831217 18:73280308-73280330 ATGTAGACAAGGACGAAGGAAGG + Intergenic
1161023826 19:2025515-2025537 AAGGAGAGAGAGAGGAAGGAGGG - Intronic
1161258362 19:3322108-3322130 ATGGGGACATGGAAGGAGGAGGG + Intergenic
1162756585 19:12864564-12864586 ATGGAGACTCAAAGAAAGGATGG - Intronic
1162877779 19:13633642-13633664 AGAGAGACAGAGAGGAAGGAAGG - Intergenic
1162877783 19:13633678-13633700 AGAGAGAGACAGAGGAAGGAAGG - Intergenic
1162877797 19:13633794-13633816 AGAGAGAGACAGAGGAAGGAAGG - Intergenic
1162877816 19:13633927-13633949 AGAGAGAGACAGAGGAAGGAAGG - Intergenic
1162877820 19:13633959-13633981 AGAGAGAGACAGAAGAAGGAAGG - Intergenic
1163081421 19:14946017-14946039 ATGGAAACAGAGTAGAATGATGG - Intergenic
1163204909 19:15795219-15795241 AAGTAGGCAGAGAAGAAGGAAGG - Intergenic
1163229300 19:15989310-15989332 CTGGAGACTCAGAAGAGGGAAGG - Intergenic
1164397501 19:27878816-27878838 AAGGAGAAAAAGAAGAAGTAGGG + Intergenic
1164425976 19:28142317-28142339 ATGGAGAGAGAGAGGAAGAAAGG + Intergenic
1164443850 19:28300544-28300566 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1164464386 19:28475182-28475204 ATGGAGACACAAGAGAAAGAAGG - Intergenic
1164554780 19:29243180-29243202 TGGGAGACAGGGAAGAAGGAAGG - Intergenic
1164588640 19:29494333-29494355 ATGGAGGAAGGGAAGAAGGAAGG + Intergenic
1164648648 19:29876377-29876399 CAGGAGACACAGAAGGAGGCTGG - Intergenic
1164794497 19:31015048-31015070 AGAGAGACAGAGAGGAAGGAAGG + Intergenic
1164901388 19:31928515-31928537 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1164916773 19:32058311-32058333 AGGGAGAGAGGGAAGAAGGAAGG - Intergenic
1164922742 19:32101799-32101821 ATGGAGACTCAGAAGGGGGTGGG - Intergenic
1164930566 19:32172591-32172613 ATGGGGCCCCAGATGAAGGAAGG - Intergenic
1165015082 19:32874926-32874948 TTGGAGAGAAAGAAGAAGGGCGG - Intergenic
1165188855 19:34045288-34045310 AGAGAGAGAGAGAAGAAGGAAGG + Intergenic
1165322627 19:35095606-35095628 AGGGAGAGAGAGAGGAAGGAAGG + Intergenic
1165474613 19:36023354-36023376 ATGGAGACCCAGAGGCAGGAAGG - Intronic
1165885344 19:39074138-39074160 AAGGAGAGAGAGAGGAAGGAAGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166169917 19:41020642-41020664 ATGGAGATAGAGTAGAATGATGG - Intergenic
1166206344 19:41272084-41272106 ATGAAGACAGAGATGAAGCAAGG + Exonic
1166295421 19:41887148-41887170 ACGGAGCTACAGAAGCAGGAAGG + Intronic
1166349669 19:42190089-42190111 AGGAAGACAGAGAAGAGGGAAGG + Intronic
1166388432 19:42395467-42395489 ATGGTGACACAGAAAAACGATGG + Intergenic
1166490539 19:43257157-43257179 ATAGAGACAAAGTAGAATGATGG + Intronic
1166624436 19:44337186-44337208 AAGAAGAAACACAAGAAGGAAGG - Intronic
1166991514 19:46695641-46695663 ATGGAGACAGAGAACCAGGAAGG + Intronic
1167114076 19:47478877-47478899 TTGGAGATTCAGAAGCAGGAAGG + Intronic
1167373258 19:49097289-49097311 CTCGAGACACAGAAAAAGGGAGG - Intronic
1167418440 19:49389417-49389439 ACGGGGACACTGAAGCAGGATGG - Intronic
1167419999 19:49397255-49397277 ATGGAGACAGAGAGGAGGGGTGG + Intronic
1167476285 19:49703188-49703210 AAGGAGACAGAAAAAAAGGAAGG - Intronic
1167601370 19:50456858-50456880 ATGGAGGTACAGATGATGGATGG - Intronic
1167604299 19:50473288-50473310 AGGGAGAAATAGAGGAAGGAGGG - Intronic
1167671969 19:50858743-50858765 AGGGAGTCAAAGAAGAGGGAAGG - Intronic
1167691752 19:50989258-50989280 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1167723677 19:51196607-51196629 TTGGAGACTCAGAATGAGGAAGG - Intergenic
1167789705 19:51666637-51666659 AGGGAGAAAGAGAGGAAGGAAGG + Intergenic
1167889571 19:52528568-52528590 ATGTACACAGAGATGAAGGACGG + Intronic
1168106545 19:54168959-54168981 AGAGAGAGAAAGAAGAAGGAAGG - Intronic
1168361193 19:55742063-55742085 ATAGAGACAAAGTAGAATGATGG + Intergenic
1168379005 19:55904440-55904462 ATAGAGACTCAGATGAAGCAAGG - Intronic
925228637 2:2209424-2209446 ACGGAGATAGAGTAGAAGGATGG - Intronic
925470138 2:4152107-4152129 AGGCAGACAAAAAAGAAGGAAGG - Intergenic
925470461 2:4155760-4155782 ATGGATAAACAGATGATGGATGG - Intergenic
925684079 2:6453285-6453307 AGGGAGAGAGAGAAGAAGGAAGG + Intergenic
925862619 2:8194527-8194549 AGGGAGAAAGAGAGGAAGGAAGG - Intergenic
925881709 2:8358120-8358142 AGGGAGAGACAGGAGATGGAGGG + Intergenic
925911181 2:8574572-8574594 TCAGGGACACAGAAGAAGGAGGG + Intergenic
926116355 2:10216044-10216066 AGAGAGAGAAAGAAGAAGGAAGG + Intergenic
926173709 2:10570278-10570300 ATGGTGAGACAGGAGGAGGAAGG + Intergenic
926221869 2:10941704-10941726 AGGGAAACCCAGGAGAAGGATGG + Intergenic
926346706 2:11953650-11953672 ATGGAAAGAAATAAGAAGGAAGG + Intergenic
926366075 2:12134042-12134064 ATGGAGAGAGGGAAGGAGGATGG - Intergenic
926414184 2:12632884-12632906 ATGGAGCCTAAGAAGAAGCATGG - Intergenic
926543243 2:14206804-14206826 ATGGAAGCAAAGAAGTAGGAAGG + Intergenic
926818365 2:16824240-16824262 AAGGAGAGATAGAAGAAGGAAGG - Intergenic
926906942 2:17814827-17814849 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
926931849 2:18048854-18048876 ATGAAGACACAGGGGAAGGCTGG - Intronic
927060681 2:19416448-19416470 AAAGAGAGAAAGAAGAAGGAAGG - Intergenic
927273461 2:21239463-21239485 ATGGAGAAGAAGAAGAAGGAAGG - Intergenic
927350362 2:22105503-22105525 ACAGAGACACAGAGGAAGGAAGG + Intergenic
927454945 2:23241317-23241339 CTGGAGACAGAGCAGAAGGTGGG + Intergenic
927458266 2:23276046-23276068 ATGGAGAGACTGAGGAAGGAAGG - Intergenic
927659510 2:24981039-24981061 AAAGAGAGAGAGAAGAAGGAGGG + Intergenic
928031636 2:27784628-27784650 ATAAAGACACAGAAGGAGGAAGG + Intronic
928454711 2:31409104-31409126 ATGGAGATAGAGTAGAAGGATGG + Intronic
928738333 2:34319155-34319177 CTGGAGACAGATAAGAAGGGTGG - Intergenic
928742655 2:34373238-34373260 AGGGAGAGAGAGAGGAAGGAAGG - Intergenic
929560924 2:42955873-42955895 ATGTAGACAAAGATGAAGGAGGG - Intergenic
929625105 2:43398615-43398637 ATAGAAACTCAGAAGAAGGATGG + Intronic
929648911 2:43657906-43657928 TTGTAGATACAGAAGAAGGAGGG - Intronic
929757770 2:44781740-44781762 AGGGAGGCCCAGAAGAGGGAGGG - Intergenic
929861260 2:45679790-45679812 GAGGGAACACAGAAGAAGGAAGG - Intronic
930524527 2:52511060-52511082 ATGGAGACTCAGTAACAGGATGG + Intergenic
930686698 2:54316295-54316317 GTAGAGACACAGAAGATAGAAGG + Intergenic
931420513 2:62122922-62122944 ATGGAACCACAGCAGTAGGAGGG + Intronic
931812900 2:65872382-65872404 AAGGGGACAAAGAGGAAGGAGGG + Intergenic
931905420 2:66837504-66837526 ATGAAGACAGAGTAGAATGATGG - Intergenic
932287133 2:70544834-70544856 ATGGAGACAGAGTCGAATGATGG + Intronic
932504948 2:72219907-72219929 ATGGAGACACAGTTGAAGACGGG + Intronic
932957155 2:76365991-76366013 AAGGAGAGAGAGAGGAAGGAAGG - Intergenic
932961644 2:76419292-76419314 AGGAAGAAACAGAGGAAGGAAGG - Intergenic
932969875 2:76527843-76527865 AGGGAGAGAGAGAGGAAGGAAGG - Intergenic
933018133 2:77157261-77157283 AGGGAGAAAGTGAAGAAGGAAGG + Intronic
933141438 2:78795743-78795765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
933388670 2:81643749-81643771 ATGGAGACAGAGTATAAGGATGG + Intergenic
933715170 2:85354686-85354708 ATGGAAACCCAAAAGAAGTACGG - Intronic
933904903 2:86882292-86882314 TTGGAGACTCAGAAGGAGGAGGG + Intergenic
933996933 2:87677014-87677036 ATGAAGGCACAGAAGCAAGACGG + Intergenic
934121817 2:88847571-88847593 AGAGAGACAGAGAAGAGGGAAGG + Intergenic
934325370 2:92009231-92009253 AGGGAGACAGAAAGGAAGGATGG + Intergenic
934613902 2:95759651-95759673 ATGGATAGACAGATGAAAGATGG + Intergenic
935013515 2:99157722-99157744 ACGGACATACAGAAGAAGGAGGG - Intronic
935265754 2:101392453-101392475 AATGACACACAGAAGGAGGAAGG + Intergenic
935309970 2:101773763-101773785 ATGGAGATATAGTAGAAGGATGG - Intronic
935422764 2:102887000-102887022 AGGGAGGCAGAGAAGAAGGGAGG - Intergenic
935643634 2:105314110-105314132 GTGAAGACACAGAAAGAGGAAGG + Intronic
935813437 2:106823820-106823842 GTGAAGACACAGCAGAAAGATGG - Intronic
936296917 2:111273896-111273918 ATGAAGGCACAGAAGCAAGACGG - Intergenic
936367325 2:111869870-111869892 TTGGAGACTCAGAAGGAGGAGGG - Intronic
936580027 2:113691493-113691515 ATGGAGACTCAGAAGGGGGAGGG - Intergenic
936885486 2:117306269-117306291 ATGGAGAGAGAGTAGAAGGATGG + Intergenic
936895746 2:117425552-117425574 ATGAAGACACAGGAAAAAGATGG + Intergenic
937064432 2:119006514-119006536 AAGGAGACCCAGAGCAAGGATGG + Intergenic
937108340 2:119340269-119340291 GTGGAAACAGAGAAGCAGGACGG + Exonic
937345966 2:121125482-121125504 AAGGAGAAGGAGAAGAAGGAAGG + Intergenic
937350132 2:121155423-121155445 AAGGAGACAGAGAGGAAGAAAGG + Intergenic
937869114 2:126775202-126775224 ATGGATACCCAGAACAAGGCTGG - Intergenic
937934882 2:127235320-127235342 AAGGAGAAAGAGAGGAAGGAAGG + Intergenic
938657909 2:133453725-133453747 AGGAAGAAACAAAAGAAGGAAGG + Intronic
938671189 2:133588386-133588408 AGGGAGAGAGGGAAGAAGGAAGG - Intergenic
938676063 2:133635204-133635226 ATGCAGACAGAGGAAAAGGAAGG + Intergenic
938700896 2:133878359-133878381 ATGGAGATACAGAACCAGGCAGG + Intergenic
938774237 2:134527320-134527342 ATAGAGAGAGAGAGGAAGGAAGG + Intronic
938963209 2:136361485-136361507 ATGGAGAGAGAGAAGGAAGAAGG - Intergenic
939038768 2:137163465-137163487 ATTGAGACACAGAAGAAGAGAGG + Intronic
939223749 2:139338755-139338777 ATGATGACACAAAAGAAAGAAGG + Intergenic
939276590 2:140005573-140005595 ATGGAGATAGAGAAGAATGATGG + Intergenic
939338887 2:140867737-140867759 ATAGAGACACAGCAAAGGGATGG + Exonic
940153684 2:150630341-150630363 ATGAAGACACACAGAAAGGAAGG + Intergenic
940286579 2:152038549-152038571 CTGGAGGCACAGAAGAGGAAAGG + Intronic
940322173 2:152389303-152389325 ATGAAGATACAGCAGAAGGATGG - Intronic
940347281 2:152640775-152640797 AAGGAGACTGAGAAGAAAGAAGG - Exonic
940545974 2:155085858-155085880 ATGCAGACTCAGAAGGAGGAGGG + Intergenic
940572032 2:155448388-155448410 ATGGAGCCCTTGAAGAAGGATGG - Intergenic
940575120 2:155493716-155493738 AAGGAGAGAGAGAGGAAGGAAGG - Intergenic
940578456 2:155546182-155546204 AGGGAGAGACAGAACAAGGGAGG + Intergenic
940660857 2:156543585-156543607 CTGGAAACACAGAAGAGGGAAGG + Intronic
940733879 2:157427131-157427153 ATAGACACACAGAAGGAGGAAGG + Intronic
940820286 2:158346422-158346444 AGGGACATACAGAAGAAGCAAGG - Intronic
940867302 2:158830023-158830045 AGGGAAACACAGCAGAAGGAGGG + Intronic
940922256 2:159321721-159321743 ATGGAAACAGAGTAGAAGGATGG + Intronic
941309619 2:163912599-163912621 ATGGGGAGCCAGAAGAGGGATGG - Intergenic
941348572 2:164402485-164402507 ATGGACAGAGAGTAGAAGGATGG + Intergenic
941990567 2:171552421-171552443 ATGGGGAGACAGAAGAAGGGAGG - Intronic
942430450 2:175905825-175905847 ATGGAGATTCAGAAGCATGAGGG - Intergenic
942473331 2:176286422-176286444 TTGAAAACACAGAAAAAGGAAGG - Intronic
942612366 2:177755544-177755566 ATGGGGTCGCAGCAGAAGGAGGG - Intronic
942741436 2:179183859-179183881 AGAGAGACAGAGAGGAAGGAAGG + Intronic
942810198 2:179990571-179990593 AGAGAGAGAAAGAAGAAGGAGGG + Intronic
942852634 2:180508176-180508198 AAGGAGATAGAGTAGAAGGATGG - Intergenic
943069708 2:183126020-183126042 AGGGAGAGAGGGAAGAAGGAAGG - Intronic
943322624 2:186464447-186464469 TTAGAGACTCAGAAGTAGGAGGG + Intergenic
943330781 2:186556369-186556391 AGGGAGAAAGAGAGGAAGGAAGG - Intergenic
943344144 2:186717558-186717580 AAGGAGACAGAGAAGTGGGAGGG - Intronic
943453455 2:188074313-188074335 ATCAAGATACAGAAGAAGGTTGG - Intergenic
943575936 2:189631096-189631118 AGGGAGAAAGAAAAGAAGGAAGG + Intergenic
943794321 2:191972535-191972557 AAGGGGACACAGAGGAAGCAGGG + Intronic
943795607 2:191989304-191989326 ATGGAAACTCAGACCAAGGATGG + Intronic
943805624 2:192121429-192121451 GTGGAGACAAAGTAGAAGGAGGG + Intronic
943831650 2:192471783-192471805 AAGGAGACACTGAAGAGGGTAGG + Intergenic
944902783 2:204232599-204232621 ATGGAGAAACAGGAGAAGAAAGG + Intergenic
944967884 2:204956569-204956591 ATGGAGACACAAAACAAGCTGGG - Intronic
945028674 2:205643337-205643359 AGGGAGACAATAAAGAAGGAGGG + Intergenic
945169801 2:206983548-206983570 ATGGGGACTCAGCAGAAGGCAGG + Intergenic
946156320 2:217809104-217809126 ATGGAGATACAGATGGATGAAGG + Intronic
946185245 2:217977225-217977247 CTGGATAAACAGAACAAGGAGGG + Intronic
946210469 2:218143535-218143557 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
946647294 2:221851535-221851557 ATGGAGCCACAGAGGTGGGACGG - Intergenic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
946998911 2:225430104-225430126 AGGGAGACAAAGAAGAAGAGAGG - Intronic
947029942 2:225782598-225782620 AGGGAGAAACAGAGGGAGGAAGG - Intergenic
947280657 2:228450090-228450112 GTAGAGACACAGAAGTAAGATGG + Intergenic
947295663 2:228627759-228627781 AAGGAGAAGAAGAAGAAGGAGGG - Intergenic
948287406 2:236796608-236796630 AGAGAGAGAAAGAAGAAGGAAGG - Intergenic
948371932 2:237495142-237495164 ATGGAGGCACAGGTGAGGGAGGG - Intronic
949021866 2:241745312-241745334 GTGGAGACACAGCAGCAGGCAGG - Intronic
1168773208 20:428996-429018 ATCGTGGTACAGAAGAAGGACGG + Exonic
1168891344 20:1296942-1296964 ATGGAAAACCAGAAGAAGGCTGG - Intronic
1168974390 20:1953201-1953223 AGGGAGAGAGAGAAGGAGGAAGG + Intergenic
1169083255 20:2810604-2810626 TTGGAGACTCAGAAGGAGGAGGG - Intergenic
1169274996 20:4227742-4227764 AGAGAGAGAGAGAAGAAGGAAGG - Intronic
1169323214 20:4652615-4652637 ATGGAGACTCAGAAGTGGGGAGG - Intergenic
1169502911 20:6178177-6178199 ACAGAGACACAGAAGGAGGATGG + Intergenic
1169546721 20:6657886-6657908 ATGGAGATAGGGAAGAAAGAAGG + Intergenic
1169748250 20:8964736-8964758 AGGGAGAAACAGAGGAATGAAGG + Intronic
1169848953 20:10029225-10029247 AGAGAGAGAGAGAAGAAGGAAGG + Intronic
1169971748 20:11275896-11275918 AGGGACAAAGAGAAGAAGGAAGG - Intergenic
1170140959 20:13124548-13124570 AGGAAGTCATAGAAGAAGGACGG + Intronic
1170587045 20:17742676-17742698 CTGCAGATAGAGAAGAAGGAGGG + Intergenic
1171822667 20:29868392-29868414 ATGGAGAATCAGGAGAAAGAAGG + Intergenic
1172112609 20:32556173-32556195 ATAGAGACACAGAGGGAGGCAGG - Intronic
1172133686 20:32673230-32673252 CTGGAGCCACAGAGGCAGGAGGG + Intergenic
1172546517 20:35765994-35766016 GTGGAGAGCCAGAGGAAGGAAGG - Intergenic
1172747647 20:37225240-37225262 TAGGAGACACAAAAGAAAGAAGG - Intronic
1173037190 20:39423680-39423702 AAAGAGACACAGCACAAGGAGGG - Intergenic
1173131946 20:40402194-40402216 ATGGGGAGTCAGAAGAAGTAAGG - Intergenic
1173180755 20:40804660-40804682 AGGGAGACAGGGAGGAAGGATGG + Intergenic
1173454384 20:43190967-43190989 GTGCTGACACAGAAGAAGGAGGG - Intergenic
1173564125 20:44027322-44027344 ACGGGGAAACATAAGAAGGAGGG - Intronic
1173917890 20:46723138-46723160 ATGGAAATATAGAAGAAGAATGG - Intronic
1174158217 20:48531062-48531084 ATGGCAGCCCAGAAGAAGGACGG + Intergenic
1174166093 20:48584539-48584561 AAGGGGACGTAGAAGAAGGAAGG - Intergenic
1174202073 20:48813653-48813675 ATGGAGACAGGGAAGAAGAAAGG + Intronic
1174275508 20:49400967-49400989 ATGGATGAATAGAAGAAGGAAGG - Intronic
1174560575 20:51428095-51428117 AGGGAGAGAGGGAAGAAGGAAGG + Intronic
1174793695 20:53503804-53503826 AGGGAGACAGGGAGGAAGGAGGG + Intergenic
1175040577 20:56046458-56046480 TTAGAGACTCAGAAGAAAGAGGG + Intergenic
1175273911 20:57754495-57754517 AGGGAGGGAGAGAAGAAGGAAGG - Intergenic
1175382676 20:58574641-58574663 ATGGAGAGATAGATGGAGGAAGG - Intergenic
1175749482 20:61485408-61485430 TTGGATCCACAGAGGAAGGAGGG - Intronic
1176231357 20:64034637-64034659 ATGGAGAGACGGAAGCATGAGGG + Intronic
1176668484 21:9709608-9709630 ATCAAGACGCAGAGGAAGGAAGG + Intergenic
1176957623 21:15124324-15124346 CAGGAGACAGGGAAGAAGGAGGG + Intergenic
1177024233 21:15902427-15902449 ATGGAGATAGAGTAGAAGGATGG + Intergenic
1177090432 21:16760682-16760704 AAAGAGACACTGCAGAAGGAAGG + Intergenic
1177401413 21:20610593-20610615 ATGGACACCAAGTAGAAGGATGG + Intergenic
1177491860 21:21836258-21836280 ACGAAGACAGAGAGGAAGGAAGG - Intergenic
1177911934 21:27043626-27043648 AGGGAGACATAGAAGCAGGTGGG + Intergenic
1178072443 21:28983655-28983677 ATGGAGAGCCACAGGAAGGATGG + Intronic
1178191521 21:30287523-30287545 ATGGAGGGAGGGAAGAAGGAAGG + Intergenic
1179068082 21:38045111-38045133 TAGTAGACACAGAAAAAGGAGGG - Intronic
1179076150 21:38123585-38123607 ATGGAGGCACAGAGGAAGTTGGG + Intronic
1179176760 21:39013528-39013550 AGGGAAACACAGCAGAAGGCAGG + Intergenic
1179185399 21:39081804-39081826 AAGGAGAAGGAGAAGAAGGAGGG + Intergenic
1179244793 21:39623282-39623304 AAAGAGAAACAGAGGAAGGAAGG - Intronic
1179480303 21:41672544-41672566 ATGGAGAAACTGAGGCAGGACGG + Intergenic
1179547426 21:42122169-42122191 ATGGAGCCACTGCTGAAGGAGGG + Intronic
1179935884 21:44603058-44603080 GTGGAGACAGAGAAGGAGGCTGG + Intronic
1180324268 22:11354597-11354619 ATGGAGACTCAGAAGGGTGAAGG + Intergenic
1181090488 22:20469212-20469234 ATGGAAACACAGAACAGAGATGG + Intronic
1181382138 22:22514283-22514305 TTGGAGGCACAGCAGAAGGAGGG - Exonic
1181479491 22:23189350-23189372 ATGGAGACAGAGTAGAACGGTGG - Intronic
1181671198 22:24426331-24426353 AAGGACAGACAGAAGATGGATGG + Intronic
1181713468 22:24706673-24706695 ATGGAAACAGAGTAGAAGGGTGG - Intergenic
1181963284 22:26638406-26638428 AGGGAGAGAGAGAGGAAGGAGGG + Intergenic
1182048994 22:27298997-27299019 AAGGAGAAAGAGAAGAAGAAGGG + Intergenic
1182177894 22:28311845-28311867 ATGGAGATAGAGTAGAATGATGG - Intronic
1182763697 22:32743453-32743475 TTGGAGACAGAGGAGAGGGAGGG + Intronic
1182924453 22:34109248-34109270 ATGGAGACAGACAGGAAGGAAGG - Intergenic
1183034860 22:35133921-35133943 ATGGAGACAAGGGAGGAGGAAGG + Intergenic
1183090742 22:35520206-35520228 ATTGAGACACAGGGGAAGAAGGG + Intergenic
1183091100 22:35522770-35522792 AGGGAGAGAAAGAAGAAGGAAGG - Intergenic
1183141815 22:35948999-35949021 ATGGAGACAAAGTAGAATGCTGG - Intronic
1183349984 22:37329710-37329732 AGGGAGAGAAAGAAGAAAGAAGG + Intergenic
1183439648 22:37815979-37816001 AAGGAGACACAGAAGCTAGAGGG - Intronic
1183499311 22:38168940-38168962 ATGGACAAAGGGAAGAAGGAAGG - Intronic
1183618352 22:38958590-38958612 AGGGAGAAAGAGAGGAAGGAAGG - Intronic
1183698765 22:39438072-39438094 ATGGAGGGAACGAAGAAGGAAGG - Intergenic
1184120548 22:42447002-42447024 GAGGAGACACAGAGGAAAGAGGG + Intergenic
1184396990 22:44248156-44248178 AGGAAGACAGTGAAGAAGGAAGG - Exonic
1184521269 22:44995743-44995765 GTGGAGACAGAGATGAGGGAGGG + Intronic
1184934718 22:47712894-47712916 ATGGAGAGACAGAAAATGCAAGG - Intergenic
1184959117 22:47916076-47916098 AGGAAGAAAGAGAAGAAGGAAGG - Intergenic
1185191397 22:49438712-49438734 ATGGAATCACAGAAGATGAAGGG - Intronic
1185226043 22:49653361-49653383 ATGCAGACACTGGGGAAGGAGGG + Intronic
949161395 3:887192-887214 AGGGAGGGAAAGAAGAAGGAAGG - Intergenic
949499736 3:4668294-4668316 ATGGACACAGAGTAGAAGGATGG - Intronic
949508016 3:4744873-4744895 AGGGAGACAGAGAGGGAGGAAGG - Intronic
949741063 3:7235195-7235217 ATGGAAATACAAAGGAAGGAAGG - Intronic
949828641 3:8189807-8189829 ATGGATACAGAGTAGAATGACGG - Intergenic
950061093 3:10071638-10071660 ATGGAGATAGAGTAGAAGTATGG + Intronic
950138935 3:10601886-10601908 ATGAAGACAAATAAGAAAGAGGG - Intronic
950401711 3:12774076-12774098 ACAGGGACACAGAAGAGGGAAGG - Intergenic
950488277 3:13285582-13285604 ATGGAGACAGAGAATGAGCAAGG + Intergenic
950579934 3:13855500-13855522 AGGGGGCCACAGAAGAAGGGAGG - Intronic
950674123 3:14544491-14544513 CTGGAGTCAGAGATGAAGGACGG - Intergenic
951035161 3:17925046-17925068 AAGGAAAGAAAGAAGAAGGAAGG + Intronic
951134599 3:19089880-19089902 ATGGAGGGAAGGAAGAAGGAAGG + Intergenic
951292158 3:20884532-20884554 ATGGAGGCACACAAAATGGATGG + Intergenic
951292219 3:20885544-20885566 ATGGAGGCACACAAAATGGATGG - Intergenic
951397845 3:22192040-22192062 ATGGAGAAAGAGATGAATGATGG - Intronic
951526498 3:23657773-23657795 AGGGAGGGAGAGAAGAAGGATGG + Intergenic
951539174 3:23766016-23766038 ATGGAGAGACACAGGAAAGAAGG + Intergenic
951563163 3:23988057-23988079 AAAGAGAGAGAGAAGAAGGAAGG - Intergenic
951599940 3:24362493-24362515 ATGGAGAGAAAAAAGAAGAAGGG - Intronic
951951657 3:28205022-28205044 ATGGAAATACAAAAAAAGGAGGG + Intergenic
951966785 3:28395711-28395733 ATGGAAACAAAGTAGAAGGGTGG + Intronic
952108503 3:30095971-30095993 AGGGAGAAACAGAGGAAGGGAGG - Intergenic
952139330 3:30460428-30460450 ATGGAGATAGAGTAGAAGGATGG + Intergenic
952155768 3:30641906-30641928 AGGGAGAGAGAGAGGAAGGAAGG - Intronic
952174068 3:30842547-30842569 ATGGAGAAAGGGAGGAAGGAAGG + Intronic
952490212 3:33863456-33863478 AAGGAGACAGAGTAGAATGATGG - Intronic
952493147 3:33891235-33891257 TTGGAGACTCAGAAGAGAGAGGG - Intergenic
952557719 3:34552053-34552075 ACGGAGACAGAGAAGGAGGTAGG - Intergenic
952643374 3:35625390-35625412 TTGGAGACTCAGAAGTGGGATGG - Intergenic
952701154 3:36329002-36329024 AGGGAGACAGGGAAGAAAGAAGG + Intergenic
952708289 3:36402287-36402309 ATGGAGGGGAAGAAGAAGGAAGG + Intronic
952849144 3:37713475-37713497 ATTGAGCCACAGAGGGAGGAGGG + Intronic
953277297 3:41514762-41514784 ATGGAGACTCAGAAGGGTGAGGG + Intronic
953380464 3:42467520-42467542 ATGGAGACTCAGAAGGGTGAAGG + Intergenic
953691832 3:45126242-45126264 AGAGAGAGAGAGAAGAAGGAAGG - Intronic
953787720 3:45923215-45923237 AGGGAGAAATAAAAGAAGGAAGG - Intronic
954830069 3:53413487-53413509 AGAGAGAGAGAGAAGAAGGAAGG - Intergenic
955035641 3:55264571-55264593 ATGAGGAGAGAGAAGAAGGAGGG + Intergenic
955123390 3:56084690-56084712 TTGGAGACTTAGAAGCAGGAAGG + Intronic
955292766 3:57707772-57707794 ATGGAGACAGAGTAGAAGGATGG + Intergenic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
955488618 3:59460392-59460414 AGGGAGAAACAGGAAAAGGAAGG - Intergenic
955562195 3:60203905-60203927 GTGAAGACAGAGTAGAAGGATGG + Intronic
955644779 3:61125780-61125802 ATGGGGAAACAGGAAAAGGATGG + Intronic
955874539 3:63476050-63476072 AAGGAGAGAGAGAGGAAGGAAGG + Intronic
955874603 3:63476242-63476264 AAGGAGGGAGAGAAGAAGGAAGG + Intronic
955874646 3:63476375-63476397 AAGGAGGGAGAGAAGAAGGAAGG + Intronic
955874654 3:63476403-63476425 AGGGAGGGAGAGAAGAAGGAAGG + Intronic
956031075 3:65038772-65038794 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
956078368 3:65530867-65530889 ATGGAGAGAGAGAAAGAGGAGGG + Intronic
956856093 3:73276273-73276295 TTGGAGACTCAGAAGTAGGCTGG - Intergenic
956864654 3:73357086-73357108 AGGGAGGGTCAGAAGAAGGAAGG - Intergenic
957086661 3:75685952-75685974 ATGGAGACACAGCAGGGTGAGGG - Intergenic
957181516 3:76884924-76884946 ATGAAGACACAGAGGAGAGATGG + Intronic
957334163 3:78805326-78805348 ATTAAGAAACAAAAGAAGGAGGG - Intronic
957486017 3:80864299-80864321 ATGTTGACAGAGTAGAAGGATGG + Intergenic
957593787 3:82233957-82233979 AGGGTGAGAGAGAAGAAGGAAGG + Intergenic
957810599 3:85215990-85216012 AAAGAGACACTGAAGAGGGAAGG - Intronic
957900008 3:86477005-86477027 ATGGAGATAGAGTAGAATGATGG - Intergenic
958144965 3:89612428-89612450 AGGGAGAAAAAAAAGAAGGAAGG - Intergenic
958461124 3:94397254-94397276 ATGAAGACCCAGAAGGATGAGGG + Intergenic
958611386 3:96431099-96431121 ATGGGGACATAAAAGCAGGAAGG + Intergenic
958682173 3:97344907-97344929 ATGAAGGAACAAAAGAAGGAAGG + Intronic
958940043 3:100301509-100301531 ATGGAGATACACAAAAAGTATGG - Intronic
959007978 3:101042205-101042227 ATGGCTACAGAGAAGGAGGAAGG - Intergenic
959105831 3:102063539-102063561 ATGGAGGCAAGGAAGAGGGAAGG - Intergenic
959449504 3:106481397-106481419 ATGGCCACACAGAAAAGGGAAGG - Intergenic
959903908 3:111689690-111689712 GTGGAGGGAAAGAAGAAGGAGGG + Intronic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960066164 3:113375437-113375459 ATGGAGAAAGACAAAAAGGATGG + Intronic
960076204 3:113488586-113488608 TTGGAGACTCAGAAGGGGGAGGG + Intronic
960095562 3:113686391-113686413 AAGGAGACACTGAAGATGGTAGG - Intronic
961340191 3:126212538-126212560 AGGGAGAGAAGGAAGAAGGAAGG + Intergenic
961345503 3:126260850-126260872 ATGGGGAGAAAGAAGAGGGAAGG - Intergenic
961414730 3:126749039-126749061 AAGGAGACAAAGAATGAGGAGGG + Intronic
961542547 3:127609807-127609829 ACTGAGAAACAGAGGAAGGAAGG - Intronic
961614681 3:128169468-128169490 ACGGTGAGACAGAAGAAGGCAGG + Intronic
961952894 3:130769358-130769380 ATGGAGATGGAGTAGAAGGATGG + Intergenic
962139837 3:132777829-132777851 AGACAGACAGAGAAGAAGGATGG - Intergenic
962242026 3:133757720-133757742 ATGGCAACACAGAAGAAAGGAGG - Intronic
962347395 3:134628205-134628227 ATGGAAACAAAGATGCAGGAAGG + Intronic
962359572 3:134726544-134726566 AGGGAGAGAGAGAAGGAGGAAGG - Intronic
962627443 3:137239880-137239902 ATGGAGAAAGAGAGGAAGGTGGG + Intergenic
962952187 3:140229489-140229511 ATGGAGAAAAAGGAAAAGGAGGG - Intronic
962993676 3:140603852-140603874 ATGAATACACAGAAGTAGAATGG + Intergenic
963240092 3:142994502-142994524 ATGGAAACACAGGAGAAGATTGG - Intronic
963505150 3:146175728-146175750 TTGGAGCAACAGAAGTAGGAGGG - Intergenic
963802496 3:149690193-149690215 AGGAAGACAGAAAAGAAGGAAGG + Intronic
964088272 3:152844750-152844772 ATGTAGACAGAGAAGAAAAAAGG + Intergenic
964271734 3:154964008-154964030 AGGGAGAGAAAGAAGATGGAGGG - Intergenic
964526024 3:157616048-157616070 ATGGAGACAGGGAGGAAGGCGGG + Intronic
964779299 3:160317688-160317710 AAGGAAACACAGAAGATAGAGGG + Intronic
964891315 3:161539267-161539289 ATGGAGACAGAGTAGAATGGTGG - Intergenic
965099398 3:164277427-164277449 ATACAGAGACAGAAGGAGGAGGG + Intergenic
965379505 3:167970602-167970624 ATGGAGATAAAGTAGAACGATGG + Intergenic
965581938 3:170277910-170277932 ATGGAGGAACAGACGTAGGAAGG - Intronic
965678965 3:171230843-171230865 ATGGAGCCACAGGGGAAGGAAGG - Intronic
965712366 3:171568282-171568304 CCAGAGACACAGAAGAAGCATGG + Intergenic
965892051 3:173526771-173526793 ATGAAGACAGAGTAGAAGGATGG - Intronic
966678534 3:182615911-182615933 CTGGAGACAGAGAAGAAGTAAGG + Intergenic
967546080 3:190730293-190730315 ATAGAGACATAGAAGAACAAAGG - Intergenic
967584798 3:191199067-191199089 AGGGAGAAACTGAAGAAGGAAGG + Intergenic
967691568 3:192479979-192480001 ATTGAGAAAGAGAAGAAAGAAGG + Intronic
967830155 3:193911771-193911793 CTGAAGAGACAAAAGAAGGAGGG - Intergenic
967841973 3:194012895-194012917 ATGAAGACAATGAAGAAGGGAGG - Intergenic
967954288 3:194865801-194865823 ACTGAGACTCAGAAGTAGGAAGG + Intergenic
968134324 3:196210400-196210422 AGGGAGAGAGAGAGGAAGGAAGG + Intronic
968292861 3:197552470-197552492 ATGGAGACCCAGAACATGGAGGG - Intronic
968451615 4:678664-678686 AGGAAGACCAAGAAGAAGGAAGG + Exonic
968978660 4:3835053-3835075 ATGGAGAGAGAGAAGAGGGAAGG + Intergenic
969125790 4:4946844-4946866 ATGGAGATTCTGAAGCAGGATGG + Intergenic
969173291 4:5380849-5380871 ATTGAGACTCAGAGGAGGGAAGG + Intronic
969183277 4:5457906-5457928 ATGGAGGGAGAGAGGAAGGAAGG + Intronic
969481298 4:7448470-7448492 AGGGAGACATGGAAGAAGGAAGG - Intronic
969622374 4:8285082-8285104 ATGGAGACAGAGCAGAGAGAGGG - Intronic
970122162 4:12768182-12768204 AGGAAGAAAGAGAAGAAGGAAGG + Intergenic
970273164 4:14368493-14368515 ATGGAGAGCCAGAAGGGGGATGG + Intergenic
970432831 4:16004852-16004874 AGGGAGAGAGAGAGGAAGGAAGG - Intronic
970815377 4:20150094-20150116 GTGGGGACACAAAAGGAGGAAGG - Intergenic
971051767 4:22869977-22869999 AAGCAGACAGAGAAGAAGAATGG - Intergenic
971062427 4:22987586-22987608 GGGGAGACAGAGAGGAAGGATGG - Intergenic
971303686 4:25462585-25462607 ATGAAGACACAGCAAAAAGATGG - Intergenic
971393674 4:26209542-26209564 AGGGAGACAGGGAAGGAGGAAGG - Intronic
971393682 4:26209566-26209588 AGGGAGACAGGGAAGGAGGAAGG - Intronic
971394283 4:26214302-26214324 AAGGAGACAGAGAAGGAGGGAGG + Intronic
971592231 4:28482791-28482813 TTGGAGTCACAGGAGAAGAATGG + Intergenic
971676425 4:29635354-29635376 CTGGAGACCCAGAAGGATGAGGG + Intergenic
971861168 4:32108088-32108110 AGGGAGGTAGAGAAGAAGGAAGG + Intergenic
971887598 4:32473406-32473428 ATGGCGAGCCAGAAGAGGGATGG + Intergenic
972103175 4:35447596-35447618 AGGGAGAGAGAGAGGAAGGAAGG + Intergenic
972318238 4:37947750-37947772 TTGGAGACAAAGTAGAGGGAAGG + Intronic
972351936 4:38244187-38244209 ATGGAAACACAGCAGGATGAAGG - Intergenic
972444992 4:39135472-39135494 CTGGAGACATTGCAGAAGGAAGG - Intergenic
972924134 4:43983530-43983552 ATGGAGGCAAAAAGGAAGGAAGG + Intergenic
972926674 4:44016896-44016918 ACTGCCACACAGAAGAAGGAGGG + Intergenic
973251950 4:48069750-48069772 ACTGAGACATAGAAGGAGGAAGG - Intronic
973256658 4:48120022-48120044 ATGGTGATATAGGAGAAGGAGGG - Intronic
973291167 4:48472198-48472220 AGAGAGAAAGAGAAGAAGGAAGG - Intergenic
973307610 4:48670627-48670649 ATGGAGATAGAGTAGAAGGATGG - Intronic
973557135 4:52094947-52094969 AGGCAGACACAGAAGACAGATGG - Exonic
973563341 4:52159078-52159100 AAGGAGGGAGAGAAGAAGGAAGG - Intergenic
973779059 4:54271569-54271591 AGGGAGGGAGAGAAGAAGGAAGG - Intronic
974032797 4:56790990-56791012 ATGGAGACTCAGAAGAGGGAGGG - Intergenic
974329668 4:60461696-60461718 TGGGAGCCACAGAAGAAAGATGG + Intergenic
974837192 4:67265297-67265319 AGGGAGACACAGAAGGTGGGTGG - Intergenic
975030504 4:69608602-69608624 AGGGAGTCAGGGAAGAAGGAAGG + Intronic
975035670 4:69677275-69677297 ATAGACATACAGAAGAAGGATGG + Intergenic
975290482 4:72672115-72672137 TTGGAGACTCAGAAGTGGGAGGG - Intergenic
975519560 4:75285647-75285669 ATTGAGAGAAAGAAAAAGGAAGG + Intergenic
976152516 4:82106392-82106414 ATGGTAACTCAGTAGAAGGAAGG + Intergenic
976406661 4:84667046-84667068 ATGGAGACAGAGTAGAATGATGG + Intergenic
976527211 4:86107571-86107593 AAGGAGAAACAGGAGAAGGGGGG + Intronic
976810241 4:89092400-89092422 AGGGAGGGACAGAGGAAGGAAGG + Intronic
976830922 4:89312951-89312973 AGGGAGGCAGAGAGGAAGGAAGG - Intergenic
976848147 4:89513565-89513587 AGGGGGAGACAGAAGAAAGATGG - Intergenic
976960024 4:90958882-90958904 AAGTAGAGACAGAAGAAGGATGG - Intronic
976991426 4:91371340-91371362 ATGGGGACAGAGTAGAAAGATGG - Intronic
977146600 4:93448968-93448990 AGGGAGATGGAGAAGAAGGAAGG - Intronic
977505829 4:97903026-97903048 ATAGAAACAGAGTAGAAGGATGG + Intronic
977644705 4:99399857-99399879 ATGGAGATAGAGTAGAAAGATGG + Intergenic
977676058 4:99748464-99748486 ATGAAGACACTGAAGCTGGAAGG - Intergenic
977974549 4:103249023-103249045 CTGGAGACTCAGAAGCAGGGAGG - Intergenic
978021244 4:103815511-103815533 ATGAAGAAAAAGGAGAAGGAAGG - Intergenic
978062829 4:104359285-104359307 ATGGAGACAGAGTGGAGGGATGG + Intergenic
978132286 4:105213691-105213713 ATGGAGACTCATAGGAAGGTGGG - Intronic
978204462 4:106063803-106063825 ATGAAGACACAGCATAAAGATGG + Intronic
978404542 4:108365107-108365129 AAGAAGAAACAGAAGAAGGCAGG + Intergenic
978524521 4:109652094-109652116 ATGTACACCCAGAAGAAAGACGG - Intronic
978890483 4:113820659-113820681 CTGCAGAGACAGAAGAATGAAGG + Intergenic
979032045 4:115661649-115661671 CTGGATAAACAGCAGAAGGAAGG - Intergenic
979246410 4:118510061-118510083 ATGGAGAAAGAGAAGAAAAAAGG - Intergenic
979281463 4:118872827-118872849 ATGGAGACTCAAAAGGGGGAGGG - Intronic
979928375 4:126596610-126596632 TTGTAGACACAGAAGAGAGATGG + Intergenic
979940921 4:126761916-126761938 ATGCACACACAGAAGTAGGAAGG + Intergenic
980468757 4:133221536-133221558 ATGGAGACACAGAGGCTAGAAGG - Intergenic
980609017 4:135132407-135132429 AGAGAGAGAAAGAAGAAGGAAGG - Intergenic
980848136 4:138348774-138348796 TTAGAGACACAGAAGGAGGAAGG + Intergenic
981361589 4:143852065-143852087 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
981372326 4:143973046-143973068 TTGGAGACTCAGAAGCGGGAGGG - Intergenic
981663557 4:147195643-147195665 TAGGTGACACAGAAGAGGGAGGG + Intergenic
981730553 4:147892670-147892692 TTGGAGACTCAGAGGAAGGGGGG + Intronic
982188387 4:152826458-152826480 TTGGAGACTCAGAAGAGGGGAGG + Intronic
982335145 4:154227998-154228020 ATGGAGATAGAGTAGAATGATGG - Intergenic
982445800 4:155489486-155489508 GGGGAGACACAGTAGTAGGAAGG + Intergenic
982446135 4:155492522-155492544 ATGAAGACATAGAAGGAAGATGG + Intergenic
982473304 4:155820313-155820335 AGAGAGAAAGAGAAGAAGGAAGG - Intergenic
982504175 4:156197018-156197040 ATGGGGAGCCAGAAGAAGCATGG - Intergenic
982525346 4:156470939-156470961 ATTCAGAAGCAGAAGAAGGAAGG + Intergenic
982585382 4:157230590-157230612 ATGGAGGGAAGGAAGAAGGAAGG - Intronic
983477098 4:168226846-168226868 ATGCAGATAGAGTAGAAGGATGG + Intronic
983500933 4:168499222-168499244 AGGGAGACGGGGAAGAAGGAAGG + Intronic
983925356 4:173395426-173395448 ATGGAGACAAAGTGAAAGGAAGG - Intronic
984193723 4:176634034-176634056 AGGCAGACACAGAAGACTGAAGG + Intergenic
984288321 4:177761882-177761904 ATGGAGACAGAGACGACGCATGG - Intronic
984321770 4:178206677-178206699 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
984652705 4:182287282-182287304 ATGGAGACAGAGAACCAGGCAGG - Intronic
984678559 4:182579089-182579111 GTGGAGATACAGAAGAAGGCAGG - Intronic
984679696 4:182593404-182593426 ATGGAGGGACGGAAGAAGAAAGG - Intronic
984736478 4:183113268-183113290 ATGTAGAAACAGAGGGAGGAGGG + Intronic
984762848 4:183377361-183377383 AGGGAGGGAGAGAAGAAGGAAGG - Intergenic
984818922 4:183862762-183862784 AAGGAAACTCAGAAGAGGGAGGG + Intronic
984908842 4:184653088-184653110 AAGGAGGGAAAGAAGAAGGAAGG + Intronic
984978504 4:185254084-185254106 ATGGTGGCACAGAGGAAGCAAGG + Intronic
985052023 4:186000544-186000566 ATGGAGGAAAAGAAGATGGAAGG - Intergenic
985263198 4:188134252-188134274 ATGAAAGCACAGAAGAAGTATGG - Intergenic
985406295 4:189641900-189641922 ATCAAGACGCAGAGGAAGGAAGG - Intergenic
985703779 5:1389056-1389078 ATGGATGGACAGAAGAAGGGAGG - Intergenic
985817635 5:2138332-2138354 AGGGAGAGAGAGAGGAAGGAAGG - Intergenic
985819937 5:2152908-2152930 AAGGAGAGACAGAAGAAGAGAGG - Intergenic
985944765 5:3170550-3170572 ATGGAGATTTAGGAGAAGGACGG - Intergenic
986539946 5:8834415-8834437 CTGGAGACTCAGAACAGGGAAGG + Intergenic
986687498 5:10287474-10287496 ATGGAGACTCAGAAGGGGGAGGG + Intronic
986720479 5:10557526-10557548 ATGGGGACAAAGATGAAGGCAGG - Intergenic
986822834 5:11486579-11486601 AGGGAGAGACAGGGGAAGGAGGG + Intronic
986847280 5:11770192-11770214 AGGGAGAGACAGAAGAAGAATGG + Intronic
986936626 5:12896142-12896164 ATAAAGACACAGAAGAAAGAAGG + Intergenic
987015216 5:13811044-13811066 ATGGAGATAGAGTAGAAGGATGG + Intronic
987183221 5:15387654-15387676 AAGGATACACAAAAGAGGGAAGG + Intergenic
987206169 5:15628357-15628379 ATGGACCCAAAGAAGATGGATGG + Intronic
987433825 5:17868579-17868601 ATGGATATAGAGTAGAAGGATGG - Intergenic
987566371 5:19593530-19593552 AGGGAGAAGGAGAAGAAGGAAGG - Intronic
988070297 5:26279394-26279416 AGGGATACACAGAAGAAATATGG + Intergenic
988205339 5:28126516-28126538 ATGGAGAGCCAGAAGGGGGATGG - Intergenic
988458470 5:31410382-31410404 ATAGGGGCACAGAAGAAAGAAGG - Intronic
988736639 5:34028633-34028655 AGGGAGAGAAAGAAGGAGGAAGG - Intronic
988961823 5:36378541-36378563 AGGGAGACACATATGAGGGAGGG - Intergenic
988995699 5:36713077-36713099 AAGCAGACACAGAAAAAGCATGG + Intergenic
989214363 5:38888599-38888621 ATGGAGAAAGAAAAGAGGGAAGG - Intronic
989665232 5:43846324-43846346 AGGGAGACAGGGAGGAAGGAAGG - Intergenic
989784055 5:45305744-45305766 AAGAAGAAACAGAAGAAGGGAGG + Intronic
989981922 5:50655684-50655706 AGAGAGAAAAAGAAGAAGGAAGG - Intergenic
990317858 5:54601077-54601099 ATGGACAGACAGAGGGAGGACGG - Intergenic
990427444 5:55700864-55700886 AAGGAGACAGAGAAGGAGGAGGG - Intronic
990439390 5:55829555-55829577 AGGGTCACACAAAAGAAGGAAGG - Intergenic
990507491 5:56458947-56458969 AAGGAGGGAAAGAAGAAGGAAGG - Intronic
990756538 5:59078075-59078097 ATGGAGAGAAACAACAAGGAGGG - Intronic
990903313 5:60777058-60777080 ATGGAGATAGAGTAGAAGGGTGG + Intronic
991000261 5:61775655-61775677 ATGGAGACACGGAAGACGGAGGG + Intergenic
991063706 5:62403983-62404005 TTGGAGTCACAGAGGGAGGAAGG + Intronic
991411360 5:66348544-66348566 AAGCAGACTCAGGAGAAGGACGG + Intergenic
991517150 5:67449814-67449836 ATGGGCACACAGAAAAAAGAAGG - Intergenic
992239965 5:74757899-74757921 ATGAAGAAAAAGTAGAAGGATGG + Intronic
992261209 5:74972093-74972115 ATGAAGACACAGCAGCAGGGTGG + Intergenic
992403615 5:76434347-76434369 TTGGAGACTCAGAAAGAGGAGGG - Intronic
992904619 5:81334108-81334130 ATGGGGAGCCAGAAGGAGGATGG - Intronic
993045212 5:82858632-82858654 AGGGAGACACTGAAGGAAGAAGG - Intergenic
993054558 5:82967536-82967558 ATGGAGGCACAGAAGCAAGCTGG + Intergenic
993188104 5:84645940-84645962 ATGGGGAGCCAGAAGAGGGATGG - Intergenic
993418795 5:87673586-87673608 ATGGAGAAACGGAAAAAGCAAGG - Intergenic
993705299 5:91162702-91162724 TCAGAGACCCAGAAGAAGGAGGG + Intronic
993767588 5:91879907-91879929 ATGGAGACAGAGTAGAAGGATGG - Intergenic
994311005 5:98270509-98270531 AGGAAGACAGGGAAGAAGGAAGG + Intergenic
994356940 5:98803332-98803354 ATGTATAAACAGAAGAAGGAAGG + Intergenic
995412371 5:111873251-111873273 AAGGACACAGAGAAGAAGAACGG + Intronic
995424582 5:112005910-112005932 ATGGAGAGAGAAAAGAGGGAAGG + Intergenic
995469968 5:112490955-112490977 ATAGAGACACAGAGGGAGGAAGG + Intergenic
995557120 5:113341191-113341213 AGAGAGACAGAGAGGAAGGAAGG - Intronic
995558106 5:113351505-113351527 ATGGAGATAGAGGATAAGGATGG + Intronic
995560603 5:113377074-113377096 GCTGAGACACAGCAGAAGGAAGG + Intronic
995771131 5:115671652-115671674 ATGAAGACAGAGTAGAAGGATGG + Intergenic
996007461 5:118440088-118440110 AAGGAGACAGAGAGCAAGGAGGG + Intergenic
996135612 5:119838255-119838277 ATGGAGATAGAGTAGAATGATGG - Intergenic
996553596 5:124755097-124755119 ATGGAGGCAAAGGAGAAAGATGG - Intergenic
996561361 5:124833079-124833101 TTGAAAACACAGAAAAAGGAAGG - Intergenic
997005579 5:129813222-129813244 AGGGAGACACAGTTGAAAGATGG - Intergenic
997076060 5:130678957-130678979 AGGGAGAGAGAGAGGAAGGAAGG + Intergenic
997085462 5:130792508-130792530 ATGGAAATAGAGTAGAAGGATGG + Intergenic
997089896 5:130844438-130844460 CTGGAGACTCAGAAGAGGGGAGG + Intergenic
997109563 5:131059917-131059939 TTGAGGACACAGAAAAAGGATGG - Intergenic
997203860 5:132029872-132029894 AAGAAGAGAAAGAAGAAGGAAGG + Intergenic
997211575 5:132080024-132080046 ATGGAGACACAGGAGAGTGTTGG - Intergenic
997233703 5:132260520-132260542 CTGGAGAGAAAGAAGAAGGAAGG - Intronic
997576430 5:134981090-134981112 AAGAAGAAACAAAAGAAGGAAGG - Intronic
997716756 5:136048363-136048385 ATGGAGGGTCAGAAGAGGGAAGG - Intronic
997952773 5:138255012-138255034 AAGGAGAGAGAGAGGAAGGAAGG + Intronic
997996113 5:138587763-138587785 ATGGAGACACAAAGAAAGGGTGG - Intergenic
998231110 5:140361980-140362002 AAGGAGACACAGAATATGAAAGG - Intronic
998333172 5:141347118-141347140 AGAGAGAAACAGAGGAAGGAAGG - Intronic
998440036 5:142151645-142151667 ATGTAGTCACAAAAGAAGGCAGG - Intronic
998813697 5:145991568-145991590 ACGGAGAAAAAGAAGAAAGAGGG + Intronic
998824059 5:146083332-146083354 ATAGAGACACAGAGGGAAGACGG - Intergenic
998883298 5:146667485-146667507 ATGGAGAAAAAGAAGAAAGCAGG + Intronic
999132552 5:149295604-149295626 ATGGAGAGAAAGAGGAAGGGAGG + Intronic
999410098 5:151343050-151343072 CAGGAGACACAGAACAAGGCAGG + Intronic
999575408 5:152971227-152971249 TTGGAAACTCAGAAGGAGGAGGG + Intergenic
999652174 5:153778141-153778163 AGGGAGAGACAAAGGAAGGAGGG + Intronic
999797406 5:155001467-155001489 ATAGAGACACAGAGGGAAGATGG + Intergenic
999919069 5:156297960-156297982 ATAGAGACAGAGTAGAAGGACGG - Intronic
1000131963 5:158308919-158308941 CTGAAGACATAGAAGAAGGGAGG - Intergenic
1000383678 5:160652142-160652164 AAGGAGACACAGCAGGAGGAAGG - Intronic
1000419863 5:161026409-161026431 ATGAAGTCACAAAAGTAGGAAGG + Intergenic
1000508106 5:162147338-162147360 AAAGAGAGACAGAGGAAGGAAGG - Intronic
1000662978 5:163959143-163959165 ATGGAGGAAGAGAAGAAGGAAGG - Intergenic
1000759676 5:165206810-165206832 ATGGAGACGGAGAACAAAGAGGG + Intergenic
1001214917 5:169846855-169846877 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1001256661 5:170188639-170188661 ATGAGGATAGAGAAGAAGGAGGG + Intergenic
1001421442 5:171590246-171590268 ATGGATGGACAGATGAAGGATGG - Intergenic
1001425399 5:171619141-171619163 TTGGAGACACAGAAAAGTGATGG + Intergenic
1001832970 5:174805080-174805102 GTGAAGACACAGATGCAGGAGGG - Intergenic
1001852632 5:174982924-174982946 AGAGAGAGAGAGAAGAAGGAAGG - Intergenic
1001895345 5:175374601-175374623 TTGGAGACTCAGAAGGAGGGAGG - Intergenic
1002559989 5:180074553-180074575 ATAGAGACAGAAAAGAAGAATGG - Intergenic
1002598250 5:180338303-180338325 ATGGAAAAATAGAAGAAGCAAGG - Intronic
1002899490 6:1399132-1399154 ATGGAGACAGAGAAGAAGGAGGG + Intergenic
1003315853 6:5011350-5011372 AAAGAGACACAGCAGGAGGAAGG + Intergenic
1003350058 6:5308242-5308264 GTGAAGTCACAGAAGCAGGAAGG + Intronic
1003359254 6:5408691-5408713 ATGAACAAACGGAAGAAGGAAGG + Intronic
1003637519 6:7846510-7846532 GGGGAAACACAGAAGGAGGAAGG + Intronic
1003652676 6:7975819-7975841 ATGTAGACAGAGAAGCAGGATGG + Intronic
1003673453 6:8181298-8181320 AGGGAGACAGGGAAGAAGGAAGG - Intergenic
1004002920 6:11612087-11612109 ATTGAGACACTGCAGAAGGAAGG + Intergenic
1004184362 6:13409275-13409297 AGAGAGACAGAGAGGAAGGAAGG + Intronic
1004247474 6:13993664-13993686 AGAGAGAGAGAGAAGAAGGAAGG - Intergenic
1004496888 6:16172878-16172900 ATGGAGAGACAGAAGAGAAAAGG - Intergenic
1004725633 6:18308847-18308869 AAGGAGAGAGAGAGGAAGGAAGG - Intergenic
1004869526 6:19890718-19890740 AAGGAGAAAGGGAAGAAGGAAGG - Intergenic
1004869895 6:19894289-19894311 TTGTAGACACATCAGAAGGAAGG + Intergenic
1005046771 6:21650684-21650706 ATGGAGACACAGCAGGGGGTGGG + Intergenic
1005167588 6:22942290-22942312 ATAGAAAAACAGAAGAATGAGGG + Intergenic
1005200450 6:23338649-23338671 ATGGAGACACACAGGATGTATGG + Intergenic
1005376567 6:25188462-25188484 ATGGAGGCACAGTAGAAAGATGG - Intergenic
1005483061 6:26273033-26273055 ACCAAGGCACAGAAGAAGGATGG + Exonic
1005506773 6:26476088-26476110 AAGGAGACATAGGAGAAGGGAGG - Intronic
1005682736 6:28223085-28223107 AGGGAGACAGGGAAAAAGGAAGG - Intergenic
1005917601 6:30367036-30367058 ATGGAGACACAGAGAAGTGAAGG + Intergenic
1006081322 6:31568850-31568872 TGAGAGACACAGAGGAAGGAAGG - Intergenic
1006213894 6:32421852-32421874 ATGCAGACACACAAAAAGTAAGG + Intergenic
1006241288 6:32681328-32681350 TTGGAGACTCAGAAGAGGGGAGG - Intergenic
1006301754 6:33197323-33197345 ATGGAGACACAGAAGAAGGAAGG + Intronic
1006616152 6:35328497-35328519 AGGGAGAGAGAGAGGAAGGAAGG + Intergenic
1006663799 6:35674020-35674042 AGGGAGAAAGGGAAGAAGGAAGG - Intronic
1006670384 6:35726639-35726661 ATAGGGACTCAGAAGAAAGAAGG - Intronic
1006951085 6:37821059-37821081 TTGGAGACATAGAGGCAGGAAGG + Intronic
1007046753 6:38783529-38783551 AAGGAGAGACACAGGAAGGAAGG - Intronic
1007262777 6:40575409-40575431 ATGGACACAGGAAAGAAGGAGGG + Intronic
1007350064 6:41265870-41265892 ATAGAGACTCAGAAGAGTGAGGG + Intergenic
1007406419 6:41638455-41638477 AGGGAGAGAAGGAAGAAGGAAGG + Exonic
1007425291 6:41742493-41742515 ATGGAGACACAAACGAGGGGAGG + Intronic
1007510544 6:42371330-42371352 AAGGAGACACAGCAGATGAAAGG - Intronic
1007522840 6:42465685-42465707 AGAGAGAGACAGAGGAAGGAAGG - Intergenic
1007602797 6:43093770-43093792 ATGAAGCAACAGAAGAACGAAGG + Intronic
1007865317 6:44962876-44962898 AGGGAGACAGAAAATAAGGAAGG - Intronic
1007985043 6:46198936-46198958 TTTGAGACACAGAAGAGAGAAGG + Intergenic
1008055948 6:46946221-46946243 TTGCAGCCAGAGAAGAAGGAGGG + Intronic
1008117523 6:47569240-47569262 ATGGAAACTCAGAAGAATGGTGG + Intronic
1008369552 6:50716473-50716495 AGGGAGAAAAAGAAGAAGGAAGG + Intronic
1008722045 6:54366574-54366596 ATCGAGATAGAGAAGAGGGAGGG + Intronic
1008996929 6:57669697-57669719 ATTGGGAGGCAGAAGAAGGAGGG + Intergenic
1009278340 6:61714881-61714903 ATGGAGACTCAGAAGAGTGGGGG + Intronic
1009292926 6:61906577-61906599 ATGGAGATAGAGTAGAATGATGG - Intronic
1009318387 6:62253615-62253637 ACTGACACACAGAAGAAGAAGGG + Intronic
1009818767 6:68772313-68772335 AGGGAAATACAGAAGATGGATGG + Intronic
1010028374 6:71245743-71245765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
1010465311 6:76161243-76161265 ATGGGAACCAAGAAGAAGGATGG - Intergenic
1010472780 6:76249555-76249577 CAGGAGACACAGAAGACGGGTGG + Intergenic
1010977008 6:82326572-82326594 TTGGAGACTCAGAAGAAAGGAGG - Intergenic
1011598711 6:89040519-89040541 ATGGTGACACAGAGGTAAGAAGG - Intergenic
1011812083 6:91144402-91144424 AGGGAAGCACAGAAGAAGGAAGG - Intergenic
1012635224 6:101529772-101529794 ATGGGAATTCAGAAGAAGGATGG + Intronic
1012646189 6:101684983-101685005 GAGAAGACACAGAAGCAGGAAGG - Intronic
1012691550 6:102319321-102319343 TTGGAGGCTCAGAAGAAGAAAGG + Intergenic
1012802375 6:103847238-103847260 AGGGAGAGACAGAGGAAGGAGGG + Intergenic
1013073756 6:106752375-106752397 CAGGAGACACAGCAGAGGGATGG - Intergenic
1013105236 6:107021467-107021489 ATGAAGATCCAGAAGAATGAGGG - Intergenic
1013496156 6:110699563-110699585 TTGGAGATTCAGAAGAAGGGAGG + Intronic
1013508649 6:110824407-110824429 CTGGAGACTCAGAAAAGGGAGGG + Intronic
1013724735 6:113080104-113080126 AAAGAGAGAGAGAAGAAGGAAGG + Intergenic
1013954208 6:115821574-115821596 TTAGAGACTCAGAAGAAGAAGGG + Intergenic
1014069661 6:117166891-117166913 CTGGAGACACAGAAGAGAGGTGG - Intergenic
1014088969 6:117381394-117381416 TTGGAGACTCAGAAGGAGGGAGG - Intronic
1014092627 6:117421414-117421436 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1014675700 6:124362522-124362544 ATGGAGACAGAGAATAAGAAAGG - Intronic
1015210663 6:130694865-130694887 ATGGAGAAGCAGCAGCAGGAAGG + Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015402167 6:132798878-132798900 ATGTAGACACAGAAAAGGCAGGG + Intergenic
1015424413 6:133049321-133049343 AGGGAGGGAAAGAAGAAGGAAGG - Intergenic
1015426031 6:133068509-133068531 ATGGAGCTAGAGAAGAAAGAGGG + Intergenic
1015464542 6:133534026-133534048 ATGGAAATAAAGAACAAGGATGG + Intergenic
1015556779 6:134470721-134470743 AGAGAGAGAGAGAAGAAGGAAGG - Intergenic
1015578113 6:134694223-134694245 ATGGAGACAGAGTAGAAGAATGG - Intergenic
1015636266 6:135277801-135277823 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
1015759412 6:136642368-136642390 ATAGTGACACTGAAGAAGGCTGG + Intronic
1015808085 6:137132806-137132828 ATGGCCACACAGAAAAAGAAAGG + Intergenic
1015812878 6:137178921-137178943 ATGGAGACACAGTAGGTGCAGGG + Intergenic
1016110328 6:140215564-140215586 ATGGAGACTCAGAAGTAAGAGGG - Intergenic
1016379174 6:143456176-143456198 ATTTAGACACAGAGGGAGGAAGG + Intronic
1016497622 6:144682176-144682198 ATGGAGATAGAGTAGAAGGATGG - Intronic
1016572788 6:145533519-145533541 ATGGAGGCAGAGAAGTAGGTGGG - Intronic
1016623549 6:146140171-146140193 ATGTAGACAGGAAAGAAGGAAGG - Intronic
1016624536 6:146150737-146150759 ATGGAGATAGAGTAGAAGGATGG - Intronic
1016647068 6:146422995-146423017 AAGGAGGGAAAGAAGAAGGAAGG + Intronic
1016795140 6:148109965-148109987 AGGGAGAGAGAGAGGAAGGAAGG - Intergenic
1016890863 6:149005598-149005620 AGGGAGGGAGAGAAGAAGGAAGG - Intronic
1017055392 6:150431432-150431454 ATGTAGAACCAGAAGCAGGAGGG + Intergenic
1017229154 6:152053401-152053423 AGGGAGAGACAGAAGGAGGAAGG - Intronic
1017265562 6:152441599-152441621 AAGGAAGCACAGAAGAAGGTAGG + Intronic
1017272315 6:152522213-152522235 TTGGAGACTCAGAAGGATGAGGG - Intronic
1017567097 6:155699258-155699280 AAAGAGAAAAAGAAGAAGGAAGG - Intergenic
1017572900 6:155766529-155766551 AGGGAGAGACCGAAGGAGGAAGG - Intergenic
1018012675 6:159685966-159685988 ATGGAGGCGTAGAAGAAGGAGGG - Intronic
1018279478 6:162170147-162170169 ATGGAGACAGAGAGTAAGAAAGG - Intronic
1018377122 6:163223511-163223533 ATGGGAAAGCAGAAGAAGGATGG + Intronic
1018393560 6:163359497-163359519 ATAGAGACACAGAGAAAAGATGG + Intergenic
1019010749 6:168841862-168841884 ATGGAGACAGACAGGAGGGAGGG + Intergenic
1019389994 7:781205-781227 ATGGAGATAGAGCAGAAGGATGG - Intronic
1019393469 7:803022-803044 AAAGAGAGACAGAAGAAAGAAGG + Intergenic
1019684301 7:2372260-2372282 ATGGAGAAAAGGAGGAAGGAAGG + Intronic
1019750968 7:2729565-2729587 ATGCAGAAGCAGAAGAGGGAGGG - Exonic
1019777424 7:2920662-2920684 ATGGATACATAGATGATGGATGG - Intronic
1019868435 7:3735351-3735373 ATAGAGACAAAGTAGAATGATGG - Intronic
1020025775 7:4898912-4898934 AAAGAGAGACAGAGGAAGGAAGG + Intergenic
1020197623 7:6054117-6054139 ATGGAGATAGAGTAGAATGATGG - Intronic
1020970252 7:14928831-14928853 ATGGAGACTCAGATGGATGAGGG - Intronic
1021280259 7:18708282-18708304 ATGGAGAAAAAGAGGGAGGAAGG + Intronic
1021345271 7:19519714-19519736 ATTGAGACACAGAGGAAGAAAGG + Intergenic
1021412479 7:20344063-20344085 ATGGGGACAGAGAGGAAGTAAGG + Intronic
1021662236 7:22931169-22931191 ATGAAGACACACAGGAAAGAAGG + Intergenic
1022184328 7:27952384-27952406 TTGGTGACACAGATGAAGCATGG - Intronic
1022507372 7:30915437-30915459 GTGGAGACACTGCAGAGGGAAGG + Intronic
1024023106 7:45388534-45388556 ACGGGGAGATAGAAGAAGGATGG - Intergenic
1024039348 7:45538478-45538500 ATGCAGAGCAAGAAGAAGGAAGG + Intergenic
1024368923 7:48558186-48558208 AGGGAGAGAGAGAGGAAGGAAGG - Intronic
1024471087 7:49769447-49769469 AAGGAGGGAAAGAAGAAGGATGG - Intergenic
1024833378 7:53487690-53487712 AGGGAGGGAAAGAAGAAGGAAGG - Intergenic
1024962624 7:54993727-54993749 CTGGAGAGACAGAAGAATGTGGG - Intergenic
1025152673 7:56572250-56572272 ATGGAAATAGAGTAGAAGGATGG - Intergenic
1026080139 7:67210663-67210685 ATGGATAGACAGATGACGGATGG - Intronic
1026123247 7:67556120-67556142 AAGGAGAGAGAGAGGAAGGAAGG - Intergenic
1026148683 7:67770199-67770221 AAGAAGAAACATAAGAAGGATGG - Intergenic
1026150852 7:67787117-67787139 AGTGAGACTCTGAAGAAGGAAGG - Intergenic
1026225769 7:68439186-68439208 ATGGAGATAGAGTAGCAGGATGG + Intergenic
1026289083 7:68989791-68989813 ATGGAGACACAGATGGAAGAAGG - Intergenic
1026319269 7:69254802-69254824 AGGGAGAGAGAGAAGAAGGAAGG + Intergenic
1026486885 7:70829568-70829590 ATGGGGAGAGAAAAGAAGGAAGG - Intergenic
1026526357 7:71156681-71156703 AGAGAGACAGAGAGGAAGGAAGG - Intronic
1026680224 7:72461027-72461049 ATGGAGAGAAGGAAGGAGGAAGG - Intergenic
1027408103 7:77884388-77884410 ATGGAGACTCAGAAGGGGTAGGG - Intronic
1027609709 7:80345459-80345481 ATGGAGACTCAGAAGGTGGAGGG + Intergenic
1027823996 7:83087287-83087309 TTGGAGACTCAGAAGCAGGGAGG + Intronic
1028123910 7:87089354-87089376 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
1028161741 7:87493592-87493614 ATGGAGACATGGAATAAAGAAGG + Intergenic
1028396104 7:90369994-90370016 TTGGAGACTCAGAGGGAGGAAGG + Intronic
1028454940 7:91028051-91028073 CTGGAGACTCAGAAGCAGGAAGG - Intronic
1028524961 7:91773787-91773809 ATGGATACTAAGAAAAAGGAAGG - Intronic
1028669551 7:93385980-93386002 GTGGAAACACAGAGGATGGAGGG + Intergenic
1028967498 7:96818269-96818291 TTGGAGACTCAGAAGAGGGGTGG - Intergenic
1029653973 7:101912244-101912266 ATGGAGATAGAGGAGGAGGAGGG - Intronic
1029748732 7:102531164-102531186 AAGGAGAGAGAGAGGAAGGAAGG - Intergenic
1029766679 7:102630248-102630270 AAGGAGAGAGAGAGGAAGGAAGG - Intronic
1029835143 7:103301514-103301536 AAGGAGAAACAGAAAAAGGAAGG + Intronic
1030060997 7:105621219-105621241 ATTGACAAAAAGAAGAAGGAAGG - Intronic
1030294178 7:107903895-107903917 ATGGGGAGATAGAGGAAGGAAGG + Intronic
1030369132 7:108677086-108677108 ATGGAAAGAGAGTAGAAGGATGG - Intergenic
1030377810 7:108773696-108773718 AAGGAGAGATGGAAGAAGGAAGG - Intergenic
1030412418 7:109198134-109198156 ATGCAGACACAGAGGCCGGAGGG + Intergenic
1030749063 7:113207210-113207232 AAGGAGACTCAGCAGAAGAAAGG - Intergenic
1030942417 7:115670499-115670521 ATAGTTACACAGAAGGAGGAAGG + Intergenic
1030963242 7:115953523-115953545 CTGCAGACACAGAAGAGAGAAGG + Intronic
1031003674 7:116447250-116447272 TTGGAGACTCAGAAGAGGGAGGG + Intronic
1031274458 7:119701643-119701665 AGGGAGACACATATGAAGGAAGG - Intergenic
1031492510 7:122406466-122406488 AGGAAGACAGGGAAGAAGGAAGG + Intronic
1031674464 7:124591518-124591540 TTAGAGACTCATAAGAAGGAAGG + Intergenic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1032228851 7:130056183-130056205 AGAGAGAGAGAGAAGAAGGAAGG + Intergenic
1032592882 7:133208508-133208530 AATGAGACCCAGAAGAAAGAAGG - Intergenic
1032680201 7:134174660-134174682 AGGGAGACAGAGAAGAAAGTGGG + Intronic
1032911774 7:136440513-136440535 CAGGAGACAGAGAAGAGGGAGGG - Intergenic
1033225697 7:139560511-139560533 ATGGAGACAGAGTAGAAGGGTGG + Intergenic
1033421183 7:141205918-141205940 ATGGAAACAGAGACCAAGGAAGG - Intronic
1033459092 7:141529222-141529244 ATGGAGACACAGACACACGAGGG - Intergenic
1033593679 7:142837682-142837704 AAAGAGAGAGAGAAGAAGGAAGG + Intergenic
1033656978 7:143381288-143381310 AGGGACACACGGAAGGAGGAGGG - Exonic
1033974927 7:147089272-147089294 ATGGAGACAATGAAGTGGGAGGG - Intronic
1034260830 7:149754223-149754245 AGAGAGACATAGATGAAGGAAGG - Intergenic
1034277269 7:149829401-149829423 AGGGGGACACAGGAGGAGGAGGG - Intergenic
1034995106 7:155572074-155572096 AGGGAGAAAGAGAGGAAGGAAGG + Intergenic
1035343219 7:158178354-158178376 TTGGAGACTCAGAAGCGGGAGGG - Intronic
1035543755 8:462732-462754 TTGGAGACTCAGAAGAGGGAAGG + Intronic
1035582708 8:749919-749941 GTGGAGACAGAGAAGCAGGCTGG - Intergenic
1036125976 8:6062270-6062292 CTGGAGACACAGAAAGAGAAAGG + Intergenic
1036218754 8:6902809-6902831 ATGGAGTCACAGGACAAGCAAGG + Intergenic
1036546121 8:9771460-9771482 AGGGAGGGAGAGAAGAAGGAAGG + Intronic
1036576805 8:10035152-10035174 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1036596246 8:10215015-10215037 ATGGAGTCACAGAGGAGGGTGGG + Intronic
1036688508 8:10926973-10926995 GGAGAGACACAGAAGTAGGAGGG + Intronic
1036783212 8:11664785-11664807 TTAGAGACTCAGAAGAAAGAGGG - Intergenic
1036986961 8:13543828-13543850 TTGGAGACTCAGAAGAGGGGAGG + Intergenic
1037224410 8:16567693-16567715 TGGGAAACACAGAAAAAGGAAGG + Intergenic
1037659553 8:20915223-20915245 AAGGAGACACAGAGTAAGGCAGG + Intergenic
1037674244 8:21040713-21040735 ATAGAGACAGAGATGAGGGAGGG - Intergenic
1037733149 8:21546116-21546138 ATGGGGATGCAGGAGAAGGAGGG + Intergenic
1038129217 8:24710663-24710685 ATGGAGGAACAGAGTAAGGAGGG + Intergenic
1038324819 8:26564927-26564949 TTGGAGACTCAGAAGAAGGAGGG - Intronic
1038896888 8:31793882-31793904 ATGGAGAGATGGAAGGAGGAAGG - Intronic
1038957744 8:32485572-32485594 AAGCAGACACTCAAGAAGGAAGG + Intronic
1039187163 8:34930401-34930423 AAAGAGAGAGAGAAGAAGGAGGG + Intergenic
1039311883 8:36325224-36325246 TTGGATACACAGAGGCAGGATGG - Intergenic
1039455942 8:37706682-37706704 AAGGAGAGAGAGAGGAAGGAGGG + Intergenic
1039945647 8:42126766-42126788 TTGGAGACAGAGAAGGAGGGAGG - Intergenic
1039995073 8:42525170-42525192 AAGGAAATACAGAAAAAGGAAGG + Intronic
1040087320 8:43358137-43358159 TTGGAGACTCAGAAGAAGGAAGG - Intergenic
1040405186 8:47094743-47094765 TTGGAGACTCAGAAGAAGAAAGG + Intergenic
1040970397 8:53130002-53130024 TTGGAGACTCAGAAACAGGAGGG - Intergenic
1041155775 8:54985368-54985390 ATGGAGGGAGAGAGGAAGGAAGG + Intergenic
1041277492 8:56177884-56177906 CTGGGGACACAGAAGCAGTACGG - Intronic
1041524933 8:58794821-58794843 CTGGAGAAAGAGAAGCAGGAAGG + Intergenic
1041744988 8:61198722-61198744 TTGGAGACTTAGAAGAAGGGAGG - Intronic
1041937351 8:63348477-63348499 TTGGAGACTCAGAAGAGGCAAGG - Intergenic
1041982104 8:63873767-63873789 ATGGACGAACAGAAGAAAGAAGG + Intergenic
1042159217 8:65875106-65875128 ATGGGGATCCAGAAGCAGGATGG + Intergenic
1042397696 8:68311080-68311102 AAGGAGACAGGGAAGGAGGAAGG - Intronic
1042397832 8:68311941-68311963 AGGGAGACAGGGAAGGAGGAAGG - Intronic
1042750588 8:72153709-72153731 GTGGAGCCCCAGGAGAAGGAAGG - Intergenic
1042784496 8:72533329-72533351 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1043084454 8:75810918-75810940 ATGAAGAGGAAGAAGAAGGAAGG - Intergenic
1043119402 8:76303724-76303746 ATGGAGAAAGGGAGGAAGGAAGG + Intergenic
1043196304 8:77296478-77296500 TTGGAGACACAGCTGAATGATGG + Intergenic
1043412981 8:80018956-80018978 ATGGAGACAGAGTAGAAGGATGG + Intronic
1043475038 8:80597809-80597831 AGGGAGAGAAAGAGGAAGGAAGG - Intergenic
1043775098 8:84256891-84256913 AGCGAGACACAGAAGAACGTGGG - Intronic
1044143401 8:88683066-88683088 CTGGAGACACTGAAGTAGGGTGG + Intergenic
1044471592 8:92575511-92575533 ATGGAGACAATGAAGGAAGAAGG - Intergenic
1044622475 8:94203819-94203841 AGGAAGACAGGGAAGAAGGAAGG + Intronic
1044746676 8:95377618-95377640 ATGGAGACAGAGACGAAGACTGG - Intergenic
1044891762 8:96843391-96843413 AAGGAAAGAAAGAAGAAGGAAGG + Intronic
1044918700 8:97145189-97145211 TTGGAGACTCAGAAGCAGGGAGG - Intronic
1044962541 8:97544909-97544931 ATGGGGTCAAAGAGGAAGGAGGG + Intergenic
1045054901 8:98360381-98360403 ATGGAGACACAGAGGGAAGAAGG - Intergenic
1045065223 8:98438063-98438085 TTGGAGGCTCAGAAGGAGGATGG + Intronic
1045322547 8:101092740-101092762 AGAGAGAGAAAGAAGAAGGAAGG - Intergenic
1045353551 8:101364282-101364304 ATGAACACACAGGAAAAGGAAGG - Intergenic
1045355920 8:101388996-101389018 ATGGGGACAGAGAAGGAGGATGG - Intergenic
1045372255 8:101536031-101536053 ATTTAGACAGAGAAGCAGGAAGG + Intronic
1045434773 8:102151284-102151306 ATGGAGACACAGTAAATGCAAGG + Intergenic
1045756064 8:105543736-105543758 TTGAATACACAAAAGAAGGAAGG - Intronic
1045995237 8:108354218-108354240 ATGGAGATAGAGTAGAAGGCTGG + Intronic
1046042409 8:108921846-108921868 ATGGAGAGACAGAAAAAAGAAGG + Intergenic
1046211188 8:111079352-111079374 ATGGAGATAGAGTAGAAGCATGG - Intergenic
1046476104 8:114745897-114745919 ATAGAAAAACAGAGGAAGGAAGG + Intergenic
1046531922 8:115457417-115457439 ATAGAGATAGAGAAGAAGGGTGG + Intronic
1046565440 8:115893597-115893619 ATGGAGTCAGAGAAGTAAGAGGG + Intergenic
1046918088 8:119698875-119698897 ATGGAGAGACAGAAACAGAAGGG - Intergenic
1047029351 8:120860266-120860288 ATGGAAACACAGAAGAAACCTGG - Intergenic
1047106078 8:121731900-121731922 TTGGAGACTCAGAAGGAAGAGGG - Intergenic
1047177644 8:122556593-122556615 AAGGGGACAAAGAAGAAGGAAGG + Intergenic
1047889185 8:129288458-129288480 ATAAAGACTCAGAAGAGGGAGGG + Intergenic
1047893787 8:129342995-129343017 ATGGAGACACAGTAGGAAGGAGG + Intergenic
1047927195 8:129693358-129693380 ACACAGACACAGCAGAAGGAAGG + Intergenic
1048073828 8:131047072-131047094 AAGGAAAAACAGAAGAAGGCAGG - Intergenic
1048147303 8:131857978-131858000 ATGGAGAAGGAGAAGAAAGAAGG - Intergenic
1048232174 8:132653210-132653232 ATGGATAGATGGAAGAAGGAAGG + Intronic
1048361330 8:133699627-133699649 ATGAAGACACACATGAAAGACGG + Intergenic
1048366402 8:133742529-133742551 AGGGAGAAAGAAAAGAAGGAAGG + Intergenic
1049429582 8:142553918-142553940 ATAAACACAAAGAAGAAGGAAGG - Intergenic
1049569558 8:143362793-143362815 ATGGAGGCTCAGAAGACCGAAGG - Intergenic
1050301132 9:4260010-4260032 ATGGAAACACAGAGGGAGAAAGG + Intronic
1050475621 9:6037824-6037846 TTGGAGACTCAGAAGAATGTAGG - Intergenic
1051043748 9:12848469-12848491 ATTGAGACACAGAACAGGCAAGG + Intergenic
1051455202 9:17247544-17247566 AAAGAGGCACTGAAGAAGGAAGG - Intronic
1051545031 9:18264085-18264107 ATGGAGACACAGCAGACAGGAGG - Intergenic
1051822516 9:21184209-21184231 AAGGAGAGAAAGAAAAAGGAAGG - Intergenic
1051910415 9:22148722-22148744 AGTGAGAGACAGAAGAGGGAGGG - Intergenic
1052177931 9:25486923-25486945 AGGGAGACTCTGAAGAAGGTTGG + Intergenic
1052551488 9:29955834-29955856 ATGGAGACTCAGAATGGGGAGGG - Intergenic
1052638064 9:31128394-31128416 ATGGAAACACATAAATAGGAAGG + Intergenic
1052768674 9:32667751-32667773 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1052995242 9:34548421-34548443 ATGGAGACACAAGAGACAGAGGG + Intergenic
1053067402 9:35078319-35078341 CTGGAGACACAGGAGCAGCAGGG - Exonic
1053107380 9:35422982-35423004 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1053346219 9:37380170-37380192 AGGGAGAAAGAGAAGAAGGGAGG + Intergenic
1053373755 9:37586496-37586518 ATGGAGACAGAGTAGAATGATGG + Intronic
1053433659 9:38060729-38060751 ATGGAGCCACAGGAGATGCAGGG - Intronic
1053487411 9:38470431-38470453 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1053524852 9:38818032-38818054 CTGGAGACTCAGAAGCGGGAGGG - Intergenic
1053532198 9:38893854-38893876 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1053550237 9:39070477-39070499 ATGGATATAGAGTAGAAGGATGG + Intergenic
1053750017 9:41243742-41243764 ATGGAGAACCAGGAGAAAGAAGG - Intergenic
1053814348 9:41890588-41890610 ATGGATATAGAGTAGAAGGATGG + Intronic
1054197086 9:62042448-62042470 CTGGAGACTCAGAAGCGGGAGGG - Intergenic
1054204421 9:62118263-62118285 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1054255516 9:62808080-62808102 ATGGAGAACCAGGAGAAAGAAGG - Intergenic
1054335789 9:63807528-63807550 ATGGAGAACCAGGAGAAAGAAGG + Intergenic
1054616248 9:67296852-67296874 ATGGATATAGAGTAGAAGGATGG - Intergenic
1054633940 9:67470101-67470123 TTGGAGACTCAGAAGCAGGAAGG - Intergenic
1054641322 9:67546246-67546268 CTGGAGACTCAGAAGCGGGAGGG + Intergenic
1054728297 9:68674875-68674897 AGGGAGAAAAAAAAGAAGGAAGG - Intergenic
1055001723 9:71458227-71458249 AAGGAGACCCAGAAGAACAAAGG + Intergenic
1055122606 9:72679631-72679653 ATGGAGACACAGCAAATGGATGG - Intronic
1055730271 9:79273801-79273823 AAGGAGAGAAAGAGGAAGGAAGG + Intergenic
1056320348 9:85429601-85429623 GTAGAGACCCAGAAGAAGAATGG + Intergenic
1056327355 9:85490915-85490937 ATGGGGAGCCAGAAGGAGGATGG - Intergenic
1056545054 9:87606478-87606500 AGGGAGAGACAGAGGGAGGAAGG - Intronic
1056597672 9:88021038-88021060 AAGGAGAGAGAGAAGAAGGAAGG - Intergenic
1057076142 9:92139113-92139135 AAGGAGACAGAGAAGGAGCAGGG - Intergenic
1057298758 9:93864426-93864448 AGGGAGACAGAGTAGAAGAAAGG - Intergenic
1057470686 9:95353598-95353620 AAGGAGAGAAAGAGGAAGGAAGG - Intergenic
1057756770 9:97845436-97845458 AGGAAGACACAGAGGAAGGCAGG - Intergenic
1057936613 9:99244930-99244952 AGGGAGACTGGGAAGAAGGAAGG + Intergenic
1058111228 9:101032462-101032484 AGGAGCACACAGAAGAAGGAAGG - Intronic
1058348043 9:103988003-103988025 TTGGAGACTCAGAAGTAGGTAGG + Intergenic
1058404869 9:104661433-104661455 ATGGAGCCTCACATGAAGGAAGG + Intergenic
1058463933 9:105209617-105209639 ATGGAGACTCAGAAGGAGAAGGG - Intergenic
1058635444 9:107033867-107033889 ATGAAGAAACAGACTAAGGAAGG - Intergenic
1058876616 9:109250214-109250236 ACGGAGGCCCAGAAGTAGGAAGG + Intronic
1059608535 9:115864857-115864879 AGAGAGACAGAGAGGAAGGAAGG + Intergenic
1059635273 9:116164273-116164295 AGGAAGAGAGAGAAGAAGGAGGG - Intronic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1059828225 9:118058118-118058140 ATGGAGACTCAGAAGCCTGAGGG - Intergenic
1060165716 9:121412849-121412871 AGGGAGAGACAGAGGAGGGAGGG - Intergenic
1060273411 9:122164234-122164256 AAGGAGAAAAAGAAGAAGGGAGG + Intronic
1060338276 9:122748690-122748712 ATAGAGACTCAGAAGAAGTGGGG - Intergenic
1060592701 9:124828960-124828982 AAGGAGAGAGAGAGGAAGGAAGG - Intergenic
1060592713 9:124829028-124829050 AAGGAGAGAGAGAGGAAGGAAGG - Intergenic
1060935554 9:127513256-127513278 ATGGAGATAGAGTAGAAAGATGG + Intronic
1061156189 9:128863197-128863219 AAGTAGACACACAAGGAGGAGGG + Intronic
1061302028 9:129710892-129710914 GTGAAGACAGAAAAGAAGGAAGG - Intronic
1061307969 9:129743283-129743305 ATGGAGACACCAAGGAATGATGG + Intronic
1061372966 9:130208163-130208185 ATGTAGGCAGAGAAGAAAGATGG + Intronic
1061649858 9:132038794-132038816 CAGGAGACAGGGAAGAAGGAAGG + Intronic
1061727718 9:132590482-132590504 ATGGAGACAGAGGAGGAGGAGGG - Intergenic
1062044396 9:134418369-134418391 ACGGAGACACAGATGAAGACTGG - Intronic
1062090661 9:134677073-134677095 GGGGAGACACAGAAGAGGCAGGG + Intronic
1062201271 9:135304094-135304116 ATGGATAGACAGATGATGGAGGG + Intergenic
1203375716 Un_KI270442v1:374937-374959 ATGGAGAACCAGGAGAAAGAAGG + Intergenic
1203657382 Un_KI270753v1:11337-11359 ATCAAGACGCAGAGGAAGGAAGG - Intergenic
1185461801 X:336301-336323 ATGGACACACAGAGGAACCACGG + Intronic
1185498364 X:576887-576909 ATGGACACCCAGAAGAGGCAGGG + Intergenic
1185499060 X:583999-584021 AGGGAGACAGAGGAGGAGGAGGG + Intergenic
1185535149 X:855191-855213 AGGGAGGGACAGAGGAAGGAAGG - Intergenic
1185574897 X:1163614-1163636 AAGGAAAGAAAGAAGAAGGAAGG + Intergenic
1185591993 X:1283359-1283381 AGGGAGGGACGGAAGAAGGAAGG - Intronic
1185593066 X:1291427-1291449 ATGAAGAAAAAGAGGAAGGAAGG - Intronic
1185708450 X:2282577-2282599 AGGGAGAGAGAGAAGAAAGAGGG + Intronic
1185766964 X:2733140-2733162 AGGGAGAGACAGAGGAAGGCAGG - Intronic
1185803289 X:3032598-3032620 AGGGAGAGACAGAAGAGGGAGGG + Intronic
1185807715 X:3075868-3075890 ATGGAGAGAGAGAAGAAGAGAGG - Intronic
1185825385 X:3244271-3244293 ATGGATAAACAGAGGAAGGAAGG + Intergenic
1185998961 X:4987314-4987336 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1186020138 X:5245529-5245551 AGAGAGACAAAGAAGAAGGAAGG - Intergenic
1186421881 X:9433095-9433117 ATGGGGACACAGCCCAAGGATGG - Intergenic
1186622798 X:11259165-11259187 ATGGATAGAGAGTAGAAGGACGG - Intronic
1186962611 X:14752935-14752957 CCAGAGACAGAGAAGAAGGAAGG - Intergenic
1187096197 X:16151024-16151046 ATGGAGACAAAGCAGGAGGCTGG + Intronic
1187206523 X:17186911-17186933 TTGGAGACTCAGAAGCAGGGAGG + Intergenic
1187716601 X:22108342-22108364 TTGGAGACTCAGAAGCAGGGAGG + Intronic
1187843071 X:23508871-23508893 TTGGAGGCACAGAAGAAGATAGG + Intergenic
1188009536 X:25041592-25041614 ATGGAGACACAGAGAGAGGATGG - Intergenic
1188158741 X:26774966-26774988 ATGGAGACTCAGAAAGGGGAAGG + Intergenic
1188303982 X:28539840-28539862 ATGCAGACACAGAAGGAAGATGG + Intergenic
1188579650 X:31695234-31695256 ATGGAGACAGAATAAAAGGATGG + Intronic
1188711195 X:33401198-33401220 ATGGAGAGAGTGAAGAGGGAAGG + Intergenic
1188747390 X:33862798-33862820 ATGGAGACAGAGCAGAAGGATGG - Intergenic
1188896277 X:35672278-35672300 AAGAAGATAAAGAAGAAGGAAGG - Intergenic
1189129401 X:38482416-38482438 ATGGAGACTCAGAGGAATGCTGG - Intronic
1189203767 X:39220193-39220215 ACGCAGACTCAGAAGAAAGATGG - Intergenic
1189575801 X:42351932-42351954 ATGAAGACACAGAAGAGTGAGGG - Intergenic
1189599305 X:42605585-42605607 AGGAAGACCCAGAAGAAGAAAGG - Intergenic
1189675518 X:43456933-43456955 AAGGAGAGAGAGAGGAAGGAAGG + Intergenic
1190056340 X:47183215-47183237 ATGGAGACTCAAAAGGTGGAGGG + Intronic
1190065720 X:47240596-47240618 ATGGAGACCCGCAAGAAAGATGG + Exonic
1190257897 X:48777589-48777611 ATGAAGGAATAGAAGAAGGAAGG + Intergenic
1190943008 X:55061773-55061795 ATGGAGATAGAGTAGAAGGGTGG - Intergenic
1191059449 X:56279017-56279039 ATGTAGGCACTGCAGAAGGATGG + Intronic
1191081604 X:56517137-56517159 ATGGAGATAGAGTAGAATGATGG + Intergenic
1191794703 X:65008771-65008793 ATGGAGATAGAGTAGAATGATGG + Intronic
1191834546 X:65449839-65449861 TTGGAGACTCAGAAGCATGAGGG + Intronic
1192002240 X:67165349-67165371 ATGGACATAGAGTAGAAGGATGG + Intergenic
1192097084 X:68223534-68223556 TTGGAGACTCAGAAAAAGGGTGG + Intronic
1192098515 X:68239071-68239093 ATGGGGAGCCAGAAGGAGGATGG + Intronic
1192511427 X:71722654-71722676 AGGGAGACACAGAGGGAGTATGG - Intergenic
1192515270 X:71758851-71758873 AGGGAGACACAGAGGGAGTATGG + Intergenic
1192530665 X:71881049-71881071 CTGGACACAGAGTAGAAGGATGG + Intergenic
1192842577 X:74872391-74872413 AGGGATAGACAGCAGAAGGATGG + Intronic
1193279904 X:79634965-79634987 ATGGAGACAGAGTAGAATGATGG - Intergenic
1193470943 X:81902571-81902593 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
1193601538 X:83512572-83512594 ATGGAGAGGAAGAAGAAGGATGG - Intergenic
1193617174 X:83703485-83703507 TTGGAGACTCAGAAGTAGGAGGG - Intergenic
1193650848 X:84129806-84129828 ATGGAAATAGAGTAGAAGGATGG + Intronic
1193696525 X:84713378-84713400 AGGGAGATACAGGAGAGGGAAGG - Intergenic
1193891229 X:87048209-87048231 TTGGAGATAGAGTAGAAGGATGG - Intergenic
1194222546 X:91213611-91213633 ATATAGAGACAGAGGAAGGAGGG + Intergenic
1194408204 X:93524373-93524395 ACGGAGCCAGAGTAGAAGGATGG - Intergenic
1194453931 X:94079529-94079551 TTGGAGACTCAGAAGCAGGGAGG - Intergenic
1194563252 X:95448537-95448559 ATGGAAACAGAGTAGAAGAATGG - Intergenic
1194903188 X:99540672-99540694 ATGGAGTCCCAGAAGGAGAAAGG + Intergenic
1195010283 X:100726931-100726953 ATGGAGACTCAGAAGGGTGAGGG - Intronic
1195089807 X:101448019-101448041 ATGGAGATAGAGTAGAAGGATGG - Intronic
1195662490 X:107393703-107393725 ATGGAGATAAAGTAGAAGGATGG - Intergenic
1195708083 X:107752544-107752566 CTGGAGACAAAGAACAAGGAAGG + Intronic
1195870566 X:109481029-109481051 ATGAAGGGAGAGAAGAAGGAAGG + Intronic
1196074837 X:111564401-111564423 ATGGAGAAAGAGTAGAAGGATGG - Intergenic
1196465623 X:115969091-115969113 CAGGAGACACAGAAGATGGAGGG - Intergenic
1196557934 X:117112704-117112726 TTGGAGACTCAGAAGCAGGAGGG + Intergenic
1196601535 X:117606447-117606469 ATGAAGATAGAGTAGAAGGATGG + Intergenic
1197048661 X:122031291-122031313 TTAGAGACCCAGAAGGAGGAGGG - Intergenic
1197526732 X:127573927-127573949 ATGGAGATAGAGTAGAAGGATGG - Intergenic
1197571314 X:128154156-128154178 TTGGAGACTCAGAAGTAGGAGGG + Intergenic
1197616691 X:128699912-128699934 ATGGAGGAAGAGAAGAAGGGAGG + Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1197816933 X:130507307-130507329 ATGGGGCAACAAAAGAAGGATGG - Intergenic
1197821169 X:130542333-130542355 AGGGAGACACAGAAGGGAGATGG - Intergenic
1198027011 X:132716949-132716971 ATGCTGACACAGACCAAGGATGG + Intronic
1198038327 X:132823431-132823453 TTAGAGACTCAGAAGGAGGAGGG - Intronic
1198178047 X:134174368-134174390 TTGGAGAGACAGAAGAAGGTTGG + Intergenic
1198215205 X:134549349-134549371 AGGGAGACAGGGAGGAAGGAAGG + Intergenic
1198224450 X:134632456-134632478 ATGGTGACAGAGAAGAAGGGAGG - Intronic
1198229169 X:134673274-134673296 ATGGAGGAAGGGAAGAAGGAAGG + Intronic
1198417189 X:136432612-136432634 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1198593215 X:138207750-138207772 ATGGACACTCATAAGAAGAAAGG + Intergenic
1198761238 X:140034719-140034741 AGGGAAAAACAGAAGAGGGAAGG + Intergenic
1198767210 X:140091743-140091765 ATGGAGGAGCAGCAGAAGGAGGG + Intergenic
1198801548 X:140452773-140452795 TTGGAGATACAGAAGGAGCAGGG + Intergenic
1198831223 X:140752763-140752785 AAGGACACACAGATGAGGGAAGG - Intergenic
1199387873 X:147243980-147244002 ATGGAGAAAAAGAAGAAGGAAGG - Intergenic
1199616747 X:149661925-149661947 ATAGAGACAGAGTAGAAGGATGG - Intergenic
1199625894 X:149741323-149741345 ATAGAGACAGAGTAGAAGGATGG + Intergenic
1199849414 X:151714794-151714816 AAGGAGGAAAAGAAGAAGGAAGG - Intergenic
1200559074 Y:4677376-4677398 ATATAGAGACAGAAGAAGGAGGG + Intergenic
1200686071 Y:6261103-6261125 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1200773093 Y:7145341-7145363 ATGGAGACAAAGTAGAATGGTGG + Intergenic
1200783796 Y:7240846-7240868 AGGGAGGGAGAGAAGAAGGAAGG - Intergenic
1200991607 Y:9352350-9352372 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1200994263 Y:9372626-9372648 TTGGAGAAACAGAAAAAGGTTGG - Intronic
1200996927 Y:9392966-9392988 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1200999442 Y:9461518-9461540 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1201002097 Y:9481824-9481846 TTGGAGAAACAGAAAAAGGTTGG - Intronic
1201004762 Y:9502110-9502132 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1201007415 Y:9522436-9522458 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1201010023 Y:9542288-9542310 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1201066313 Y:10098629-10098651 ATGGAGAACCAGGAGAAAGAAGG - Intergenic
1201191592 Y:11448194-11448216 AGGGAGACAGAAAGGAAGGACGG + Intergenic
1201253811 Y:12087759-12087781 ATGGATAAACAGAGGAAGGAAGG - Intergenic
1201452070 Y:14127767-14127789 ATGGAGAAAAAGAAGAGGAAAGG - Intergenic
1201461518 Y:14230648-14230670 AAGGAGAAAGAAAAGAAGGAAGG + Intergenic
1201461533 Y:14230782-14230804 AGGGAGACAGAGAGGGAGGAAGG + Intergenic
1201461675 Y:14232565-14232587 AAGAAGAAGCAGAAGAAGGAAGG - Intergenic
1201517700 Y:14835664-14835686 ATGGAGACAAAAAAGAAGGAAGG + Intronic
1201584368 Y:15544756-15544778 ATAGAGACTCTGCAGAAGGAGGG + Intergenic
1201651045 Y:16287316-16287338 ATAGAGAGATAGATGAAGGATGG - Intergenic
1201696201 Y:16829142-16829164 ATTGAGGGACAGAGGAAGGAAGG + Intergenic